ID: 964309608

View in Genome Browser
Species Human (GRCh38)
Location 3:155378692-155378714
Sequence CTGTGTTTCTAGTAGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 1, 2: 0, 3: 24, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964309608_964309610 8 Left 964309608 3:155378692-155378714 CCTGGAAACTACTAGAAACACAG 0: 2
1: 1
2: 0
3: 24
4: 250
Right 964309610 3:155378723-155378745 TTTTAGTGTGAGTTCAAAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964309608 Original CRISPR CTGTGTTTCTAGTAGTTTCC AGG (reversed) Intronic
904422961 1:30405822-30405844 CTGTGTTTCCAGCAGCTACCCGG - Intergenic
906220507 1:44074527-44074549 CTGTGTGTCTAGAAGCTGCCAGG + Intergenic
907330304 1:53666650-53666672 CTGTGTTTCTGGTGGTTTTGGGG - Intronic
907856346 1:58307546-58307568 CTGAGTTTCTACTAGATTCCAGG + Intronic
908204118 1:61827825-61827847 CTTTGTTTTTAGTAATTGCCTGG + Intronic
908204315 1:61829659-61829681 CTGTGTTTATAGAAATTTCAAGG - Intronic
909300072 1:74002021-74002043 CCTAGTTTCTGGTAGTTTCCTGG + Intergenic
909869463 1:80721436-80721458 TTGTGTTTCTACTTGTTTCAAGG + Intergenic
910361655 1:86418325-86418347 CTGTGTTCCTACTAGATGCCAGG - Intergenic
910985304 1:92999209-92999231 CAGTGTTTCTAGAAGTCTCTGGG - Intergenic
911046210 1:93630954-93630976 CTGGATTTGTATTAGTTTCCAGG + Intronic
913358640 1:117953461-117953483 CTTTGTTTCTGGCAGGTTCCAGG + Exonic
916116623 1:161490188-161490210 CTGTGTTTCCAGGTGTTCCCAGG - Intergenic
916181030 1:162083781-162083803 CTGTATTTTTATTAGTTTTCAGG - Intronic
918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG + Intergenic
920162243 1:204007997-204008019 CTTTGTTTATACTATTTTCCAGG - Intergenic
921824050 1:219651674-219651696 CTGTGATTCCAGTAGTTTGTTGG + Intergenic
1063121656 10:3109069-3109091 CTGTGTTTCTAGTGAGTTTCTGG + Intronic
1063992727 10:11583854-11583876 TTGTATTTTTAGTAGTTTTCAGG - Intronic
1065583784 10:27198146-27198168 TTATGTTTCTATTACTTTCCAGG + Intronic
1068605152 10:58997128-58997150 CTGTATTTCTAATAGGTTTCTGG + Intergenic
1068872335 10:61958617-61958639 CTTTATTTCTAGTAATATCCTGG - Intronic
1072319812 10:94238071-94238093 GAGTGTTTCTAGTGGTTTTCTGG - Intronic
1075950557 10:126474051-126474073 CTGTGTGTCTAGCAAGTTCCTGG - Intronic
1076447006 10:130522572-130522594 CTGTTTTTCTATTTGTTTCCAGG - Intergenic
1077729521 11:4714751-4714773 ATGTGTTTCAAGTTATTTCCTGG - Intronic
1078622592 11:12922754-12922776 CTGTATTTCTAGTAGTAACAGGG - Intronic
1080432503 11:32211746-32211768 CTGTGTTCATAGGAGATTCCCGG + Intergenic
1080432513 11:32211818-32211840 CTGTGTTCATAGGAGATTCCAGG + Intergenic
1081245992 11:40766920-40766942 TTGTGTTTCTGGTTGTTTTCTGG - Intronic
1081761408 11:45578652-45578674 CTGTGTTTCTATCACTTGCCAGG - Intergenic
1085925705 11:81017919-81017941 CTGTGTTTCTTGTACTTGCTTGG - Intergenic
1088541662 11:110919856-110919878 TTCTGTTTCTTGTAGTTTTCTGG + Intergenic
