ID: 964314054

View in Genome Browser
Species Human (GRCh38)
Location 3:155424635-155424657
Sequence CTAAATATACAGATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 6, 2: 23, 3: 71, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964314054 Original CRISPR CTAAATATACAGATGGACAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
907557129 1:55353791-55353813 CTAAATATAATGATGGGCCAAGG - Intergenic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908505347 1:64792046-64792068 CTAAATATATGGATTGTCAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909627761 1:77737399-77737421 CTAAATACACAGAAGTACAGAGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919362915 1:196617408-196617430 ACAAAGATACAGATGAACAACGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923222088 1:231904550-231904572 CTAAATACACAGATAGATACAGG + Intronic
923943651 1:238858218-238858240 CTTAATTTACAGATTGACACTGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924298537 1:242613323-242613345 CTAAAACTCCAGATGCACAAGGG - Intergenic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068465896 10:57391120-57391142 CTAAATACATAGGTGAACAAAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071684446 10:87739945-87739967 CTACATATACCAATGTACAATGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078596744 11:12693676-12693698 CAAAATAAACAGGAGGACAACGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082772918 11:57222449-57222471 GTAATTATAAAGAAGGACAATGG - Intergenic
1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG + Intergenic
1085262839 11:75218122-75218144 CTACATATAGAGAAAGACAAGGG - Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1088089926 11:106025589-106025611 ATACATATACATATGCACAATGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089084764 11:115807495-115807517 CTAAAGAAACAGAGGCACAAGGG - Intergenic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093047008 12:14458383-14458405 ACAAATATATAGATGGAAAAGGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095525647 12:43122004-43122026 CTAAATATAAGGAAGGAGAAGGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1099801696 12:87465101-87465123 TTAAATACACAGAATGACAAAGG + Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102074198 12:110047110-110047132 GTAGATATACAGATGTACCAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107866481 13:44708084-44708106 ATAAATATACAGATAGATCAGGG - Intergenic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1109079686 13:57882893-57882915 CTAAATATAGAGTTGGGGAAGGG + Intergenic
1109357840 13:61254823-61254845 AAAAATATACTGATGGGCAAAGG + Intergenic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113019947 13:105873742-105873764 ATAAACATACAGATAAACAAAGG + Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113529019 13:111006331-111006353 CGAAATGTACACATGGACAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114826569 14:26087787-26087809 ATAAAAATAGAGATAGACAATGG - Intergenic
1114849191 14:26362359-26362381 CTAAATATATTGATGTACATTGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1117670422 14:58100532-58100554 GTAATTATAAAGATGGACCAGGG + Intronic
1118235718 14:64003619-64003641 GTAAACACACAGAAGGACAAGGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122332525 14:100932661-100932683 CTATACATGCAGAAGGACAAAGG - Intergenic
1123190286 14:106562773-106562795 CTAAAAATACAGGTGGACTTAGG + Intergenic
1125710632 15:41782906-41782928 GTAAGGATATAGATGGACAAGGG - Intronic
1127667151 15:61159042-61159064 ATAAATATACAGCTAGACATAGG + Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1134337600 16:13315564-13315586 CTAATTACACAGCTAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140403455 16:74691064-74691086 TTAAATATATATGTGGACAAAGG + Intronic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1140999351 16:80293921-80293943 GTAGATAGACAGATGGACATGGG + Intergenic
1141314277 16:82945979-82946001 CAAAACATACGGAAGGACAAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1146969318 17:37059699-37059721 CTAAATAAAGAGCTGGGCAAAGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1149951418 17:60991313-60991335 ATAAATAAACAGAAGTACAATGG - Intronic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155780612 18:29828861-29828883 TTAAATATAAAGATGTAGAAAGG + Intergenic
1155914249 18:31540342-31540364 CTACATATACAGATACATAACGG + Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG + Intronic
925625426 2:5838111-5838133 CTAATTATAAAGAAGGATAAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
930552906 2:52858249-52858271 ATAAGTATAAATATGGACAAAGG + Intergenic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937520365 2:122706550-122706572 CTACATGTACGGATGGGCAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939470935 2:142618343-142618365 TAAAAAATAAAGATGGACAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941090497 2:161169112-161169134 TTAAAGAAAGAGATGGACAAAGG + Intronic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943096318 2:183433874-183433896 ATAAATATACAGATCCTCAAAGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943842827 2:192602267-192602289 CTAAATATACAGGTTGAAAGAGG + Intergenic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
944637645 2:201690274-201690296 ATAAATCTGCAGAAGGACAAGGG + Exonic
945283962 2:208064001-208064023 CTAAATAAATGGAAGGACAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945634754 2:212333711-212333733 GTAGATATACAGGTGGACCAAGG - Intronic
946276794 2:218637688-218637710 CTATAGATACAGGTAGACAAAGG + Intergenic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170660217 20:18331578-18331600 CTAATTACACACATGTACAATGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174676989 20:52367636-52367658 TGAAATATTCAGATGGACCATGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176994807 21:15543190-15543212 CTAAATATATATTTGAACAAAGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182382628 22:29905256-29905278 CTATATATACAGCAGGCCAAGGG - Intronic
1182747072 22:32614355-32614377 CCAAAGAGAGAGATGGACAAGGG + Intronic
1183117302 22:35701901-35701923 CTAAATATACAGGTTGAAAGAGG - Intergenic
