ID: 964305225

View in Genome Browser
Species Human (GRCh38)
Location 3:155332493-155332515
Sequence CATCATATACTAAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964305218_964305225 13 Left 964305218 3:155332457-155332479 CCTCTGAAACTGCTCCCCTCAAA No data
Right 964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG No data
964305219_964305225 -1 Left 964305219 3:155332471-155332493 CCCCTCAAATTAAAAAACGTTAC No data
Right 964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG No data
964305220_964305225 -2 Left 964305220 3:155332472-155332494 CCCTCAAATTAAAAAACGTTACA No data
Right 964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG No data
964305221_964305225 -3 Left 964305221 3:155332473-155332495 CCTCAAATTAAAAAACGTTACAT No data
Right 964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964305225 Original CRISPR CATCATATACTAAGGGCAGA GGG Intergenic
No off target data available for this crispr