1091431064 12:435044-435066 CTGTGTTTCATCTAGTTTCATGG + Intronic
1091431082 12:435202-435224 CTGTGTTTCATCTAGTTTCATGG + Intronic
1091431091 12:435281-435303 CTGTGTTTCATCTAGTTTCATGG + Intronic
1091431100 12:435360-435382 CTGTGTTTCATCTAGTTTCATGG + Intronic
1091929854 12:4386879-4386901 CTCTGTTTCTGCTGGTTTCCAGG - Intergenic
1092666395 12:10804237-10804259 TTGTATTTTTAGTAGATTCCGGG + Intergenic
1093071691 12:14712114-14712136 CTGTATTTCTAGAAGTTGCTGGG - Intergenic
1094310120 12:29071081-29071103 CTGTTTTTCTGGTAGGTCCCAGG - Intergenic
1096185566 12:49578302-49578324 CTGTGTTTGCAGTAGGCTCCTGG + Intronic
1104617102 12:130279834-130279856 CTGTGTTTTTAGTAGAGACCGGG - Intergenic
1104657709 12:130585895-130585917 CTTTGTTTTTAGTAGTCTCAGGG - Intronic
1106371859 13:29142334-29142356 TTGTGTTTCTAATAAATTCCTGG + Intronic
1106702622 13:32246316-32246338 CTGTGTTTCTAATATTTTTATGG + Intronic
1106963657 13:35033109-35033131 GTGTTTTTATAGTAGTTTCATGG + Intronic
1107834071 13:44399326-44399348 CTGGTTTTCTATTAGTTTCCAGG + Intergenic
1108734338 13:53266887-53266909 TTGTGTTTCTAGAATATTCCAGG - Intergenic
1109652560 13:65348829-65348851 CTGTGATTCTAGTAGATAACTGG + Intergenic
1110819443 13:79897504-79897526 CTGTGTTCCTAGGACTTCCCTGG + Intergenic
1112323746 13:98429703-98429725 CTGTGTTTCCAGCTTTTTCCGGG + Intronic
1116342209 14:43738202-43738224 CTCTATTCCTAGTAGTTTCATGG - Intergenic
1116959562 14:50955973-50955995 CTGTATTTCTAGGAGTCTCCAGG - Intergenic
1117006248 14:51423867-51423889 CTATGTATCTAGCAGTCTCCTGG + Intergenic
1117200725 14:53387226-53387248 CTGTATTTCTAATAGGTTTCCGG + Intergenic
1117746385 14:58873870-58873892 CTTTGTTTCAAGTAACTTCCAGG - Intergenic
1118612169 14:67549982-67550004 CTGTCTTTCTAGTGGATCCCTGG + Intronic
1118671471 14:68132662-68132684 CTCTGGTTCTAGCAGTTTCTGGG - Intronic
1120423973 14:84323554-84323576 CTGTGCTTTTATTAGTTGCCTGG + Intergenic
1121045973 14:90787988-90788010 CTGTATTTTTAGTAGATACCGGG - Intronic
1121115914 14:91342621-91342643 ATGTGTCTCTAGTGGTTGCCAGG + Intronic
1123739139 15:23218307-23218329 CTGAGTTTCTAGTACGGTCCTGG + Intergenic
1123863045 15:24487371-24487393 TTGTGTTTCTTGTAGATTCTGGG + Intergenic
1124049538 15:26183346-26183368 CTGTGTCTCTAGTGGTTACTAGG + Intergenic
1124290357 15:28447263-28447285 CTGAGTTTCTAGTACGGTCCTGG + Intergenic
1124292880 15:28470285-28470307 CTGAGTTTCTAGTACGGTCCTGG - Intergenic
1125747490 15:42006850-42006872 CTGTGTTTCTAGTAATTACAAGG - Intronic
1126546745 15:49882154-49882176 CTGTGCCTTCAGTAGTTTCCTGG - Intronic
1127653788 15:61036217-61036239 CTGTCTTTCTAGTAGAATTCTGG - Intronic
1127654627 15:61044762-61044784 CTGTATTTCTAGCAGGCTCCTGG - Intronic
1127906291 15:63378861-63378883 ATGTGTTTCTAGTGGCCTCCAGG - Intronic
1128158129 15:65404574-65404596 CAGTGTTTCTAGGTCTTTCCAGG + Intronic