950382913 3:12632514-12632536 GTAAAGATACAGATTGATAAAGG + Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951974619 3:28491226-28491248 TTAAATATACAGCTGGATATAGG + Intronic
952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954357048 3:50090416-50090438 CTAAATCTTCAGTGGGACAATGG + Exonic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958989272 3:100823104-100823126 GTAAAAATTCAGATGTACAATGG + Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963373098 3:144427247-144427269 CTAATAACACTGATGGACAATGG + Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
964296956 3:155243991-155244013 ATAAATATATAGATAGATAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972319514 4:37960371-37960393 CTAAATATAAAGTGGGACCACGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975145589 4:70963920-70963942 TTAAATATACAGATATAGAATGG + Intronic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976780097 4:88749193-88749215 CCAAATATAAAGAAGGATAATGG - Intronic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
978488262 4:109281017-109281039 ATAAATATGTAGATAGACAAAGG + Intronic
979114864 4:116810702-116810724 ATAAATATACAGCTGCATAAGGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980593912 4:134928119-134928141 CTAAAGATAAAGATAGAAAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982263008 4:153511656-153511678 ATACATATATAGATGGAAAAAGG - Intronic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989415606 5:41171869-41171891 TTAAAAATACAGACTGACAAGGG - Intronic
990929373 5:61071217-61071239 ATAAATTTACAGTAGGACAAGGG - Intronic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
993452546 5:88090433-88090455 GAAAATATACAGATTGCCAAGGG + Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
996066994 5:119090368-119090390 ATAAATATCCAGGTAGACAAAGG - Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999267145 5:150274112-150274134 CTAAAGAGACAGGTGGAAAATGG + Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000630861 5:163588980-163589002 CAACATATACAGGTGGTCAAAGG + Intergenic
1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002830115 6:812767-812789 CTAAATAAAAAGATAGACAGGGG - Intergenic
1002870076 6:1158782-1158804 CTAAATACACAGTTGTAAAAGGG + Intergenic
1003798409 6:9632006-9632028 TTAAAATTACAGATGGAAAAGGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005485073 6:26291944-26291966 CTAAAAATCCTGATGGAGAATGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007323966 6:41046377-41046399 CTATAAATACTGATGGACAGAGG + Intronic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008150581 6:47946562-47946584 CTAAACATAATGATAGACAAAGG - Intronic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011048268 6:83111691-83111713 CTAATTTTTAAGATGGACAAAGG - Intronic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012727403 6:102831904-102831926 GTAAATATAGAGGTTGACAAGGG + Intergenic
1012755576 6:103226512-103226534 CAAAATGTATAGATGCACAATGG + Intergenic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013661547 6:112302396-112302418 CTAGATATACAGATGAGCCAAGG - Intergenic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1014181408 6:118388412-118388434 TTATTTATACAGCTGGACAAAGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021322025 7:19224069-19224091 CAAAATGTAGATATGGACAACGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022769011 7:33449076-33449098 ATAAATATTGAGATGAACAAGGG + Intronic
1023914590 7:44579396-44579418 CTAAAAATCCAGGTGGATAAAGG + Exonic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024427833 7:49248028-49248050 CTAAATCTAAAGAAGGGCAATGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029301098 7:99582908-99582930 CCAAATATCCAGATGGGGAAAGG - Intronic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039013343 8:33120120-33120142 CAAAATATACTGTAGGACAATGG + Intergenic
1039174561 8:34788460-34788482 CTATATATATATATGTACAATGG - Intergenic
1039174566 8:34788678-34788700 ATATATATACATATGTACAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1040627305 8:49163474-49163496 CTAAAGATACAGTTTAACAATGG + Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043359387 8:79453630-79453652 CTAGATATACAGAGTAACAATGG + Intergenic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046536848 8:115525561-115525583 CTAAATAATCAGATTGAGAATGG - Intronic
1046680776 8:117167748-117167770 CTAAAAATATATATGTACAAGGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050140109 9:2508799-2508821 TTAAGTAAATAGATGGACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1053636613 9:40012765-40012787 ATAAATATGCAGAAAGACAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054895670 9:70308247-70308269 CTAAATATACTGATGGTAAGGGG - Intronic
1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057736769 9:97669844-97669866 CTAAATATTCTGATGAGCAATGG - Intronic
1058521703 9:105818921-105818943 CTAAATATACAGGTTGAAAGAGG + Intergenic
1058728363 9:107825575-107825597 CTAAATTTATAGATACACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062018440 9:134304176-134304198 CTAAATAGACAGCAGGGCAAAGG + Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186622880 X:11260113-11260135 CTAGCTTTACAGATGGAAAAAGG + Intronic
1186752250 X:12633181-12633203 GTACATATACAGATAGACACTGG - Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188436319 X:30163060-30163082 CTAAATATTAAGATGGACCCAGG - Intergenic
1188742002 X:33795935-33795957 CCAAATATATAGATGTACACTGG - Intergenic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193168580 X:78309939-78309961 TTAAATATACTGTTGTACAAAGG + Intronic
1193655582 X:84193150-84193172 ACAAATATGCAGATGGATAAAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1196892414 X:120304213-120304235 ATAAATATACAGAGATACAAAGG + Intronic
1197851584 X:130867269-130867291 GTAAATATATAGTTGGAAAATGG + Intronic
1199338247 X:146644291-146644313 CTATATATAGATATGGACTAGGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199644157 X:149889408-149889430 CTAAATCTACACATGGGCTAAGG - Intergenic
1199859660 X:151789882-151789904 CTATAGACAGAGATGGACAAAGG + Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic