ID: 964318425

View in Genome Browser
Species Human (GRCh38)
Location 3:155468528-155468550
Sequence GAAAATAAACGGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1078
Summary {0: 1, 1: 10, 2: 37, 3: 176, 4: 854}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964318422_964318425 -1 Left 964318422 3:155468506-155468528 CCTACACGGACACACATAGACTG 0: 1
1: 0
2: 23
3: 213
4: 673
Right 964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG 0: 1
1: 10
2: 37
3: 176
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964318425 Original CRISPR GAAAATAAACGGATGGAAAA AGG Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
904252080 1:29232171-29232193 GAAATCAAATGGCTGGAAAATGG - Intergenic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
904822979 1:33257013-33257035 GCAAATAAACGGATTGCAAACGG + Intronic
904944980 1:34192664-34192686 GAAAATAAACAGATTGACAGAGG + Intronic
905782590 1:40725619-40725641 AAAAATAAATGGATGGATGAGGG - Intronic
906053768 1:42898129-42898151 TAAAGTAAAAGGGTGGAAAAGGG - Intergenic
906352509 1:45075559-45075581 GAAAATTAAGGGATTGAAAAAGG - Intronic
906563807 1:46781788-46781810 TAAAGTAAATGGGTGGAAAAAGG - Intronic
906876976 1:49550137-49550159 AAACTTAAAAGGATGGAAAAAGG - Intronic
907349357 1:53813415-53813437 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
907946173 1:59138583-59138605 GAAAAGAAAAGGAAGTAAAAGGG - Intergenic
908174904 1:61545846-61545868 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
908238205 1:62167624-62167646 GAAAACAAACAAATGAAAAAAGG + Intergenic
908298767 1:62740053-62740075 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
908307911 1:62843043-62843065 GAAAATACATGAATGGAAACAGG - Intronic
908412301 1:63879032-63879054 GAAAATAAACTGTTAGAAGAGGG + Intronic
909469479 1:76011103-76011125 GAAGATGAATGGATGGAAAAAGG - Intergenic
909910560 1:81252625-81252647 GAAAATAAATGGATGAAGATGGG - Intergenic
910185978 1:84540513-84540535 GAAAATAAACGACAAGAAAAGGG - Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910363253 1:86436375-86436397 TAAAATAAAGGAAGGGAAAAGGG - Intronic
910524867 1:88166038-88166060 GAAAATAAAGAGCTGGAAACAGG + Intergenic
910620773 1:89251343-89251365 GAAAACAAAGAGATGGACAAAGG + Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910801074 1:91146922-91146944 GAAAATAAAGGGCTGGAGAAAGG - Intergenic
911036100 1:93550078-93550100 ATAAATAAACGGTTGTAAAATGG + Intronic
911716289 1:101137161-101137183 GAAAATAAACAGATATTAAAAGG - Intergenic
911792644 1:102037833-102037855 AAAAATAAAGGAAAGGAAAAAGG - Intergenic
912935105 1:113996441-113996463 GAAAGTGAAGGGAGGGAAAAAGG + Intergenic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913566925 1:120081564-120081586 GAAACTAAATGGAAGGCAAATGG - Intergenic
913631204 1:120711985-120712007 GAAACTAAATGGAAGGCAAATGG + Intergenic
913659812 1:120996636-120996658 GAAGATTTATGGATGGAAAAGGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
914011169 1:143779760-143779782 GAAGATTTATGGATGGAAAAGGG - Intergenic
914166665 1:145181370-145181392 GAAGATTTATGGATGGAAAAGGG + Intergenic
914232851 1:145780294-145780316 GAAAGGAAATGTATGGAAAAGGG + Intronic
914287679 1:146242271-146242293 GAAACTAAATGGAAGGCAAATGG - Intergenic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914346264 1:146801288-146801310 TAAAGTAAAAGGGTGGAAAAAGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914548710 1:148693014-148693036 GAAACTAAATGGAAGGCAAATGG - Intergenic
914617970 1:149378697-149378719 GAAACTAAAGGGAAGGCAAATGG + Intergenic
914649792 1:149688415-149688437 GAAGATTTATGGATGGAAAAGGG - Intergenic
915157594 1:153891205-153891227 GAAAAGAAAGGAAAGGAAAAAGG + Intronic
915867841 1:159524337-159524359 GAATGCAAAGGGATGGAAAAAGG - Intergenic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
917057699 1:171002095-171002117 TAAAGTAAAGGCATGGAAAAAGG - Intronic
917184598 1:172339313-172339335 GAAAATAAACAGAAATAAAAAGG - Intronic
917598656 1:176554001-176554023 AAAAGTAAAGGGAAGGAAAAAGG + Intronic
917841138 1:178979288-178979310 GAAAGCAAAGGGATGGAAAAAGG + Intergenic
918292931 1:183126494-183126516 AAAAATAAAAGATTGGAAAAAGG - Intronic
918454230 1:184690723-184690745 GAAAATATACGGCTGTAAATTGG + Exonic
918484905 1:185018594-185018616 AAAAAAAAAAGGAAGGAAAAAGG + Intergenic
918550776 1:185739806-185739828 GAAAATAAAAAGCAGGAAAAGGG + Intronic
918873680 1:190010176-190010198 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
919140745 1:193568320-193568342 AAAAATGAAATGATGGAAAATGG - Intergenic
919141499 1:193578202-193578224 GAAAGTAGACAGATGAAAAAGGG - Intergenic
919278073 1:195446550-195446572 AAAATCAAACGGGTGGAAAAAGG + Intergenic
920726766 1:208443584-208443606 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
921277067 1:213531183-213531205 GAAAAGAAAGAGATGGAAACAGG - Intergenic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921701030 1:218269362-218269384 GAAAATAAAAGGAAGGGAAAAGG + Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
921882807 1:220273327-220273349 GAAAATGAACCCATGGATAAAGG + Intergenic
922360697 1:224818891-224818913 GAAGAGAAAGGGATGGAAAGAGG - Intergenic
922377494 1:224983304-224983326 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
922435223 1:225598686-225598708 AAAAATAAAAGAATGGGAAAAGG + Intronic
922658075 1:227403008-227403030 TAAAGTAAAGAGATGGAAAAAGG + Intergenic
922974475 1:229772356-229772378 GAAAATAAATCGAAAGAAAAGGG - Intergenic
923808442 1:237286659-237286681 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
924815593 1:247438986-247439008 GAAAATAGAGGGATGGATGATGG - Intronic
1063354933 10:5389144-5389166 GAAAATAAATCAATGGAGAAAGG + Intergenic
1063457693 10:6195833-6195855 GAGAATAAGTGAATGGAAAATGG - Intronic
1063940131 10:11120013-11120035 GAAAATTAACAGCTGGGAAATGG - Intronic
1063972112 10:11388436-11388458 GGAAAGAAAGGGAAGGAAAATGG + Intergenic
1064938868 10:20710901-20710923 GAAGATTTAAGGATGGAAAAAGG + Intergenic
1064981290 10:21170148-21170170 AAAAATAAAAGGACAGAAAAAGG - Intronic
1065024684 10:21528877-21528899 AACAACAAATGGATGGAAAAAGG + Intergenic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1065467522 10:26041244-26041266 GAAAATAAAGGAATGGAAAGAGG - Intronic
1065470753 10:26079352-26079374 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1065475393 10:26131583-26131605 GAAAATAAAGGGATACAAAGTGG - Intronic
1065497201 10:26341748-26341770 GAAAAGAAAAGGAAAGAAAAGGG + Intergenic
1066145331 10:32552253-32552275 TAAAGTAAATGGGTGGAAAAAGG - Intronic
1066201935 10:33150360-33150382 AAAAATAAAACGATGGCAAAAGG - Intergenic
1066221671 10:33340877-33340899 CAAAATAAATTGAAGGAAAAAGG - Intergenic
1066424975 10:35299609-35299631 AAAAGTAAAAGGATGAAAAAAGG - Intronic
1067287883 10:44920771-44920793 GAAAATAAAAACATGCAAAATGG - Intronic
1067956819 10:50800702-50800724 GAGAATAGAGGGAGGGAAAAAGG + Exonic
1068217888 10:54007137-54007159 GAAAATACACAGAAAGAAAAGGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068663109 10:59644542-59644564 GAAAGTGAAGGGATGGAAAATGG - Intergenic
1069588313 10:69625310-69625332 GAAAGTAAAATGATGGAAAAAGG + Intergenic
1071161400 10:82749794-82749816 AAAAAAAAAAAGATGGAAAATGG + Intronic
1071556372 10:86605640-86605662 GAAAGTAAAAGAATAGAAAAAGG - Intergenic
1071870838 10:89792650-89792672 ACAAATAAATAGATGGAAAAAGG - Intergenic
1071973628 10:90933002-90933024 GAAAATAAAGGGATAGACAAAGG + Intergenic
1072102059 10:92239092-92239114 GAAAATAAACTAAAAGAAAAAGG + Intronic
1072164056 10:92794929-92794951 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1072183769 10:93014889-93014911 AAAAATAAAGAGGTGGAAAAAGG - Intronic
1072815103 10:98499806-98499828 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1072877965 10:99193571-99193593 GAAAATAAAGGGATAGTAAAAGG + Intronic
1072928224 10:99635756-99635778 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1072987982 10:100159082-100159104 GAAAGTAAAAGAATGGGAAAAGG + Intronic
1073728341 10:106260939-106260961 TAAAATAAAGAGATGGATAAAGG + Intergenic
1074317702 10:112374443-112374465 GAAAAAAATCAGTTGGAAAAGGG + Intronic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1075509562 10:123060086-123060108 TGAAATAAAGAGATGGAAAAAGG + Intergenic
1075652399 10:124137054-124137076 GACAGTAAATGGATGTAAAATGG - Intergenic
1075660414 10:124191417-124191439 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1076019359 10:127058364-127058386 GAAAATAAAAGGATGGAAATAGG - Intronic
1076186410 10:128453051-128453073 GAAAAAGAATGGATGGAAAAAGG + Intergenic
1078801970 11:14655142-14655164 GGAAATAAAAGAATGGAAAAAGG + Intronic
1078820381 11:14874236-14874258 AAAAATAAAAGGATGGTTAAAGG - Intergenic
1079169843 11:18082560-18082582 GAAAATACAAATATGGAAAAGGG + Intronic
1079213094 11:18481257-18481279 GAAAATTAACAGATAAAAAATGG + Intronic
1079273461 11:19011408-19011430 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1079699870 11:23531617-23531639 GAAAGTGAAAGGATGGGAAAAGG - Intergenic
1080324319 11:31052137-31052159 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1080672343 11:34392908-34392930 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1081600469 11:44489054-44489076 TAAAATAAACGGATAGAAAGTGG - Intergenic
1081610362 11:44559022-44559044 AAAAATAAACGGGTAGAACAGGG + Intergenic