1128243243 15:66115832-66115854 CCTTGCTTCTGGTAGTTTCCTGG - Intronic
1128820898 15:70652284-70652306 CTGTGTTTCTAGTAGTTTCCAGG - Intergenic
1130528954 15:84731120-84731142 CTGCTTTTCCAGTACTTTCCTGG + Intergenic
1130864879 15:87924362-87924384 CTGTCTTTCTAGGAGTTTCTGGG + Intronic
1132951767 16:2566809-2566831 CTGTGTTGCAGGTAGTATCCGGG + Intronic
1132962583 16:2633361-2633383 CTGTGTTGCAGGTAGTATCCGGG - Intergenic
1133317990 16:4895744-4895766 AGGTGCTTCTAGTGGTTTCCTGG - Intronic
1133986148 16:10669794-10669816 TTGTTTTTCTGGAAGTTTCCAGG + Intronic
1134114075 16:11535047-11535069 CTGTGTCTCGAGGCGTTTCCTGG - Intergenic
1135236848 16:20764842-20764864 CTGTGTTTCCCAAAGTTTCCTGG - Intronic
1135851368 16:25966979-25967001 TTGTGTTTCTAACAGGTTCCAGG - Intronic
1137699128 16:50483609-50483631 CAGTATTTGTAGTAGTTTTCTGG + Intergenic
1141248618 16:82334108-82334130 AAGTGTTTCTATTGGTTTCCTGG - Intergenic
1141285277 16:82666228-82666250 CTGTGTTTCTGGTTGATTGCAGG - Intronic
1142545404 17:698258-698280 TTGTGTTTTTAGTAGTTACAGGG - Intronic
1144096223 17:11903003-11903025 ATGTGTATATAGTAGTTTCCTGG + Intronic
1144190820 17:12843826-12843848 TTGTGTTTTTAGTAGATTCGGGG + Intronic
1144458495 17:15438154-15438176 ATGTTTTTCAAGTAGCTTCCGGG + Exonic
1147011082 17:37448752-37448774 CTGTGTTTCCAGTACTTCTCAGG + Intronic
1147161175 17:38570195-38570217 CTGAGTTTCTGTTTGTTTCCAGG - Intronic
1148172797 17:45537362-45537384 CTGTGATTCCAGTGTTTTCCTGG + Intergenic
1148276472 17:46308087-46308109 CTGTGATTCCAGTGTTTTCCTGG - Intronic
1148298588 17:46525680-46525702 CTGTGATTCCAGTGTTTTCCTGG - Intronic
1148363121 17:47030172-47030194 CTGTGATTCCAGTGTTTTCCTGG - Intronic
1148366442 17:47058975-47058997 CTGTCTTTCAAGGAGTTTTCTGG + Intergenic
1148920138 17:51024121-51024143 TTGTGTTTTTAGTAGATTACGGG - Intronic
1149012246 17:51869472-51869494 CTGTGTTTTATGTTGTTTCCTGG - Intronic
1150404003 17:64884277-64884299 CTGTGATTCCAGTGTTTTCCTGG + Intronic
1150529913 17:65966502-65966524 TTGTTTTTCTTGGAGTTTCCAGG - Intronic
1150588056 17:66536235-66536257 CTGTGTGACTAGAACTTTCCTGG + Intronic
1151402747 17:73866536-73866558 CTGCATTTCTAATAGCTTCCCGG - Intergenic
1156777051 18:40803779-40803801 CTGTGTTTCAAGGGGTTTCATGG + Intergenic
1157651875 18:49341316-49341338 TTGTATTTTTAGTAGTTTCACGG - Intronic
1159204144 18:65228327-65228349 CTGTACTCCTGGTAGTTTCCAGG - Intergenic
1160250675 18:77201298-77201320 CTGTGTTTATTGTAGTTTTGAGG + Intergenic
1160427676 18:78789575-78789597 CTGTTTTCCTGGTGGTTTCCTGG - Intergenic
1162489864 19:10985689-10985711 CTGTATTTCCAGTAAGTTCCTGG - Intronic
1162775415 19:12975902-12975924 CTGTGTGTCTAGGAGTTTGGTGG + Intergenic
1166319470 19:42007393-42007415 CTATGTTTTAAATAGTTTCCTGG - Intronic
1166607100 19:44153286-44153308 CTTTGGTTCTAGAAGTTACCTGG - Intronic
1167555760 19:50194411-50194433 CTGGGTTTCTAGTCTTTTCCTGG - Intronic
