ID: 964303805

View in Genome Browser
Species Human (GRCh38)
Location 3:155319091-155319113
Sequence ATAAGTAATATGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964303802_964303805 -9 Left 964303802 3:155319077-155319099 CCACACACTTGCAGATAAGTAAT No data
Right 964303805 3:155319091-155319113 ATAAGTAATATGAATGTGGAGGG No data
964303800_964303805 24 Left 964303800 3:155319044-155319066 CCATGCTCTCTCTCATTCGGGCC No data
Right 964303805 3:155319091-155319113 ATAAGTAATATGAATGTGGAGGG No data
964303801_964303805 3 Left 964303801 3:155319065-155319087 CCAGAACAAAAACCACACACTTG No data
Right 964303805 3:155319091-155319113 ATAAGTAATATGAATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964303805 Original CRISPR ATAAGTAATATGAATGTGGA GGG Intergenic
No off target data available for this crispr