1082212725 11:49525192-49525214 TGAAATAAAGGGATGTAAAAAGG - Intergenic
1082622841 11:55445169-55445191 GAAAATACAGGGATCAAAAAAGG - Intergenic
1082686228 11:56242256-56242278 GAAGATGAACAGAAGGAAAAAGG + Intergenic
1082917056 11:58448432-58448454 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1082930886 11:58603797-58603819 GAAAATAGAAGGGGGGAAAAAGG - Intronic
1083064379 11:59909193-59909215 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1083231139 11:61320522-61320544 GAAAAAAAAAGTATGGGAAAAGG - Intronic
1083518218 11:63280817-63280839 GAAAGTAAGGGGATAGAAAATGG - Intronic
1083820312 11:65167108-65167130 GAAAATAAAGGAAAGGAAAGAGG - Intergenic
1086214217 11:84358429-84358451 GAAAATGAAGGCATGGAAATCGG - Intronic
1086260265 11:84931300-84931322 GAAAATAAAGGGTGGGAGAAGGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086988876 11:93280879-93280901 AAAAAAAAACGGATGCACAAAGG - Intergenic
1087024537 11:93636684-93636706 AATAATAAAAGAATGGAAAATGG + Intergenic
1087167341 11:95018682-95018704 AAAAATCAAGGAATGGAAAAAGG - Intergenic
1088137510 11:106576146-106576168 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1088206632 11:107399358-107399380 TAAAATAAAGGGATGGAAAAAGG + Intronic
1088413314 11:109560972-109560994 CAAGGTAAAAGGATGGAAAAAGG - Intergenic
1088835116 11:113571291-113571313 GACAGTAAAAGGATGAAAAAAGG + Intergenic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1088998250 11:115023502-115023524 GAAAGTGAAAGGATGGAAAAAGG + Intergenic
1089107585 11:116025929-116025951 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1089717892 11:120381374-120381396 AAAAATAAGTGGATGGATAATGG - Intronic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1089826054 11:121278941-121278963 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1090108528 11:123878348-123878370 AAAAATAAAAGAATAGAAAAGGG + Intergenic
1090519963 11:127468115-127468137 TAAAATACACCGTTGGAAAAGGG + Intergenic
1091182157 11:133615445-133615467 GAAAATAAAAGAATGTAAAAAGG - Intergenic
1091210271 11:133852306-133852328 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1091530093 12:1346361-1346383 GGAGAAAAACAGATGGAAAAGGG - Intronic
1091696972 12:2634181-2634203 AAAAAAAAAGGTATGGAAAAAGG - Intronic
1091738606 12:2943734-2943756 GAAAAAAAAAGAATGTAAAAGGG - Intergenic
1091997437 12:5004946-5004968 GAAAGTGAAGAGATGGAAAAAGG + Intergenic
1092364799 12:7868490-7868512 CAAGATAAAGGGATAGAAAATGG - Intronic
1092552391 12:9517357-9517379 GAAAAGAAAGGGAAGGACAATGG - Intergenic
1092635775 12:10446743-10446765 GAAAATAATTTCATGGAAAAGGG + Intronic
1092637510 12:10467457-10467479 TAAAATAAAGGGATAGAATAAGG - Intergenic
1092647955 12:10600061-10600083 TGAAATAAACAGATAGAAAAAGG - Intergenic
1093010729 12:14103799-14103821 TAAAGTAAAGGGGTGGAAAAGGG + Intergenic
1093196408 12:16134755-16134777 GAAAATACAGTGATAGAAAAAGG - Intergenic
1093212885 12:16328481-16328503 GAAAATAAATTGATGTAGAATGG + Intergenic
1093337464 12:17923538-17923560 GAAAATGAAAGGTTGGATAAAGG + Intergenic
1093440959 12:19195288-19195310 GAAAAGAAATGGGGGGAAAAAGG - Intronic
1093488509 12:19679492-19679514 TAAAGTAAAGGGATGGAAAAAGG - Intronic
1093542813 12:20307611-20307633 GAAAATGAAGGAATGGAAGAAGG + Intergenic
1093601646 12:21033201-21033223 GAAAATGAAGAGTTGGAAAAAGG - Intronic
1093720775 12:22439245-22439267 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
1093845759 12:23969312-23969334 GAAAAAAAATGGATTGAAGAGGG - Intergenic
1093890977 12:24520778-24520800 GAAAGTGAAAGGATGGGAAAAGG + Intergenic
1093995164 12:25632956-25632978 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
1094394198 12:29987876-29987898 GAAAGTAAAATGATGGATAAGGG + Intergenic
1094420029 12:30261014-30261036 GAAAATAATGAGATGGAAAAAGG + Intergenic
1094762085 12:33545631-33545653 GAAAAAAAAAGGAGGGAATAAGG - Intergenic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095424626 12:42062230-42062252 GAAAAAAAATGGAAGGAAAAGGG - Intergenic
1095482319 12:42649332-42649354 GAAGATTTATGGATGGAAAAAGG + Intergenic
1095893014 12:47252225-47252247 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1096332022 12:50721859-50721881 GAAAATAAAAGAATGGAGAAAGG + Intronic
1096332141 12:50722859-50722881 GAAAATAAAAGAATGGAGAAAGG - Intronic
1096819327 12:54221538-54221560 GAAAATAAAAGGCAGTAAAAAGG - Intergenic
1096904575 12:54922957-54922979 GATAAGAAATGTATGGAAAATGG - Intergenic
1096957036 12:55536642-55536664 TAAAGTAAAAGGGTGGAAAAAGG + Intergenic
1097201503 12:57282744-57282766 GAAAATAAAAGTGTGGATAAAGG + Intronic
1097283790 12:57862414-57862436 GAAAATAAGCTGATGGCTAAAGG + Intergenic
1097423583 12:59413208-59413230 GAACATAAAAGGAGAGAAAAGGG - Intergenic
1097456368 12:59803612-59803634 TAAAATAAATGGATGTAAATAGG + Intergenic
1097579611 12:61438693-61438715 GAAAAAAAAAAGAGGGAAAAAGG - Intergenic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1097604125 12:61731432-61731454 AAAAATTAACTGCTGGAAAATGG - Intronic
1097759280 12:63442613-63442635 TAAAATAAATGAAGGGAAAATGG + Intergenic
1098204816 12:68097390-68097412 GAAAATAAAGCCATGGATAAGGG - Intergenic
1098852440 12:75612893-75612915 TAAGGTAAATGGATGGAAAAAGG + Intergenic
1098913197 12:76231590-76231612 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1098982479 12:76972406-76972428 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1099224159 12:79949242-79949264 GAAAATAATGAGAGGGAAAAGGG - Intergenic
1099243977 12:80172580-80172602 GAAAAAAATCAGATAGAAAAAGG - Intergenic
1099523542 12:83692707-83692729 GAAAATAAAGGAATGGAAAGAGG + Intergenic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099743537 12:86671588-86671610 GAAAACAATGGGATGAAAAAAGG + Intronic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1100089445 12:90953040-90953062 AAAAATACAGGGATTGAAAATGG + Exonic
1100290798 12:93213102-93213124 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1100292238 12:93228031-93228053 GACAATAATAGCATGGAAAATGG - Intergenic
1100710197 12:97247740-97247762 GAAGATAAACGGATGGCAGTTGG - Intergenic
1100742258 12:97607081-97607103 CAAAATAGACGGATGGAGGAAGG - Intergenic
1100769350 12:97904280-97904302 GAAAAGAAATGGATGATAAATGG - Intergenic
1100788465 12:98104334-98104356 GAATAGAAAGAGATGGAAAAAGG - Intergenic
1101143494 12:101819493-101819515 GAAAATGAAGGGGGGGAAAAAGG + Intronic
1101272211 12:103159663-103159685 GAAATTAAATGGATGGCAAATGG - Intronic
1102318274 12:111908042-111908064 GAAAACAAAGAGATGGAAAAAGG + Intergenic
1102434653 12:112911347-112911369 GGAAATAGAGGGATGGAAAAAGG + Intronic
1103102165 12:118187583-118187605 GAAAAAAAATGGAAGGGAAAAGG - Intronic
1103403974 12:120661771-120661793 GGAGATAAACAGATGAAAAATGG - Intronic
1103459394 12:121091511-121091533 GAAAAGAAAAGGGTGGACAAAGG + Intergenic
1104244037 12:127019996-127020018 GAAAATAAAAAGATTTAAAAAGG - Intergenic
1104270531 12:127278839-127278861 AAACATAAACGAAAGGAAAAAGG + Intergenic
1104802819 12:131566311-131566333 TAAAATAAACAGAATGAAAATGG - Intergenic
1105416201 13:20213831-20213853 AAAAGCAAAAGGATGGAAAAAGG + Intergenic
1105870404 13:24500016-24500038 GAAAATAATAGGATGAAAATAGG + Intronic
1106842941 13:33705794-33705816 GAAAGTGAAGGAATGGAAAAAGG - Intergenic
1106937956 13:34745422-34745444 TAAAGTAAACAGGTGGAAAAAGG - Intergenic
1107156332 13:37171680-37171702 GAAAATAAACAGATAAAAAAGGG - Intergenic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107260960 13:38490574-38490596 GATAATAAAAGTATGTAAAAAGG - Intergenic
1107293402 13:38883124-38883146 GGGAATAAAGGGAAGGAAAAAGG - Exonic
1107371083 13:39748894-39748916 GAAAATAGTTGGATGGAATAAGG - Intronic
1107489575 13:40868432-40868454 CAAAATAAATGGATGGAGGAAGG - Intergenic
1107818484 13:44265614-44265636 AAAAGGAAAAGGATGGAAAAGGG + Intergenic
1108255703 13:48608820-48608842 GAAAATAGAGGGATGAAAAAAGG - Intergenic
1108402979 13:50067292-50067314 CAAAAGAAAGGGAAGGAAAAGGG + Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108469582 13:50754527-50754549 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1108758735 13:53536239-53536261 GAAAGAAAAAGGATTGAAAAAGG + Intergenic
1108817283 13:54307177-54307199 TAAAGTAAAGGGCTGGAAAAAGG + Intergenic
1108900875 13:55406673-55406695 GAAAATAAAGGGATAAAGAATGG - Intergenic
1109240295 13:59878267-59878289 GAAAATAAAAGAATGGAGATGGG + Intronic
1109508181 13:63334746-63334768 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1109517835 13:63467314-63467336 GAAAATGAAGGGATAGAAAAAGG + Intergenic
1109631466 13:65054546-65054568 CAAAGTAAACGGATGGAGAAAGG + Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1110627770 13:77670367-77670389 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
1110662952 13:78079844-78079866 GAAAAAAAAAGAATGGACAAAGG - Intergenic
1110997917 13:82137086-82137108 TGAAATAAACGGGTGGAAATGGG + Intergenic
1111163714 13:84429279-84429301 TTAAATAAATGGATGGAAGATGG - Intergenic
1111467420 13:88633285-88633307 AAAAATAAACTCATGGAAATTGG - Intergenic
1111467466 13:88633932-88633954 GAAAATAATCCGATTAAAAATGG - Intergenic
1112035197 13:95491109-95491131 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1112125580 13:96463770-96463792 GAAAATAAACACAAGAAAAAAGG + Intronic
1112381563 13:98895722-98895744 AAGAATAAAAGGATGAAAAAAGG - Intronic
1112516648 13:100059005-100059027 GAAAGAAAAAGGAAGGAAAAAGG + Intergenic
1112708445 13:102099220-102099242 GAAGATAAATGGATGGAAAAAGG + Intronic
1112738329 13:102445637-102445659 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1113269748 13:108660629-108660651 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1113415636 13:110126389-110126411 GAAAAGAAAAGGAAAGAAAAAGG - Intergenic
1113444916 13:110357823-110357845 GAAAGTAAAAAGATGTAAAATGG + Intronic
1113525802 13:110974847-110974869 GAAAATAAATGAATGAACAAAGG - Intergenic
1113894618 13:113755625-113755647 GAAAAGAAAAGGAGGAAAAAGGG - Intergenic
1114217910 14:20671132-20671154 GAAAACTAACAGAAGGAAAAAGG + Intergenic
1114691980 14:24592127-24592149 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1114894645 14:26971638-26971660 GCAAATAACCCAATGGAAAATGG + Intergenic
1115299464 14:31867450-31867472 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1115393505 14:32880035-32880057 GAAAGTAAAGGGAGGGAGAAAGG - Intergenic
1115773572 14:36690925-36690947 TAAAATAAATTAATGGAAAAAGG - Intronic
1115813724 14:37139501-37139523 GAAAATATATGGAGGGATAAAGG - Intronic
1115867568 14:37764622-37764644 GAAAGTGAAAGGATGGGAAAAGG - Intronic
1115958886 14:38812035-38812057 TAAAGTAAAGGGTTGGAAAAAGG + Intergenic
1115970046 14:38934678-38934700 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1116382342 14:44285743-44285765 GAAAAGAAACCGAATGAAAATGG - Intergenic
1116408028 14:44589639-44589661 GAAAAAAAACTCATGGAATAAGG - Intergenic
1116434464 14:44880684-44880706 AAAAATAAATGGATAGAAAAAGG + Intergenic
1116931084 14:50691690-50691712 GAAAGGGAAGGGATGGAAAAAGG - Intergenic
1117208822 14:53473949-53473971 GAAAATAAGTGGTTAGAAAAAGG + Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1117509931 14:56440930-56440952 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1117744761 14:58858219-58858241 CTAAATAAAGGGATAGAAAAAGG - Intergenic
1117918153 14:60700288-60700310 GAAAATGAAGGAATGGGAAAAGG - Intergenic
1118073746 14:62275960-62275982 GAAAATAAAGGAATGGGCAAAGG - Intergenic
1120135944 14:80868787-80868809 AAAAATGAAGGGATGGAAAAAGG + Intronic
1120489786 14:85162805-85162827 GAAAGCAAAGGAATGGAAAAAGG + Intergenic
1120545568 14:85807498-85807520 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1120651297 14:87136310-87136332 GAAAAGAAAAAGAAGGAAAATGG - Intergenic
1121205751 14:92165601-92165623 GAACATAAACAAATTGAAAATGG - Exonic
1121389236 14:93560115-93560137 GAAACTAAACGGAAGGTACAAGG + Intronic
1121399017 14:93655448-93655470 GTAAATAAACGGTCTGAAAATGG - Intronic
1121460067 14:94068147-94068169 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1121701937 14:95961348-95961370 GAAAAGAAAGAGATGGAAATTGG + Intergenic
1122014943 14:98787355-98787377 GAAAAAAAAAAGATGGAGAAGGG - Intergenic
1123969283 15:25490543-25490565 AAAAGTAAAATGATGGAAAAAGG + Intergenic
1124123917 15:26918802-26918824 GAAAATGAAGGGATGGAAAAGGG - Intronic
1124145437 15:27121058-27121080 GATAATAAACGAAGTGAAAATGG - Intronic
1124156223 15:27227002-27227024 GAAAAAAAACTGAAAGAAAAAGG + Intronic
1124228649 15:27920252-27920274 GAAAGGAAAAAGATGGAAAAAGG + Intronic
1124245152 15:28063261-28063283 GAAGGTAAAAGAATGGAAAAAGG - Intronic
1124352419 15:28967417-28967439 AAAAATAAAGGGATGGAGAGAGG - Intronic
1124557334 15:30738265-30738287 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
1124673929 15:31667482-31667504 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1125473140 15:40024188-40024210 AAAAATAAAAGGATGGAGAAAGG - Intronic
1125610068 15:40963819-40963841 GAAAAAAAACCGATCCAAAATGG - Intergenic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126282339 15:46968802-46968824 CAAAATAATGGGATGGAGAAAGG + Intergenic
1127006264 15:54573413-54573435 GAAAATAAACAAATCCAAAATGG + Intronic
1127124507 15:55799206-55799228 GAAGATAAAGGGAGGGAAAAGGG - Intergenic
1127132900 15:55885990-55886012 AAAAACAAAGGGATGGAAAAAGG + Intronic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1127196680 15:56593547-56593569 GAAAATAAATTGGTGGAAAGAGG + Intergenic
1127267537 15:57374139-57374161 GAAAAGGAAGGGAAGGAAAAAGG - Intergenic
1127323450 15:57869666-57869688 GAAATTAAAAGGATAGAGAAAGG + Intergenic
1127438750 15:58985408-58985430 GAAAATAAAGGGATGCGCAATGG - Intronic
1127694090 15:61427306-61427328 AAAAATAAATGAATGGAAGAAGG + Intergenic
1127828644 15:62729584-62729606 GAAAGTAAAAGAATGAAAAAAGG - Intronic
1128319748 15:66684901-66684923 GAAAATAAACAGACAGAAATAGG + Intronic
1128573299 15:68751677-68751699 GAAAAAAAAAGAAAGGAAAAAGG + Intergenic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1128999944 15:72323821-72323843 GAAAGTAAAAGGATAGAAAAAGG - Intronic
1129097392 15:73223637-73223659 GAACTTAAAGGGGTGGAAAAAGG - Intronic
1129948397 15:79562286-79562308 GAAAACTGACGTATGGAAAAAGG + Intergenic
1130398532 15:83527567-83527589 AAAAGTAAAGGGATGGAAAAAGG - Intronic
1130416766 15:83701652-83701674 GAAAATGAAGGGATGCAAAGTGG - Intronic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1131623217 15:94089454-94089476 GAAAAGAAAAGGATGGAAGCAGG + Intergenic
1132007915 15:98247488-98247510 CAAGGTAAAGGGATGGAAAAAGG - Intergenic
1132167242 15:99606080-99606102 GAAATTAAATGCCTGGAAAAGGG + Intronic
1132210082 15:100015217-100015239 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1135426138 16:22338012-22338034 GAAAGTGAAGGAATGGAAAATGG + Intergenic
1136296021 16:29302441-29302463 GACAATAAACATAAGGAAAAAGG - Intergenic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1137451600 16:48579750-48579772 GAAGGTGAAGGGATGGAAAAAGG + Intronic
1137482359 16:48863223-48863245 AAAAATATAGTGATGGAAAACGG + Intergenic
1137552587 16:49450285-49450307 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
1137938829 16:52661162-52661184 TAAAGTAAATAGATGGAAAAAGG + Intergenic
1138020602 16:53476823-53476845 GAAAATGAAAGGATGGAAAGAGG - Intronic
1138180174 16:54935945-54935967 GAAAATTCACGCAGGGAAAATGG + Intergenic
1138370214 16:56520630-56520652 GAAAATTAAGGGAAGGAAGAGGG + Intergenic
1138806633 16:60097757-60097779 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1139166768 16:64575483-64575505 GGAAATAAAGTGAAGGAAAAGGG + Intergenic
1139868330 16:70082051-70082073 GAAAATAAACAACAGGAAAAGGG - Intergenic
1139987716 16:70913980-70914002 TAAAGTAAAAGGGTGGAAAAAGG - Intronic
1140340252 16:74151796-74151818 GAAAATAAAAGCATGGGAAATGG - Intergenic
1140387001 16:74549810-74549832 GAAAATAAACAACAGGAAAAGGG + Intronic
1140492594 16:75351698-75351720 GAAAATAAAAGGATATGAAAAGG + Intronic
1141244741 16:82295237-82295259 GCATCTAAACTGATGGAAAATGG + Intergenic
1141968651 16:87464653-87464675 GAAAATATACGGAGGAAAACAGG - Intronic
1142101940 16:88276628-88276650 GACAATAAACATAAGGAAAAAGG - Intergenic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1142649367 17:1337221-1337243 GAAAATATAGAGATGGCAAATGG + Intergenic
1142668494 17:1475960-1475982 GAAAAAAAATGCATAGAAAAAGG + Intronic
1142840960 17:2629938-2629960 TAAAGTAAAGGGGTGGAAAAGGG - Intronic
1143261925 17:5605920-5605942 GAAGATAAGGGGATGGAGAAAGG + Intronic
1143981506 17:10874072-10874094 GAACATAAACTGGTGGACAAAGG + Intergenic
1143991025 17:10961724-10961746 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1144309827 17:14002744-14002766 GATAATAAAAGTATAGAAAAAGG + Intergenic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146555095 17:33816292-33816314 GAAGATGAATGGAGGGAAAAAGG + Intronic
1146583600 17:34061660-34061682 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1146759282 17:35462074-35462096 GAAAATAAAATGATGGAAAAAGG - Intergenic
1146903547 17:36603077-36603099 GAAGACAAACGGATGGGAGAGGG - Intronic
1147204687 17:38828342-38828364 AAAAATAAAAGGAAGAAAAAAGG + Intergenic
1147451172 17:40505466-40505488 GAAAATAAAAGGGAGGCAAAGGG - Intergenic
1147720865 17:42538482-42538504 GCAGGTAAAAGGATGGAAAAGGG + Exonic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148340224 17:46869015-46869037 GAAAATAAACAGAGGGAAACTGG + Intronic
1148408048 17:47437614-47437636 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1149530868 17:57394183-57394205 GAAAAAAAACAATTGGAAAAAGG - Intronic
1150554348 17:66240318-66240340 GAAAAAAAAAGGATGGAGGAAGG + Intronic
1150945280 17:69739362-69739384 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1153400671 18:4680905-4680927 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1153513588 18:5882227-5882249 AAAAATAAAGGGATATAAAAAGG - Exonic
1154100597 18:11469383-11469405 GAAAAAAAAAGGATAGGAAATGG + Intergenic
1154457991 18:14547529-14547551 GAAAGTAAAAGGAGGAAAAATGG - Intergenic
1154932093 18:21009814-21009836 GAAAATAAACCTATGAAAAGAGG - Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155929584 18:31691596-31691618 GATAATAAATGAATAGAAAATGG - Intergenic
1155963362 18:32014320-32014342 AAAAATAAAAGCATGGATAAAGG + Intergenic
1156011121 18:32499224-32499246 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1156060356 18:33066638-33066660 GAAAGTGAAGGGATGGAAAAAGG + Intronic
1156124289 18:33884202-33884224 GAAGATAAAAGGATGCAAAATGG - Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156538432 18:37886395-37886417 TAAAGTAACTGGATGGAAAAAGG - Intergenic
1156728944 18:40166235-40166257 GAAAATAAAAAGAAAGAAAATGG + Intergenic
1156877737 18:42036205-42036227 GAAAACAAAAACATGGAAAATGG - Intronic