925076280 2:1018902-1018924 CTGGGATGCTGGTAGTTTCCAGG + Intronic
925525170 2:4792193-4792215 CTGTGTTTCTGGTAACTTCCAGG - Intergenic
927448528 2:23186799-23186821 CTTTGTTTCTAAGAGTTTCTTGG + Intergenic
928220244 2:29397343-29397365 CTGTGCTTCTAGTGGTTTTCTGG - Intronic
930313542 2:49771319-49771341 CTGTGTTTCCTGGTGTTTCCAGG - Intergenic
930919219 2:56731356-56731378 CTGAGTGTATATTAGTTTCCTGG - Intergenic
931259342 2:60603713-60603735 CTGTGTTTCCGGAAGATTCCAGG - Intergenic
931960042 2:67472258-67472280 CTGTGTTTCTTGTAATTGCAAGG + Intergenic
933935674 2:87201772-87201794 CTGAGTTTCTGGAAGTTTACAGG + Intergenic
934136763 2:89003061-89003083 CTTTCTTGCTAGTAGTTTTCAGG - Intergenic
935846518 2:107171731-107171753 TTGTGTTTTTAGTAGTGTCAGGG + Intergenic
936357475 2:111764053-111764075 CTGAGTTTCTGGAAGTTTACAGG - Intergenic
936975058 2:118210669-118210691 CTGTGCCTCTTGGAGTTTCCAGG - Intergenic
937859767 2:126698415-126698437 CTGTGTTTCAATTGTTTTCCAGG - Intergenic
939693554 2:145295791-145295813 CTGTGTGTATAGCTGTTTCCTGG + Intergenic
941480387 2:166001843-166001865 TTTTGTTTCTAGTTGCTTCCAGG + Intronic
941811693 2:169761865-169761887 TTTTGTTTCTAGTTCTTTCCTGG + Intronic
942897976 2:181080920-181080942 CTGTGTTTCTAACAAGTTCCAGG + Intergenic
947678973 2:232012117-232012139 TTGTTTTTAAAGTAGTTTCCTGG + Intronic
948008909 2:234635027-234635049 CTGTATTTCCAGTAATTTGCTGG - Intergenic
1169392790 20:5203911-5203933 CTCTATTTCTCGTAGATTCCAGG + Intergenic
1169476534 20:5936361-5936383 TTGCATTTCAAGTAGTTTCCAGG - Intergenic
1169648532 20:7841582-7841604 CTGTGATTCCAGTAGCTTCCTGG - Intergenic
1171754007 20:29083786-29083808 TTGTGTTTTTAGTAGTGTCAGGG + Intergenic
1172549485 20:35787948-35787970 CTGTGTTTTTAGTAGAGTCAGGG + Intronic
1173015262 20:39219846-39219868 GTGTGTTCCTAGTGGTTTCAAGG + Intergenic
1175291268 20:57877090-57877112 CTTTGTCTCTGGTAGTGTCCTGG + Intergenic
1175505869 20:59483741-59483763 CTGTGTTTCCAGAATCTTCCTGG - Intergenic
1179073326 21:38093889-38093911 CTGAGTTTCTACTACATTCCAGG + Intronic
1181002182 22:19993019-19993041 CAGTGTTTCTGGATGTTTCCAGG - Intronic
1183324039 22:37181822-37181844 CTGTGTTTCTCATATGTTCCTGG - Exonic
1184554560 22:45226070-45226092 CTGTGTTTCTTGTCGTTCACTGG - Intronic
950408452 3:12819029-12819051 GTCTGCTTCTAGTAGGTTCCTGG + Intronic
950462332 3:13132809-13132831 CTGTGTTTCCTAAAGTTTCCTGG - Intergenic
957114132 3:76002933-76002955 TTGTATCTGTAGTAGTTTCCTGG - Intronic
959403063 3:105926710-105926732 CTGTGTGTCTAGTATTTTTTTGG + Intergenic
960012233 3:112846888-112846910 CTTAGTTTCCAGTGGTTTCCTGG - Intergenic
960425820 3:117506685-117506707 CAGTGTTTTAAGTAGTTTGCTGG + Intergenic
961187433 3:124927874-124927896 CTGTGGTGCTAGCAGTTTCAGGG + Exonic
961748429 3:129081112-129081134 CTGTATTTCTAGTAGAGTCAGGG + Intergenic