1157058450 18:44257806-44257828 GGAAAAAAACCTATGGAAAAAGG + Intergenic
1157092918 18:44657807-44657829 GAAAACAAGAGGATGGATAATGG - Intergenic
1157178183 18:45470302-45470324 GAAAACAAAAGGAAGGAAAAAGG - Intronic
1157510658 18:48269997-48270019 GAAAATAAAGTAATGGAAAAAGG + Intronic
1157541049 18:48507274-48507296 TAAACTAAAGGGGTGGAAAAAGG + Intergenic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1158146291 18:54317015-54317037 GAAAAGATAATGATGGAAAAAGG - Intronic
1158376101 18:56869667-56869689 GAAAATGAACTGATTAAAAATGG - Intronic
1158783316 18:60678215-60678237 GAAGATAAAGGGAAGGGAAAAGG + Intergenic
1159112248 18:64073031-64073053 GAAAAAAAAAAGATAGAAAAAGG - Intergenic
1159258687 18:65981447-65981469 GAAAATAAAAGAAAGAAAAATGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1160187963 18:76690165-76690187 TAAAACAAAGGGATGGAAGATGG + Intergenic
1160451867 18:78971869-78971891 GAAAATGAGAGGCTGGAAAAGGG - Intergenic
1160526669 18:79542604-79542626 GTAAATACATGGATGGATAATGG - Intergenic
1161913923 19:7214883-7214905 GAAAAAAAAGGGAGGGAACAAGG - Intronic
1163101376 19:15099133-15099155 GAAAAGAAAGGGAAGGGAAAGGG + Intergenic
1163914339 19:20227051-20227073 GAAAATAAAGGGACGGAGGAAGG - Intergenic
1164319933 19:24135289-24135311 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1164796246 19:31033953-31033975 AAAAATAAAAGAATGGGAAAAGG - Intergenic
1166045728 19:40229510-40229532 GAAAAAGAACGTAGGGAAAAAGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166954497 19:46454278-46454300 GAAAAACAACAAATGGAAAACGG - Intergenic
1167371675 19:49086180-49086202 CAAAAATAACGGCTGGAAAAGGG - Intronic
1167978046 19:53247818-53247840 TATAATAAAAGGATGTAAAAAGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
925009662 2:473152-473174 GAAAGTAAAAGTATGGAAAAGGG + Intergenic
925566267 2:5257790-5257812 GAGAATAAACCAATGCAAAAAGG - Intergenic
925882645 2:8365728-8365750 AAAAAAAAAAGGATGGAGAAAGG - Intergenic
925915849 2:8605253-8605275 GAAAAAAAACGTATAGAATAAGG + Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927441830 2:23124261-23124283 GAAAGTAAAAGGATGGTAAAGGG - Intergenic
928079786 2:28300337-28300359 GAAAATAAAGGGAAAGAAGAAGG - Intronic
928691832 2:33807791-33807813 GAAAAAAACCCAATGGAAAATGG - Intergenic
929492919 2:42412871-42412893 AAAAATAAAGGAATGGAAAAAGG - Intronic
929541048 2:42822217-42822239 GAAAATAAAGGGATGGAAAAAGG - Intergenic
929661973 2:43795638-43795660 GGAAATAAAAGGGTAGAAAAAGG + Intronic
930288476 2:49464974-49464996 AAAAATAAAGGGATGAAAAAAGG - Intergenic
930486306 2:52015952-52015974 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
930496767 2:52155727-52155749 GAAACAAAACCGAGGGAAAAAGG - Intergenic
930955770 2:57200927-57200949 GAGACTAAAGGAATGGAAAAAGG - Intergenic
931256123 2:60574627-60574649 GAAAATAACAGTATGAAAAATGG + Intergenic
931261330 2:60622140-60622162 GAAAATAGAGGGGTGGGAAAAGG - Intergenic
931548073 2:63410677-63410699 TCAAGTAAAGGGATGGAAAAAGG + Intronic
931789992 2:65656390-65656412 GAAGAGAAACGGCTGGAAATAGG + Intergenic
932511238 2:72293880-72293902 GAAAAAAAAGCTATGGAAAAAGG + Intronic
932889785 2:75582690-75582712 GAAAATAAAGGAATAGAAAAAGG + Intergenic
933373601 2:81449641-81449663 GAAAATAAAATGTTGGAAGAGGG + Intergenic
933556882 2:83841524-83841546 TAAAATAAACTAATTGAAAAAGG - Intergenic
933994668 2:87659515-87659537 GAAAATAAACAGAGAGAAAGAGG - Intergenic
934142218 2:89057942-89057964 GAATATAAAAGGAAGGAAAATGG + Intergenic
934227022 2:90142607-90142629 GAATATAAAAGGAAGGAAAATGG - Intergenic
934724494 2:96606772-96606794 GCAAACAAAAGAATGGAAAAAGG + Intronic
934782180 2:96977727-96977749 GAAAAGAAACTGATCTAAAAAGG - Intronic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935020881 2:99230165-99230187 CAAAATAAAGGAATGGAAAAAGG + Intronic
935464405 2:103379358-103379380 GAAAATAAATACATGGGAAATGG - Intergenic
935542753 2:104368942-104368964 GAAAAGAAACATAAGGAAAAGGG - Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
935851646 2:107227878-107227900 GAAAGTAAAAGGAAGGACAAAGG - Intergenic
935989877 2:108709560-108709582 GAAAATAAAGGGATTGGGAAAGG + Intergenic
936164651 2:110109337-110109359 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
936299188 2:111291398-111291420 GAAAATAAACAGAGAGAAAGAGG + Intergenic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
936828854 2:116615740-116615762 AAATATGAAAGGATGGAAAAAGG + Intergenic
936885276 2:117302702-117302724 GAAAATGAAGGGATGGCAAAAGG + Intergenic
937058068 2:118956278-118956300 TAAAATAAAGGGGTGGAGAAAGG + Intronic
937329083 2:121012879-121012901 GAAAATGAAAGGATGGGGAAAGG + Intergenic
937351676 2:121168606-121168628 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
937539435 2:122930204-122930226 GAAAATTTATGGATAGAAAAAGG + Intergenic
937561822 2:123233741-123233763 GAAAGTAAAAGGATGAGAAAAGG - Intergenic
937591852 2:123623225-123623247 GAAAATAAACGTAAGGAGAAAGG + Intergenic
938047005 2:128130750-128130772 GAAAATAAAAGGATAAAATAAGG - Intronic
938598056 2:132809621-132809643 AAACTTAAAGGGATGGAAAAGGG - Intronic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
938872307 2:135492328-135492350 GAAAATAAAAAGATGGTTAAAGG + Intronic
939157092 2:138538540-138538562 GAAAGTGAAAGGATGAAAAAAGG - Intronic
939371502 2:141307462-141307484 GAAAGTAAACGGATAAAAAAAGG - Intronic
939482279 2:142764006-142764028 GAAAGTAAAAAAATGGAAAAAGG + Intergenic
939726947 2:145732401-145732423 GAAAATAAAAGAAAGGAAAAAGG + Intergenic
939769765 2:146300690-146300712 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
939820014 2:146946099-146946121 AAAAATAAACGTAGGGAAAATGG + Intergenic
940034504 2:149299901-149299923 TAAAGTAAAGGGGTGGAAAAGGG - Intergenic
940195438 2:151089215-151089237 GAAAATATAGGGACAGAAAAGGG - Intergenic
940706775 2:157115296-157115318 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
941210167 2:162628216-162628238 TAAAATGAACACATGGAAAAAGG + Intronic
941218882 2:162749157-162749179 GAGAAGAAAGGGGTGGAAAATGG - Intronic
941227939 2:162871593-162871615 GAAAATAAAGAGATGATAAAAGG + Intergenic
941255282 2:163221738-163221760 GAAAATTAAAAGAAGGAAAAGGG - Intergenic
941304467 2:163845397-163845419 GAAAGAAAAAGGATGGACAAAGG - Intergenic
941382099 2:164806132-164806154 AAAAATAAAAGGAAGAAAAAGGG + Intronic
941479250 2:165985386-165985408 GAAAGAAAAAGGAAGGAAAAAGG + Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
941578276 2:167263739-167263761 AAAATAAAATGGATGGAAAATGG + Intergenic
941734808 2:168962062-168962084 GAAAAGAAAATAATGGAAAAGGG - Intronic
941840326 2:170076064-170076086 GCAAATTAAAGGAAGGAAAATGG - Intronic
941982204 2:171470892-171470914 GAAAAAAAAAGGATGGTATAAGG + Intronic
942223950 2:173798453-173798475 GGAAATGAACGGATGGATATTGG + Intergenic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
942604382 2:177675075-177675097 GAAAATAAAAGGAGGCAAAAAGG - Intronic
943003696 2:182362594-182362616 GAAAATAAAAGGAAGATAAAAGG - Intronic
943467930 2:188253243-188253265 AAAAACAAAAAGATGGAAAAGGG + Intergenic
943845334 2:192637930-192637952 GAAAATAATGGGATGGAAAAAGG + Intergenic
943872925 2:193025126-193025148 GAAAACAAAGAAATGGAAAAAGG + Intergenic
944269379 2:197763851-197763873 AAAAATAAACTGATTAAAAATGG + Intronic
944289108 2:197984835-197984857 GAAAATAAAAGGATAGTGAATGG + Intronic
944759848 2:202803441-202803463 GAAAGGAAAAGGATGGAAAAGGG + Intronic
945348990 2:208753838-208753860 AAAAACAAACTGATGAAAAATGG - Intronic
945475999 2:210283600-210283622 GAAAGTGAAGGGATGAAAAAAGG - Intergenic
945482343 2:210358688-210358710 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
945825949 2:214719894-214719916 AAAAGTAAAGGGGTGGAAAAAGG + Intergenic
945861466 2:215127648-215127670 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
945924931 2:215793598-215793620 GAAAATGAAAGAAAGGAAAAAGG - Intergenic
945956828 2:216094038-216094060 GGAAATAAAGGGATGGCAAATGG + Intronic
946036675 2:216748120-216748142 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
946264440 2:218526682-218526704 GAAAATAAAGGCAAGGAAATTGG - Intronic
946992657 2:225352655-225352677 GAAAATAAAGGGCTGGAATAAGG - Intergenic
947370852 2:229444165-229444187 GAGAATAGACGGAAGGAAAGTGG + Intronic
948335981 2:237207367-237207389 GCAGATAAACAAATGGAAAATGG + Intergenic
948548571 2:238751551-238751573 GAAAATAAAGGGATGGAAAAGGG + Intergenic
948842188 2:240657368-240657390 GAAGATAAAAGGATGGAGAAAGG - Intergenic
948949151 2:241237719-241237741 GAAAAAAAACGTGTGTAAAAGGG + Intronic
1169231317 20:3890298-3890320 GCAAATAGACAGAAGGAAAACGG - Intronic
1169401527 20:5284801-5284823 TAAAGGAAAGGGATGGAAAAAGG + Intergenic
1169517239 20:6331209-6331231 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1169617689 20:7468575-7468597 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1169944776 20:10977131-10977153 GAAAGGAAAGAGATGGAAAAGGG - Intergenic
1170133736 20:13051228-13051250 TAAAGTAAACGGGTGGAAAGAGG + Intronic
1170357376 20:15507347-15507369 GAAAGAAAAAGGAAGGAAAAAGG - Intronic
1170499929 20:16964392-16964414 GCCAATAAGCGCATGGAAAAAGG + Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170825737 20:19793508-19793530 GAAAAAAAAGGAAAGGAAAAAGG + Intergenic
1171165808 20:22969357-22969379 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1174394107 20:50235443-50235465 GAAAAAAAACAGATGAAAAATGG - Intergenic
1175406250 20:58731846-58731868 AATAGTAAAAGGATGGAAAAAGG + Intergenic
1175605135 20:60306613-60306635 GAAAATGAACGGCAGGAACAGGG - Intergenic
1175631930 20:60547860-60547882 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1176816163 21:13605766-13605788 GAAAGTAAAAGGAGGAAAAATGG + Intergenic
1177090671 21:16763551-16763573 GAAAATACACGTATGCACAATGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177098868 21:16874430-16874452 AAAAATAAACGTATGTAAAATGG - Intergenic
1177166284 21:17608544-17608566 AAAAAAAAAAGTATGGAAAAAGG - Intronic
1177185211 21:17786122-17786144 GAAAATAAGTGGATGCCAAATGG + Intergenic
1177221957 21:18206490-18206512 AAAAATAAAGAAATGGAAAAAGG - Intronic
1177416154 21:20795786-20795808 GAAAGTAAAAGGAAAGAAAAAGG + Intergenic
1177534603 21:22407415-22407437 TAAAATAAAAAGATGGGAAAGGG + Intergenic
1177720786 21:24904036-24904058 GCAAATAAAAGGAAAGAAAAGGG - Intergenic
1177759708 21:25389599-25389621 GAGAAAAAACTGATGGCAAAAGG - Intergenic
1178083495 21:29090021-29090043 GAAAATAAAGGCAAGGAAATGGG - Intronic
1178108820 21:29350371-29350393 GAAAATAAAGGAATGGTAGATGG + Intronic
1178150803 21:29791321-29791343 GAAAAAAAAAGGAGGGAAAAGGG + Intronic
1178227791 21:30743351-30743373 GAAAGAACAAGGATGGAAAAAGG - Intergenic
1178697426 21:34806271-34806293 ACAAGTAAAGGGATGGAAAAAGG + Intronic
1178749993 21:35293419-35293441 GAAAATAAACTCCTAGAAAATGG + Intronic
1178801878 21:35803204-35803226 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1179000695 21:37455303-37455325 CAAAATAAAAGGAAAGAAAAGGG - Intronic
1179113945 21:38472687-38472709 GAAAATGAACGTTTGGAAAAGGG + Intronic
1180139453 21:45883733-45883755 GAAGATAAACTAATGGGAAAAGG - Intronic
1181418587 22:22779921-22779943 GAAAAGAAAGGGACAGAAAAAGG + Intronic
1181672410 22:24431879-24431901 GGAAATAAACAGATTTAAAATGG - Intronic
1181979507 22:26756249-26756271 GAAAAGAAACGAAAGGAAATGGG - Intergenic
1182770809 22:32794946-32794968 GAATATAAAGGGTTGGAAGAGGG + Intronic
1183048158 22:35238583-35238605 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1183131420 22:35840347-35840369 GAAAGAAAAAGGAAGGAAAACGG - Intronic
1183286317 22:36966669-36966691 GAAAATGAAGGCAAGGAAAATGG - Intergenic
1183802460 22:40178588-40178610 AAAAATAAAAAGATAGAAAAAGG - Intronic
1183813912 22:40282994-40283016 AAAAATAAACGGGAGAAAAAAGG - Intronic
1185093341 22:48789498-48789520 GAAAAGAAACTGGTGGAAAAGGG + Intronic
1185262518 22:49876612-49876634 AAAAACAAATGGATGAAAAAAGG - Intronic
949595707 3:5544723-5544745 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
950560846 3:13722853-13722875 TAAAATAATCGAATGGAAATCGG - Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950603210 3:14054591-14054613 TAAAGTAAAGGGATGGAAAAAGG - Intronic
950677434 3:14563014-14563036 AAAAAAAAAAGGAGGGAAAAGGG + Intergenic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951279425 3:20730259-20730281 AAAAATAAAGGGAAGAAAAAAGG - Intergenic
951604911 3:24422472-24422494 CAAAATAAAGGGAAGTAAAAGGG - Intronic
951761248 3:26149063-26149085 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
951767810 3:26219437-26219459 GATAATAAAAAGATGGAAAGAGG + Intergenic
951852110 3:27152798-27152820 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
951869753 3:27348380-27348402 GGAAATCAACTCATGGAAAACGG + Intronic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952198131 3:31097448-31097470 GAATAGAAAGGGAGGGAAAAAGG + Intergenic
952222559 3:31339847-31339869 GAAATAAATCGAATGGAAAAAGG + Intergenic
952357911 3:32601723-32601745 GAGAATTAATGAATGGAAAAGGG - Intergenic
952521596 3:34164473-34164495 GAAAAGAAAGGGAAGGAAGAAGG - Intergenic
952669699 3:35951769-35951791 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
952724628 3:36570877-36570899 GAAAGTAAAAGAATGGAAAAAGG - Intergenic
952847514 3:37700751-37700773 GCAAATAAATGGATAGAAGATGG + Intronic
952974292 3:38681059-38681081 TACAATAAACTGATGGAAAAAGG + Intergenic
953087956 3:39691295-39691317 GAAAGTGAAGGAATGGAAAAAGG + Intergenic
953830830 3:46296434-46296456 GAAAATAAATAGATGAGAAATGG - Intergenic
953866620 3:46588875-46588897 AAACTTAAAGGGATGGAAAAAGG + Intronic
954743967 3:52776329-52776351 GAAAAGAAAGGGAGGGAAACAGG - Intergenic
954940165 3:54364592-54364614 GAACAAAAAAGGATGGCAAATGG + Intronic
955461419 3:59187830-59187852 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
955686663 3:61556128-61556150 GAAAACAAACGAAGGGTAAAAGG + Intergenic
955717068 3:61841105-61841127 GATAATCAGTGGATGGAAAAGGG - Intronic
955889893 3:63638714-63638736 AAAAATAATTGCATGGAAAAAGG + Intergenic
956107415 3:65834935-65834957 CAAAGTAAAAGGATGGAAAAAGG - Intronic
956920560 3:73924228-73924250 CAAATTAAATGGCTGGAAAAGGG + Intergenic
956950465 3:74275929-74275951 TAAAGTAAAGGGCTGGAAAAAGG + Intronic
957027337 3:75197533-75197555 GGAAATAAACGCATGAAAAAAGG + Intergenic
957087479 3:75695121-75695143 GAAAATAAAAGGATGGAAAAAGG + Intergenic
957161320 3:76612932-76612954 GAAAATAAAAGGATAGCAAAAGG - Intronic
957263041 3:77924473-77924495 AAAAATAAAAGTATGGAAAGGGG + Intergenic
957289843 3:78265949-78265971 CAAAGAAAAGGGATGGAAAAAGG - Intergenic
957671654 3:83312619-83312641 GAAAATAGCTGGATGGAAAGTGG + Intergenic
957710443 3:83850976-83850998 TAAAATAAATGGATGAAAGAAGG + Intergenic
958174830 3:89983869-89983891 GAAAACAAACGGATGGAAAAAGG - Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
958480594 3:94641578-94641600 AAAAGTAAAGTGATGGAAAAAGG - Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958630960 3:96683250-96683272 GAAAATAAAGGGATGAAAAAAGG - Intergenic
958760172 3:98297005-98297027 GAAAAAAAACGGAAGAATAAAGG + Intergenic
959134076 3:102394919-102394941 GCAATTAAAAGGAAGGAAAAAGG + Intronic
959280106 3:104326516-104326538 TAAATTAAAGGGATGGGAAAAGG + Intergenic
959426514 3:106196486-106196508 AATAATAAACTTATGGAAAATGG + Intergenic
959436373 3:106319472-106319494 TAAGATAAAGGGATGGAAAAGGG + Intergenic
959756776 3:109909139-109909161 AAAATTAAAGGGGTGGAAAAAGG - Intergenic
959899260 3:111641283-111641305 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
959940988 3:112080942-112080964 GAAGAAAAAGTGATGGAAAATGG + Exonic
960193784 3:114740247-114740269 TTAAATAAAATGATGGAAAATGG + Intronic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960827178 3:121801128-121801150 GAAAATAAATGGCTTGAAAATGG - Intronic
960892740 3:122467693-122467715 AAAAAAAAAAGGTTGGAAAAAGG + Intronic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961505217 3:127366251-127366273 AAAATTAAACGGAAAGAAAAAGG + Intergenic
962065808 3:131979536-131979558 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
962067788 3:132000853-132000875 AAAAAAAAAAGGAAGGAAAATGG + Intronic
962083171 3:132161969-132161991 TAATATAAAGGTATGGAAAATGG + Intronic
962482873 3:135812779-135812801 CAAAATAATCCGATGGCAAAAGG + Intergenic
963238724 3:142981879-142981901 GATAATAAAAGGGGGGAAAACGG + Intronic
963434265 3:145247827-145247849 TAAAATAAAATGATGGAAAAAGG - Intergenic
963694288 3:148545320-148545342 GAAAATAAATTAATGGAAAAAGG - Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
964136754 3:153352962-153352984 GAGAATAAAAGGTTGGATAAGGG + Intergenic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
965188464 3:165498159-165498181 GAAAAGAAACACATGGAAAGTGG + Intergenic
965251112 3:166345201-166345223 GAAAATAAAGGGATAGACAAAGG + Intergenic
965877779 3:173348761-173348783 GAAAGTGAAAGAATGGAAAAAGG - Intergenic
965949353 3:174286896-174286918 AAAAAGAAAAGAATGGAAAAAGG + Intergenic
967257313 3:187607165-187607187 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
967502263 3:190212364-190212386 GAAGATAAACAAATGGCAAATGG + Intergenic
967741380 3:193006592-193006614 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
968906186 4:3452121-3452143 GAAAATAAACAAATTGAACAGGG + Intergenic
969287790 4:6216684-6216706 GAAAGTCAAAGGATGGAAAAAGG - Intergenic
969947122 4:10795207-10795229 TAAAGTAAAGGGTTGGAAAAAGG - Intergenic
970468018 4:16347329-16347351 GATGATAAAAGAATGGAAAAGGG - Intergenic
970479939 4:16462565-16462587 GAAAAGAAATGGAAGGCAAATGG + Intergenic
970658428 4:18258383-18258405 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971018429 4:22511583-22511605 GAAAATTAACTGATGGGAACTGG - Intronic
971182914 4:24347610-24347632 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
971575279 4:28264893-28264915 GAAATTAAATGGATGGATAGGGG + Intergenic
971726848 4:30325749-30325771 CAAAGTAAAGGGACGGAAAAAGG - Intergenic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971817786 4:31511084-31511106 GAAATAAAAAGGAAGGAAAAAGG + Intergenic
972014778 4:34230204-34230226 GATGATAAAGGGATGGAAAAAGG - Intergenic
972130153 4:35822735-35822757 GACAAAAAACAGATGAAAAAGGG + Intergenic
973094965 4:46185547-46185569 GAAAAAAAAAGCATGAAAAAAGG + Intergenic
973179376 4:47249782-47249804 TAAAGTAAAAGGGTGGAAAAAGG - Intronic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
973777583 4:54257389-54257411 GAAAATAAAGGAATAAAAAAGGG - Intronic
973857926 4:55032290-55032312 AAACATCAACGGATGGAAAATGG + Intergenic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974329988 4:60465631-60465653 CAAAGTAAAAGGATGGAGAAAGG + Intergenic