962405496 3:135096484-135096506 CTGTGTTTCTATACGTTCCCAGG + Intronic
962739598 3:138353433-138353455 CTGTGTCTCTAGAAGGGTCCAGG - Intronic
962939493 3:140112954-140112976 ATGTGTTTGTAGTAATTTCCAGG + Intronic
963219438 3:142791307-142791329 CTATTTTTCCAGTAGTTTACAGG + Intronic
964309608 3:155378692-155378714 CTGTGTTTCTAGTAGTTTCCAGG - Intronic
964683376 3:159366940-159366962 CTGTATTTTTTCTAGTTTCCAGG - Intronic
965879512 3:173371720-173371742 CTGTGTTTATTGGAGCTTCCAGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
970086823 4:12357511-12357533 CTGTGTTTCTAAGATTTTCAAGG - Intergenic
970444862 4:16115149-16115171 CCGTGTTTCTGGTACTTACCTGG - Intergenic
970908875 4:21251137-21251159 TTGTGTTTCTACTAGTTACATGG - Intronic
970939659 4:21616482-21616504 CTGTGTCTCTATTAGTGTCCTGG + Intronic
972575753 4:40349707-40349729 TTGTGTTTCTATAAGTTCCCAGG - Intronic
973303269 4:48614028-48614050 CTGTGTTTCTCTTTCTTTCCTGG - Intronic
974375737 4:61073736-61073758 CTTTCTTTCCAGTAGTTTTCAGG + Intergenic
975859852 4:78665100-78665122 ATGTGTTCCTAGTAATTTCAGGG + Intergenic
976836702 4:89382805-89382827 CTTAGTTTCTGGTAGTTTACTGG + Intergenic
978430135 4:108624997-108625019 TTGTGTATCCTGTAGTTTCCTGG + Intronic
979940094 4:126751539-126751561 CTGTATTTTTAGTAGTTACGGGG + Intergenic
983629047 4:169830899-169830921 GTGTGTTTGTAGTAGTCTCTGGG - Intergenic
983731827 4:171004065-171004087 TTGAGTTTCTTGTAGATTCCGGG + Intergenic
984548475 4:181133573-181133595 CTGTTTTTCCAGAAGTTTACAGG - Intergenic
985977662 5:3433734-3433756 CAGTGTTTCTAGGAAATTCCGGG + Intergenic
986102974 5:4630943-4630965 CTGCTTTTCTAGGATTTTCCAGG - Intergenic
986912085 5:12570437-12570459 CCTAGTTTCTGGTAGTTTCCTGG - Intergenic
987129432 5:14847133-14847155 CTGTGTCTTTAGTAGTTTACTGG - Intronic
987234967 5:15933722-15933744 CTGAGTGTCTAAGAGTTTCCTGG + Intronic
987649344 5:20720062-20720084 CATTGTTTCTAGTGGTTTTCTGG - Intergenic
988215819 5:28270854-28270876 TTGTGTTACTAGAATTTTCCAGG - Intergenic
988746215 5:34141471-34141493 CATTGTTTCTAGTGGTTTTCTGG + Intergenic
990125550 5:52512677-52512699 CTGTGTTCTCAGTAGTATCCAGG - Intergenic
990934704 5:61135635-61135657 CTGTGTTTTAATAAGTTTCCAGG + Intronic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
991973896 5:72166911-72166933 CTGTGTTTCATCTTGTTTCCTGG - Intronic
996048826 5:118909165-118909187 CTTTGTTCCTAGCTGTTTCCAGG - Intronic
996432166 5:123393462-123393484 CTGTCTTTCTGGAAGTTTCATGG + Exonic
997812633 5:136986949-136986971 CTGTTTTTCTAGAATTTTCCTGG - Intronic
997840974 5:137239405-137239427 CTGTGTTTTAAGTATTTACCTGG + Intronic
1000889100 5:166783217-166783239 TTGTAATTCTAGTAGTTTCTAGG - Intergenic
1003367060 6:5484908-5484930 CTGTGTTTGTGCTAGTTTTCAGG + Intronic
1003443895 6:6167712-6167734 CTGTGTTCCTGGTGGCTTCCAGG - Intronic
1003586417 6:7393463-7393485 CTGTATTTCTGATAATTTCCTGG + Intronic
1003653818 6:7987122-7987144 CTGAGGTTCAAGTAGTATCCTGG - Intronic
1003766490 6:9242788-9242810 CTGAACTTCGAGTAGTTTCCAGG - Intergenic
1003850900 6:10221362-10221384 ATCTGTTTTTAATAGTTTCCAGG - Intergenic
1004592577 6:17068104-17068126 ATGTTTTTCTAGCATTTTCCTGG + Intergenic
1005359404 6:25016821-25016843 CTGGGTTTCTAAAAATTTCCAGG + Intronic
1005453246 6:25993928-25993950 TTGTGTTCATAGTAGTTTCTAGG + Intergenic
1005544366 6:26849704-26849726 CATTGTTTCTAGTGGTTTTCTGG + Intergenic
1005893095 6:30155981-30156003 CTGTATTTCTAACAATTTCCTGG + Intronic
1006660583 6:35639581-35639603 CACTGTTTCTAGAAGCTTCCTGG + Intronic
1008210649 6:48720492-48720514 CTTTTCTTCTAGTAGTTTCATGG + Intergenic
1009015154 6:57891332-57891354 CATTGTTTCTAGTGGTTTTCTGG + Intergenic
1011340429 6:86307548-86307570 CTTTGTTTCTAGCCATTTCCTGG - Intergenic
1011496513 6:87941969-87941991 TTGGGTGTCCAGTAGTTTCCAGG - Intergenic
1012935523 6:105363713-105363735 CTGTCTTCCTGGTAGCTTCCTGG - Intronic
1012954614 6:105555471-105555493 CTGTGTCTCTACTCGTGTCCAGG - Intergenic
1015193755 6:130502119-130502141 CTGTGTTTCTAAAAACTTCCAGG - Intergenic
1015512690 6:134054395-134054417 CTGTGTTTCTAGCAGCTTCTTGG + Intergenic
1016448715 6:144158858-144158880 CTGTGTTTCTTACACTTTCCAGG + Intronic
1016727474 6:147391541-147391563 CTGATTTTCTAGGAGTTTACAGG + Intergenic
1018476241 6:164144921-164144943 CGGTGTGTCCAGTAGTTTCCTGG - Intergenic
1019952085 7:4381843-4381865 CTAGGTTTCTATTCGTTTCCTGG + Intergenic
1020353351 7:7248997-7249019 CTGTATTTCTAGCAGATGCCTGG - Intergenic
1021333287 7:19366402-19366424 CTGGCTTTCTAGTTGTTTCTTGG - Intergenic
1022231593 7:28419109-28419131 CTGTGTGTTTGGTAGTATCCAGG + Intronic
1027200408 7:76060657-76060679 CTGTGTTTCCTGTGGGTTCCAGG + Intronic
1027249259 7:76388842-76388864 CTGTATTTTTAGTAGTGACCGGG - Intergenic
1028853182 7:95559657-95559679 CTGAATTTCTAACAGTTTCCTGG - Intergenic
1028999355 7:97137304-97137326 AAGTGTTTCTCCTAGTTTCCAGG - Intronic
1029292064 7:99509638-99509660 CTGTATTTCTAGTAGAGTCGGGG + Intronic
1030788138 7:113687521-113687543 TTATGTTTCTAGGAATTTCCAGG - Intergenic
1032780596 7:135162386-135162408 CTGTGTTCCTAGTCACTTCCTGG + Intronic
1034104417 7:148478081-148478103 CTGTTTTTTTAGAAGATTCCAGG + Intergenic
1034645177 7:152639971-152639993 CTGTGATTTTAGTAGGTTTCAGG - Intergenic
1038126213 8:24675625-24675647 CTGTGTTTGAAGTAGTTTCTGGG - Intergenic
1038681777 8:29675199-29675221 CTGTGTTTGAAGAAATTTCCTGG - Intergenic
1040725472 8:50377491-50377513 CTGTGTTTGCAGTACTTTTCTGG + Intronic
1041774259 8:61506974-61506996 TAGTGTTTTAAGTAGTTTCCAGG - Intronic
1041919149 8:63163848-63163870 CTCTGTGCCTAGTAATTTCCTGG - Intergenic
1043326966 8:79064150-79064172 CTGTATTTCTAACAGTTCCCAGG + Intergenic
1044634796 8:94311569-94311591 CTGTATGTCTAGAAGTTTCCTGG + Intergenic
1045010113 8:97951470-97951492 CTGCATTTCTAGTAAGTTCCGGG - Intronic