974351583 4:60754603-60754625 GCCAATAAATGGAAGGAAAAGGG - Intergenic
974547890 4:63335860-63335882 CAAAATACAGGGATGGAAGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
974794823 4:66735032-66735054 GAAAAAAAAAGAATGGAGAAGGG + Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
975962671 4:79932174-79932196 GAAAATAAACGGATGAATAAAGG + Intronic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976066322 4:81191716-81191738 GAAAATATACACATCGAAAAGGG + Intronic
976292613 4:83435939-83435961 GAAAATAAAAGAATGGAAAAAGG + Intronic
976348917 4:84038221-84038243 GAAAACAAACAGAAGGAAATGGG - Intergenic
976669291 4:87634288-87634310 GAATTTAAATGGATGGAAATAGG - Intergenic
976825361 4:89254831-89254853 GAAAAGAAAGGGAAGGAAAAAGG - Intronic
976841386 4:89436582-89436604 GAAAACAAAAGGAAAGAAAAAGG - Intergenic
977219896 4:94326398-94326420 AAAAATAAAAGAATGAAAAAAGG - Intronic
977649855 4:99456846-99456868 GAAAAGAAATACATGGAAAATGG + Intergenic
978582019 4:110241474-110241496 GGAAGTAAACGTATAGAAAAAGG + Intergenic
978726480 4:111975779-111975801 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
978999234 4:115197591-115197613 TAAACTAAAGGGGTGGAAAAAGG - Intergenic
979040794 4:115791051-115791073 GAAAATGCAAGGATGGAAAAAGG - Intergenic
979072703 4:116229853-116229875 GAACATAAAAAGATGAAAAAAGG + Intergenic
979190597 4:117852056-117852078 CAAAGTAAAAGGATGAAAAAAGG + Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979381892 4:120016547-120016569 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
979705086 4:123711359-123711381 AAAAGTTAAGGGATGGAAAAAGG + Intergenic
979794729 4:124832917-124832939 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
979794739 4:124833082-124833104 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
979816331 4:125110360-125110382 GAATATAAAGGGATGGTAAGAGG - Intergenic
980468991 4:133226252-133226274 AAAAATAAAATAATGGAAAAAGG - Intergenic
980580309 4:134741907-134741929 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
981521608 4:145668219-145668241 GAATATAAACAGAAGCAAAAAGG - Intergenic
981558361 4:146020444-146020466 GAAAATAAAGGTATAGAAAAAGG - Intergenic
981825045 4:148930412-148930434 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
981950936 4:150406487-150406509 GAAAATAAAATAATGGAAAAAGG + Intronic
982476701 4:155861520-155861542 AAAAGTAAAAGAATGGAAAAAGG - Intronic
982531922 4:156556099-156556121 GAAATAAAAGGGATGGAAAAAGG - Intergenic
982687192 4:158505022-158505044 GAAAATATACATATGTAAAATGG + Intronic
982816472 4:159891865-159891887 GAAAAGAAACGGAAGGGAAGGGG - Intergenic
983337741 4:166418378-166418400 TAACAAAAAGGGATGGAAAAAGG - Intergenic
983505195 4:168545948-168545970 GAAAATAAAGGGTTTGAAAATGG - Intronic
984023375 4:174513717-174513739 TAAAATAAAGTAATGGAAAAAGG + Intronic
984175796 4:176415264-176415286 GAAAATAAACTTATGGTGAAAGG - Intergenic
984203180 4:176752982-176753004 GAAACTAAATGCATGGAAACAGG + Intronic
984255955 4:177390382-177390404 GAAAAGAAAGGGAGGGAAAAGGG - Intergenic
984400527 4:179257947-179257969 GAAACAAAATGGATGGATAATGG - Intergenic
984684707 4:182653936-182653958 AAAAATAAATTTATGGAAAAGGG - Intronic
984721927 4:182980535-182980557 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
985325513 4:188764420-188764442 AAAAATAAACAGATTAAAAAAGG + Intergenic
985519361 5:364784-364806 GAAAGTAAAAGGATGGGAAAGGG + Intronic
985900829 5:2789487-2789509 GAAAAGAATTGGATGGGAAATGG - Intergenic
986020026 5:3792794-3792816 GAAAATAAACAGATCTAAAGTGG + Intergenic
987240304 5:15990975-15990997 GAAAGGAAAGGGATGGAAAAAGG - Intergenic
987497105 5:18660224-18660246 AAAAACAAATGGAAGGAAAAAGG - Intergenic
987751287 5:22041463-22041485 GAAAGTAAAGGAATGGAAGAAGG + Intronic
987845918 5:23285643-23285665 GAAAAAAGAGAGATGGAAAAAGG - Intergenic
988020214 5:25611614-25611636 GAAAGTAAAAGAATGGGAAAAGG + Intergenic
988344806 5:30022953-30022975 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
988376474 5:30441559-30441581 GAAAATAAAGGGATGGAAAAAGG + Intergenic
988817756 5:34851411-34851433 AAAAATAAATGGGTGTAAAAGGG - Intronic
989223691 5:38999910-38999932 GAAAGTAAAAGGATGGTAAAAGG + Intronic
989483362 5:41959168-41959190 GAAGATATACGGATGGCTAATGG - Intergenic
989533607 5:42538012-42538034 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990144042 5:52738509-52738531 GAAAATATAAGGAAGGAAATGGG - Intergenic
990465839 5:56070478-56070500 GAAAATAAATATATGGAAAGAGG + Intergenic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991663863 5:68977089-68977111 GAAAATAAAAGGTTAGAAAAAGG + Intergenic
991672369 5:69061422-69061444 GAAAATAAAGGGATAGAAAAAGG - Intergenic
991947947 5:71918264-71918286 GACAACAAAGTGATGGAAAAAGG + Intergenic
992087552 5:73291481-73291503 AAAAAAAAAAGCATGGAAAAGGG - Intergenic
992667463 5:79025245-79025267 GAAAATAAAAGGCAGGAGAATGG + Intronic
992945551 5:81805272-81805294 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
993195210 5:84733400-84733422 GAAAATAAATGTATGGATGATGG - Intergenic
993473751 5:88338574-88338596 AAAAATAAAGGGATGAAAAAAGG + Intergenic
993669012 5:90737780-90737802 GAAAATGAAGGAATGGAAAAAGG - Intronic
994054202 5:95397566-95397588 GAAAATAAATTCCTGGAAAATGG + Intronic
994063537 5:95508643-95508665 GAAAATTAAAGTAGGGAAAAGGG - Intronic
994133577 5:96260011-96260033 AAAAAGAAAAGGATGGAAAATGG - Intergenic
994328659 5:98480074-98480096 AAAAATATAGGGATGGGAAATGG + Intergenic
994344345 5:98667087-98667109 GAAAATAAAGGAATGGAAAAAGG + Intergenic
994428462 5:99625338-99625360 AAAAATTAAGGTATGGAAAAAGG - Intergenic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
994654162 5:102568906-102568928 GAAAATGAAGGGATGCAAAAGGG - Intergenic
994835447 5:104846164-104846186 GCAAACACACGAATGGAAAAGGG + Intergenic
994919509 5:106025269-106025291 AAAAATAAAGGGATGTAAACAGG + Intergenic
995217373 5:109611396-109611418 AAAAATAAAGGGATGGATAAAGG + Intergenic
995818023 5:116193461-116193483 GAAAGTAAAGGGGTGGAAAAAGG + Intronic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996235150 5:121118921-121118943 GAAAATAAAAGAATGGAAAAGGG + Intergenic
996513778 5:124347241-124347263 GAAAGTAAAAGGGTGGAAGAAGG + Intergenic
996816315 5:127576685-127576707 GAAAGTGAAGGAATGGAAAAAGG + Intergenic
996836399 5:127798177-127798199 ATAAATAAAGGGATGAAAAAAGG - Intergenic
996941602 5:129012789-129012811 GAAAGTAGTTGGATGGAAAAAGG - Intronic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997655639 5:135552290-135552312 GAAAATAAACTGAAGGAGAGCGG + Intergenic
997740251 5:136246659-136246681 GAAATAAAACTGAAGGAAAAAGG - Intronic
997934359 5:138097651-138097673 GAAAAGAAAAGAAAGGAAAAGGG - Intergenic
998362662 5:141602982-141603004 GAAAATAAAGGAAAGAAAAAGGG + Intronic
998695533 5:144634041-144634063 GAAAATAAAGGGATGGAACATGG + Intergenic
999818826 5:155203911-155203933 TAAAGTAAAGGGATGGAAAGAGG + Intergenic
999849351 5:155521959-155521981 GAAAATAGAGGGATTGAAAAAGG - Intergenic
999970320 5:156853936-156853958 GAAAGTAAAAGAATGGAAAAAGG + Intergenic
1000779950 5:165467466-165467488 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1001160907 5:169311923-169311945 GAAAATAAATGGTTGGATTATGG - Intergenic
1002814068 6:661939-661961 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1002952302 6:1826018-1826040 AAAAATAAAAAGATAGAAAATGG + Intronic
1003029224 6:2587427-2587449 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1003582219 6:7350044-7350066 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1004135121 6:12958474-12958496 GAAAATAAACGGAAACATAAGGG + Intronic
1004282220 6:14290109-14290131 GAAAATACAAGGGTGGAATAGGG - Intergenic
1004751420 6:18565949-18565971 GAAAGGAAAGGGATGGAAGAAGG - Intergenic
1005159238 6:22839120-22839142 GAAAGTGAATGAATGGAAAAAGG + Intergenic
1005190940 6:23223135-23223157 GAAAACAAATCAATGGAAAAAGG - Intergenic
1005367549 6:25094376-25094398 GAAAATATAAGGAGGGAAATAGG + Intergenic
1005466131 6:26115996-26116018 GAAAATAAAGGAAGGGAGAATGG + Intronic
1005673791 6:28133675-28133697 GAAAAGAAAAGGATGAAAAGAGG + Intergenic
1005679706 6:28194449-28194471 AAAAGTAAATGGATGAAAAAAGG - Intergenic
1006553849 6:34848668-34848690 AAAAATAAAGGGATGGAAAAAGG - Intronic
1006663552 6:35671501-35671523 GAAAATAAAGGGAAGGAACAAGG + Intronic
1007020023 6:38510668-38510690 GAAAACAAACTTATGGAATAAGG - Intronic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1008305518 6:49894188-49894210 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1008723998 6:54393908-54393930 GGAAAAAAAGGGAGGGAAAAGGG + Intergenic
1008775215 6:55030222-55030244 TAAGGTAAAGGGATGGAAAAAGG - Intergenic
1008802524 6:55387274-55387296 GAAAATATAAGGGTGGAAAATGG - Intronic
1008916557 6:56794251-56794273 AAAAATAAAGAGATGGTAAAAGG - Intronic
1009453376 6:63827059-63827081 TAAAGTAAAGGGATGGAAAAAGG + Intronic
1009597818 6:65758652-65758674 AAAAGTGAAAGGATGGAAAAAGG - Intergenic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1009969042 6:70606808-70606830 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1010008804 6:71027041-71027063 GACAGTAAAGGGTTGGAAAAAGG - Intergenic
1010183166 6:73112068-73112090 GAAAATATATGGATGGCAAAAGG - Intronic
1010210781 6:73361653-73361675 GAAAAGAAAGGAAAGGAAAAGGG + Intergenic
1010346609 6:74817869-74817891 GAAAATGAAGAGTTGGAAAAAGG + Intergenic
1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG + Intergenic
1011132929 6:84070918-84070940 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1011207491 6:84915378-84915400 GAAAAAAAAGAGGTGGAAAAGGG - Intergenic
1011256612 6:85428108-85428130 GAAAATACAAGGATGGTGAAGGG + Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011328878 6:86182031-86182053 TAAAGTAGAGGGATGGAAAAAGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1011789521 6:90883629-90883651 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1011902142 6:92312402-92312424 GAAAAGAAAAGGAAGGAAGATGG - Intergenic
1011907978 6:92396364-92396386 GTAAGTAAATGGATGGAAGATGG - Intergenic
1012107480 6:95182102-95182124 CAAAATAAATGGATGAAAAAGGG - Intergenic
1012221997 6:96659795-96659817 CAAAATAAAAGGATAGAAAAAGG + Intergenic
1012684793 6:102232545-102232567 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1012703413 6:102492729-102492751 GAAAATAAACAGAATGAACAAGG - Intergenic
1012738026 6:102975623-102975645 AAAAGTAAAGGGATGGAAAAAGG + Intergenic
1012748815 6:103130727-103130749 GAAAATAAAAGGTTAGAAGATGG + Intergenic
1012777615 6:103517745-103517767 GGAGATAAAGGGATGGATAATGG - Intergenic
1012897261 6:104965018-104965040 GAAAATAAACTAATGTAAACTGG + Intronic
1013741005 6:113285034-113285056 AAAAATAAAAGAATGGGAAAAGG - Intergenic
1013895339 6:115081276-115081298 GAAACTAGGCGGATGGAAAAAGG + Intergenic
1014018190 6:116558663-116558685 GAAAATAGAGGCAGGGAAAATGG - Intronic
1014149467 6:118037153-118037175 GAAATAAAATGGATGGAAAAAGG - Intronic
1014365377 6:120533893-120533915 GAAAATGAAAGGATAGAAAAAGG + Intergenic
1014531185 6:122561769-122561791 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1014683299 6:124461854-124461876 GAAAAAAGAAAGATGGAAAAAGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015184390 6:130397574-130397596 CAAAGTAAAAGAATGGAAAAAGG - Intronic
1015565784 6:134569207-134569229 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1015809296 6:137145788-137145810 GAAAATAATCAGTTGGTAAATGG + Intronic
1016472891 6:144393490-144393512 GAAAAAGAAACGATGGAAAAAGG + Intronic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016570785 6:145509869-145509891 CAAAGTAAAGGGATGGAGAAAGG + Intronic
1016646567 6:146416042-146416064 GAAAATCAAAGGATGGAAAATGG - Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017318896 6:153065087-153065109 TAAAATAAAGGGATGGAATAAGG + Intronic
1018009603 6:159657579-159657601 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1018136201 6:160780382-160780404 GAAACTAAACGGATGATACAAGG - Intergenic
1018276142 6:162133534-162133556 GAATATACAAGGATGGAGAAAGG + Intronic
1019441951 7:1052050-1052072 GAAAATAAAACGATTGAAACTGG + Intronic
1020071724 7:5231477-5231499 AAAATAAAACGGAGGGAAAATGG - Exonic
1020661587 7:10990565-10990587 GTTAATAAAAGAATGGAAAATGG + Intronic
1021183945 7:17540994-17541016 GAAAAGAAAGGGAGGGAAGAAGG + Intergenic
1021203384 7:17751990-17752012 GAAAATAAAGGGGTAAAAAAAGG - Intergenic
1021204490 7:17763684-17763706 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1021521095 7:21539837-21539859 GAAAAGCAACGGAGGGTAAAAGG - Intergenic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022290425 7:28997252-28997274 GTGAATAAACGTATGCAAAAAGG + Intronic
1022295550 7:29048346-29048368 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1022702351 7:32773461-32773483 GACAACAAACGTATGAAAAAAGG + Intergenic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1023125776 7:36952644-36952666 GAAAATGAATGGATGGGAAGCGG + Intronic
1023429258 7:40072578-40072600 GCAAATCAACACATGGAAAAAGG + Intronic
1024745164 7:52398102-52398124 TAAAATAAAGGGATGGAAAAAGG - Intergenic
1024793297 7:52992051-52992073 GAAAATATACTCAGGGAAAATGG - Intergenic
1025138298 7:56439425-56439447 GAGAATTAAGGGATGGAAAAAGG + Intergenic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1026081079 7:67221342-67221364 GAAAGGGAAAGGATGGAAAAAGG - Intronic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1026495746 7:70901174-70901196 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1026667234 7:72352765-72352787 GAAAATAGAAGAAAGGAAAAAGG + Intronic
1026696004 7:72592683-72592705 GAAAGGGAAAGGATGGAAAAAGG + Intronic
1026870998 7:73851718-73851740 GCCAATAAACTGATGGAAAGAGG - Intergenic
1027682593 7:81238996-81239018 GAAAAAAAAAGTTTGGAAAAAGG - Intergenic
1028077835 7:86536510-86536532 AAAAATCAAGGGATGAAAAAGGG - Intergenic
1028182815 7:87746668-87746690 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1028225614 7:88249345-88249367 GAAAGTGAAGGAATGGAAAATGG - Intergenic
1028438803 7:90835100-90835122 GAAGATAAAGGCATTGAAAAAGG + Intronic
1028993252 7:97073319-97073341 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1030118068 7:106078794-106078816 GAAAAAAAAAGGAGGGGAAAGGG - Intergenic
1030706529 7:112698192-112698214 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1030750825 7:113229891-113229913 GAAAATAAAAGGGTAGACAAAGG - Intergenic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1031294053 7:119980388-119980410 AGAAGTAAAAGGATGGAAAAGGG + Intergenic
1031316249 7:120261172-120261194 GAAGAGAATAGGATGGAAAAGGG - Intergenic
1031562203 7:123251958-123251980 GAAATCAAAAGGATGGTAAAAGG + Intergenic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1033706638 7:143893062-143893084 GAAAGTGAAAGGATGGAAAAAGG + Intronic
1034713050 7:153213254-153213276 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
1034752134 7:153579188-153579210 TAAAATAAAAGGATAGAAAAAGG + Intergenic
1034760850 7:153670325-153670347 GAAGATAAAAGGGTGGTAAAAGG - Intergenic
1034883674 7:154781243-154781265 GAAAATGAATGGCTGGGAAAAGG + Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1035433960 7:158843902-158843924 GAAGAAAAAAGGAAGGAAAAAGG + Intergenic
1035526955 8:321459-321481 GAAATTAAACAGAGGGAACAAGG - Intergenic
1036610054 8:10341920-10341942 GGAAATGCACTGATGGAAAATGG - Intronic
1036913614 8:12783119-12783141 GAAAGTAAAGGGTTAGAAAAAGG - Intergenic
1036931365 8:12959504-12959526 AAAAAAAAAAGGAAGGAAAAAGG - Intronic
1037136530 8:15469383-15469405 GCAAATAAACGTATGAAAATAGG + Intronic
1037378166 8:18254963-18254985 GAAAATAAACAATTGTAAAATGG + Intergenic
1037636895 8:20708164-20708186 TAAAATAGAAGGATGGCAAAGGG + Intergenic
1038050764 8:23808525-23808547 GTAAATAAACGGATCTCAAATGG - Intergenic
1038161669 8:25045445-25045467 GAAAATCAACAAATGGAAATGGG + Intergenic
1038784191 8:30595833-30595855 GAAAAGAAAGGAAAGGAAAAGGG + Intronic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1039123786 8:34177490-34177512 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1039188248 8:34941821-34941843 AAAAATAAACTGATGCAAGAAGG - Intergenic
1039217524 8:35289144-35289166 GAAAGAGAAGGGATGGAAAATGG + Intronic
1039480734 8:37871560-37871582 GAAGAAAAACCGATGGGAAATGG - Exonic
1039493241 8:37963532-37963554 GAAAACAAACGGAGGGAAAGGGG + Exonic
1039641679 8:39229484-39229506 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1039778884 8:40764090-40764112 GATAATAAAAGGGTGAAAAACGG + Intronic
1039865451 8:41497233-41497255 GAAACTAAATGAATGGAAAGAGG + Intronic
1040067267 8:43156870-43156892 CAAAGAAAAGGGATGGAAAAAGG - Intronic
1040656105 8:49510389-49510411 AAAAGTAAAAGGATGAAAAAAGG - Intergenic
1040949632 8:52924581-52924603 GCAAATAAGCTTATGGAAAATGG - Intergenic
1041060495 8:54030280-54030302 GAATGTAAAAGGATGGAAAAAGG - Intergenic
1041076134 8:54171778-54171800 GAAAATAAATGCATGGATAAAGG + Intergenic
1041159230 8:55020763-55020785 TAAAATAAAAGGGTGAAAAAAGG + Intergenic
1041227979 8:55719010-55719032 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1041281379 8:56213304-56213326 GCAAAAAAAAGAATGGAAAAGGG - Intronic
1041304329 8:56445254-56445276 GAGAGCAAAGGGATGGAAAAGGG - Intronic
1041592736 8:59608399-59608421 GAAACTAAAATGATGGAAGAAGG + Intergenic
1041816470 8:61977800-61977822 GAAAGTCAAAGGATGGAAAAGGG + Intergenic
1041877776 8:62710575-62710597 TAAAATAAAGGGGTAGAAAAAGG - Intronic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042264860 8:66898260-66898282 GAATATAAAAGAATGGAAATAGG - Intronic
1042381605 8:68121165-68121187 GAAAATAAAAGTACTGAAAATGG + Intronic
1042980629 8:74522943-74522965 GAAAATAAAGGGATGGAAGAAGG + Intergenic
1043121477 8:76330866-76330888 TAAAGTAAAGGGATAGAAAAAGG - Intergenic
1043270902 8:78331565-78331587 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1043310890 8:78858473-78858495 AACAATAAAAGGATGGACAAAGG + Intergenic
1043563129 8:81518393-81518415 GCAAATAAACTGATTAAAAATGG - Intergenic
1043599390 8:81919228-81919250 GAAAATAAACGGAAGACACAAGG - Intergenic
1043667811 8:82839543-82839565 GAAAATAAATTAATGGAAAGGGG - Intergenic
1043715440 8:83479234-83479256 GAAAATAAAGTGGTGGGAAAAGG + Intergenic
1043722518 8:83563664-83563686 GAAAGTAAAAGGGTAGAAAAAGG - Intergenic
1043816680 8:84810844-84810866 TAAAGTAAAGGGGTGGAAAAAGG - Intronic
1043937165 8:86155265-86155287 GAAAAGACACTGATGGGAAAGGG + Intergenic
1044012174 8:87007414-87007436 AAATATAAACCAATGGAAAATGG - Intronic
1044112075 8:88287251-88287273 GAGAACAAAGGGCTGGAAAAAGG - Intronic
1044175061 8:89109726-89109748 GAGAATAAATGCATTGAAAAGGG + Intergenic
1044206909 8:89501402-89501424 GAAAAGAAATAGAAGGAAAAAGG + Intergenic