1045900552 8:107274275-107274297 CCGTGTTACTATTATTTTCCTGG - Intronic
1046058033 8:109101725-109101747 CTGTATTTCTATTTGTATCCTGG - Intronic
1046656148 8:116897673-116897695 GTTTCTTTCTAGTAGTTTCATGG - Intergenic
1047003892 8:120599990-120600012 CTGTGTTTCTTGTTACTTCCCGG - Intronic
1050061474 9:1714199-1714221 CTGTATTTCTAGTAAGTACCAGG + Intergenic
1050221234 9:3392797-3392819 CTGTGTTTCTTCTAGTTTGCAGG - Intronic
1050512128 9:6407247-6407269 CTGTGTTGCTATGAATTTCCTGG + Intergenic
1051149516 9:14065282-14065304 CCATGTTTCTAGGATTTTCCTGG - Intergenic
1051180009 9:14401453-14401475 CTAGGTTTCTTGTAGCTTCCAGG - Intergenic
1051252244 9:15172291-15172313 CTGCATTTCTAGAAGCTTCCTGG + Intronic
1053484334 9:38440716-38440738 CTGTCTTTCTGGTTGTTTCCCGG - Intergenic
1055495726 9:76852652-76852674 CTGCCTTTCTCGTAGTTTACTGG - Intronic
1055597013 9:77875651-77875673 CTGTGATTCTCCTAATTTCCAGG - Intronic
1055619823 9:78113309-78113331 CTGATCTTCTAGTAGTATCCTGG + Intergenic
1055765345 9:79657234-79657256 CTGTGTTTCTTGTCATTTTCAGG - Intronic
1056002767 9:82234444-82234466 CTGTCTTTCTTGTCGTTTCTTGG - Intergenic
1056904906 9:90637714-90637736 CTCGGTTTTTAGTAGTTTGCAGG + Intronic
1056966303 9:91165424-91165446 CTGTGTTTCTAACACGTTCCTGG + Intergenic
1058344828 9:103948567-103948589 CTGTGTTTCTAGTAAGCTCCTGG - Intergenic
1060656440 9:125375529-125375551 CTGTGTTTCTAGTAGAGACAGGG - Intergenic
1061826989 9:133264545-133264567 CTGTGGTTCTCGTACATTCCTGG - Intronic
1187179736 X:16932806-16932828 CTGTGTTTCTAGTACTTTCCAGG + Intergenic
1187931910 X:24301383-24301405 CTGAGTTCCCAGTAGTTTCCAGG - Intergenic
1189014394 X:37080972-37080994 CTGTATTTCTATTAGTTTTCAGG - Intergenic
1189378813 X:40486975-40486997 CCCAGTTTCTGGTAGTTTCCTGG + Intergenic
1193858762 X:86639187-86639209 CTGTGGGTCAAGTTGTTTCCTGG - Intronic
1194340689 X:92701219-92701241 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1195169847 X:102256199-102256221 TTGTGTTTCTTTTGGTTTCCCGG + Intergenic
1195189010 X:102430901-102430923 TTGTGTTTCTTTTGGTTTCCCGG - Intronic
1195898889 X:109776969-109776991 CTGTGTTTCCAGTATGTTTCTGG - Intergenic
1196559470 X:117127881-117127903 CTGTGTTCTTATTAGTTTCAAGG - Intergenic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197573651 X:128180619-128180641 CTGTGTTTACATTAGTTTCAAGG - Intergenic
1197598408 X:128495473-128495495 CTGAGTTGCTACTGGTTTCCTGG + Intergenic
1198862130 X:141082740-141082762 TTGTGTTTTTAGTAGAGTCCGGG - Intergenic
1198900560 X:141504632-141504654 TTGTGTTTTTAGTAGAGTCCGGG + Intergenic
1199611096 X:149614813-149614835 CTTTGTTTCAAGAAATTTCCTGG - Intronic
1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1201678077 Y:16610452-16610474 CTTAGTTTCTGGTAGTTTCTTGG - Intergenic
1202054374 Y:20814543-20814565 CTGTGCTTCCAGGTGTTTCCAGG - Intergenic