1044227802 8:89738810-89738832 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1044560987 8:93611969-93611991 GAAACTAAAAGGAAGTAAAAAGG + Intergenic
1044579226 8:93806156-93806178 GAAAAGAAAAGGAAGGATAATGG + Intronic
1044707405 8:95022076-95022098 GAAAATATAAGGATTGAATAAGG + Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1045853524 8:106733881-106733903 GAAAAAAAAGGGAAGGAAGAGGG - Intronic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046029864 8:108770471-108770493 CAAAAGAAAAGGAAGGAAAATGG + Intronic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046171887 8:110519827-110519849 GAAATTGAAGAGATGGAAAAAGG + Intergenic
1046367557 8:113255860-113255882 TAAAATCAAGGGATGTAAAACGG - Intronic
1046608558 8:116397738-116397760 GAAAGCAAAAGGATGGAAAAAGG + Intergenic
1047260813 8:123257891-123257913 GAAAATAAACGGGAGGAAATGGG - Intronic
1047459851 8:125052441-125052463 GTATATAAACGAATGGAGAAAGG - Intronic
1047580663 8:126211943-126211965 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
1047591208 8:126329444-126329466 GAAAATAAAGGAAGGGCAAAGGG - Intergenic
1047657087 8:126989805-126989827 GAAAACCAAAGGAGGGAAAAGGG - Intergenic
1048416638 8:134234488-134234510 GAAATTAAAAAAATGGAAAAAGG + Intergenic
1048644236 8:136400237-136400259 GAAGAAAAAGAGATGGAAAAGGG + Intergenic
1048769117 8:137876824-137876846 GAAATTAAAAATATGGAAAAAGG + Intergenic
1049122877 8:140755624-140755646 GAAAAACAATGCATGGAAAATGG - Intronic
1049295777 8:141836226-141836248 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1050206491 9:3201899-3201921 GAAAATGAACCCATGGATAAGGG + Intergenic
1050377609 9:4988806-4988828 GAAAATTAAGGGGTAGAAAATGG - Intronic
1050971732 9:11885787-11885809 GAAAATCAACTGATTGTAAATGG - Intergenic
1051395152 9:16612424-16612446 TCTAATAAAAGGATGGAAAATGG - Intronic
1051487304 9:17622963-17622985 GAAAGGAAACGAAAGGAAAAGGG - Intronic
1051545186 9:18265796-18265818 GAAAATGAAATTATGGAAAAGGG + Intergenic
1052141335 9:24988983-24989005 AAACTTAAAGGGATGGAAAAAGG - Intergenic
1052372729 9:27684007-27684029 GAAAATAAAAGGAAGGGAAATGG - Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1054894083 9:70287614-70287636 TAAAATAAAGGGATAGAAAAAGG - Intronic
1055379694 9:75692654-75692676 GAAAATAAAGGGAGGAAAATTGG - Intergenic
1055612230 9:78034516-78034538 GAAAAGATACGGCAGGAAAAGGG + Intergenic
1055798966 9:80010741-80010763 TGAAATTAAAGGATGGAAAAGGG - Intergenic
1056032564 9:82568135-82568157 GAAAATTAAAGGCTGAAAAAGGG - Intergenic
1056685995 9:88759839-88759861 GAAAGTAAAAAGAGGGAAAAAGG + Intergenic
1056698840 9:88885255-88885277 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1057139928 9:92720180-92720202 TAAAATCAACGTAAGGAAAAGGG + Intronic
1057540168 9:95960303-95960325 GAAAATAAACACTTTGAAAAAGG + Intronic
1057558061 9:96103439-96103461 GAAAAGAAAAGGAAAGAAAAAGG - Intergenic
1057970300 9:99549912-99549934 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1058013074 9:99999516-99999538 GAAAACAACCTGATTGAAAATGG - Intronic
1058210127 9:102157672-102157694 GAAAGTGAAGGAATGGAAAATGG - Intergenic
1058308208 9:103469541-103469563 AAACTTAAAGGGATGGAAAAAGG - Intergenic
1058666952 9:107328033-107328055 GAAAGTAAAATGATAGAAAAAGG - Intronic
1058770867 9:108230149-108230171 TAAAGTAAAGGGATGAAAAAAGG + Intergenic
1059073351 9:111163804-111163826 GAAAAAAAACGGAGGTGAAAGGG - Intergenic
1059172668 9:112140532-112140554 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1059180906 9:112211233-112211255 GAACATATACAGAAGGAAAATGG - Intergenic
1059609380 9:115876470-115876492 TAAAGTAAATGGGTGGAAAAGGG - Intergenic
1059897869 9:118888430-118888452 GAAAATAAAACAATGGAGAAAGG + Intergenic
1059981576 9:119778249-119778271 GAATTTAAAGGGATGGGAAATGG - Intergenic
1060353423 9:122880412-122880434 CAAAATAAAGGGATGCAACAGGG - Intronic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1203531195 Un_GL000213v1:143699-143721 GAAAGTAAAAGGAGGAAAAATGG - Intergenic
1186751108 X:12621821-12621843 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1186751236 X:12623009-12623031 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1187214056 X:17257658-17257680 AAAAGTGAAGGGATGGAAAAAGG + Intergenic
1187681584 X:21772411-21772433 TAAAGTAAAGGCATGGAAAAAGG + Intergenic
1187689676 X:21852772-21852794 GAAAATGAACTGATAAAAAATGG + Intronic
1187773402 X:22728685-22728707 TAAAGTAAAGGGGTGGAAAAGGG - Intergenic
1188328568 X:28838420-28838442 GGAAATAACCGGAAGTAAAAGGG + Intronic
1188418108 X:29962273-29962295 GAAAAAAAAGGGATTGTAAATGG - Intergenic
1188718410 X:33491642-33491664 GAAAGCAAATGGATAGAAAACGG + Intergenic
1189218370 X:39346896-39346918 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1189291792 X:39891262-39891284 GAAAATAAAGGGAGAGTAAAAGG - Intergenic
1189598932 X:42600479-42600501 TAAAAGAAACGGATGAAAAAAGG + Intergenic
1190137921 X:47813993-47814015 GAAAATAAAGGGATAAAGAATGG + Intergenic
1190449139 X:50560010-50560032 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1190614964 X:52220848-52220870 GAAAATAAAAGGATGGAAAAAGG + Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1191903380 X:66062532-66062554 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1191954360 X:66627416-66627438 TAAAGAAAAGGGATGGAAAAAGG + Intronic
1192014426 X:67314133-67314155 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1192104473 X:68300900-68300922 GAAAATAAAGGCATGGAATAAGG + Intronic
1192820428 X:74638939-74638961 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1192913448 X:75630232-75630254 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1192970093 X:76219460-76219482 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1192978807 X:76316945-76316967 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193084358 X:77436060-77436082 GAAAATAAAACCATGGATAAGGG + Intergenic
1193133124 X:77939374-77939396 GGAAATAAATGGAGGGATAATGG - Intronic
1193153737 X:78151312-78151334 GACAATAGAGAGATGGAAAAAGG - Intergenic
1193421015 X:81281967-81281989 TAAAGTAAAGGGGTGGAAAAAGG + Intronic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193578716 X:83234660-83234682 TAAAGTAAAGTGATGGAAAAAGG + Intergenic
1193590156 X:83379584-83379606 TAAAGTAAAGGGGTGGAAAAAGG - Intergenic
1193730625 X:85098118-85098140 GAAAATGAAATGATGGAAAAAGG + Intronic
1194024677 X:88736812-88736834 GAAAATAAATTGATTGAAAATGG - Intergenic
1194378935 X:93169696-93169718 GAAAACAAAATGATGAAAAAAGG + Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194466337 X:94238535-94238557 TAAAGTAAAGGAATGGAAAAAGG + Intergenic
1194543267 X:95201646-95201668 TAAAATAAAAGGGTGGAAAAAGG - Intergenic
1194613851 X:96076898-96076920 GAAAATAAACAGGTAGAAAAAGG + Intergenic
1194626374 X:96230785-96230807 AAAAATAAAAGGAGGGAGAAAGG + Intergenic
1194628249 X:96251099-96251121 GAAAATAAAGGAATGGCAAAAGG + Intergenic
1194800472 X:98266493-98266515 GAAAGTAAAGGAGTGGAAAAAGG + Intergenic
1194921754 X:99775752-99775774 TAAAATAAAGGAATGGAAAAAGG - Intergenic
1194928248 X:99854680-99854702 GAAAATAAACTCAAAGAAAAAGG - Intergenic
1195019310 X:100810866-100810888 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1195242528 X:102966898-102966920 GAAAAGAGAAGGATGGAAGAAGG - Intergenic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1195647379 X:107247596-107247618 GAAAATAAAAGGTTGGGAAGAGG - Intergenic
1195933910 X:110107121-110107143 GAAACTAAAAGGAGGGAAAGAGG + Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196130527 X:112150451-112150473 GAAAATAAAAGAAAGGAAAGTGG - Intergenic
1196171094 X:112589352-112589374 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1196219095 X:113090201-113090223 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1197013013 X:121589946-121589968 GAAAATAAGTGAATGGAAAATGG - Intergenic
1197052339 X:122074827-122074849 GAAAATAAAGGGATGAAGAAAGG - Intergenic
1197105208 X:122705658-122705680 GAAAATTAAGGGATGGAAAAAGG + Intergenic
1197132649 X:123022277-123022299 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1197186686 X:123595240-123595262 CAAAATAAACTGATGGTGAAGGG - Intergenic
1197668882 X:129254063-129254085 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1197866968 X:131029320-131029342 GAAAACAAAGGGAAGGAAAAGGG - Intergenic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198538711 X:137613247-137613269 TAAAATAAAAGAATGGGAAAAGG + Intergenic
1198696977 X:139352356-139352378 GAAAATAAAGGGGTGGAAAAAGG - Intergenic
1199149466 X:144413507-144413529 AAAAATAAAGGGATGGAAAAAGG - Intergenic
1199355992 X:146865377-146865399 GAAAATAAAATAAAGGAAAAAGG + Intergenic
1199667412 X:150109858-150109880 AAAAACAAATGGATGGAGAAGGG - Intergenic
1199797220 X:151211753-151211775 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1199821544 X:151454064-151454086 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1199926525 X:152472158-152472180 TAAAGTAAAGGGGTGGAAAAAGG + Intergenic
1199946117 X:152669586-152669608 TAAAAAAAAAGGAAGGAAAAGGG - Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1201146810 Y:11069243-11069265 GAACAAAAACGGGTGGAATAGGG - Intergenic
1201386939 Y:13451412-13451434 GAAAAAAAAAGAACGGAAAAAGG + Intronic
1201615042 Y:15887581-15887603 TAAAATAAAAGGATGGAGGAAGG + Intergenic
1201934844 Y:19397755-19397777 GAAAATAAAGGAATGAAAATAGG - Intergenic