ID: 964320595

View in Genome Browser
Species Human (GRCh38)
Location 3:155492736-155492758
Sequence CGATCTCCAAACATGGAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964320590_964320595 15 Left 964320590 3:155492698-155492720 CCACTTAGACACGTAGTCATAGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 964320595 3:155492736-155492758 CGATCTCCAAACATGGAGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964320595 Original CRISPR CGATCTCCAAACATGGAGTC TGG Exonic
903466056 1:23553551-23553573 GGATCTGCAAAAATGAAGTCAGG - Intergenic
906371266 1:45255910-45255932 CAATCTCCAAACATGGAAGGGGG + Intronic
910293237 1:85618668-85618690 CTATCTCCAAAAATGAAGTTGGG + Intergenic
910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG + Intergenic
912563879 1:110571311-110571333 CGATCACGAAACCTGGAGTCAGG - Intergenic
919771044 1:201158750-201158772 AGAGCTCCAAACTTGGAGGCAGG - Intronic
924204215 1:241695330-241695352 ACATCTCTAAACATGGAGTTAGG - Intronic
1070227124 10:74520724-74520746 CGATTTCCAAGCATTAAGTCTGG + Intronic
1074712111 10:116185928-116185950 GGATATCCAGACATGGAGTCTGG + Intronic
1078984034 11:16572674-16572696 GGATCTGCAAACAGGAAGTCAGG + Intronic
1081305885 11:41511678-41511700 CCATCTCAAAACATGCAGTTAGG + Intergenic
1084545330 11:69812502-69812524 CCATCTATAAACATGGAGACCGG - Intronic
1086460430 11:87000280-87000302 AGATCTCCAAACAGAGACTCTGG - Intergenic
1092959450 12:13582108-13582130 CCATCTCAAAACATGGGGCCTGG + Intronic
1101846193 12:108365042-108365064 CCATCTGCAAACAAGGAGCCTGG + Intergenic
1103141703 12:118554332-118554354 TGATTTCAAAACATGGACTCTGG - Intergenic
1112992924 13:105535588-105535610 CCATCTCCAAAAATGCTGTCTGG + Intergenic
1113180414 13:107618840-107618862 CCATCTCCAAACTGTGAGTCTGG - Intronic
1117954886 14:61115096-61115118 CATTTTCCAAACATGGACTCAGG + Intergenic
1128656979 15:69469741-69469763 CAGGCACCAAACATGGAGTCAGG - Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1130139484 15:81212212-81212234 CAATCTCCAAAGATTGAATCAGG - Intronic
1134326035 16:13208748-13208770 CATTCTCCAAACATTAAGTCTGG + Intronic
1139935154 16:70565143-70565165 GGAGCTCCAAAGATGGATTCAGG - Exonic
1144680036 17:17187108-17187130 CTGTCTCCAAGCATGGACTCTGG - Exonic
1148828557 17:50413406-50413428 CATTTTCCAAACATGGCGTCAGG + Intergenic
1153574871 18:6510389-6510411 CAATTTCTAAAAATGGAGTCTGG - Intergenic
1156478366 18:37420662-37420684 CGTTCTCCAAGCATGGGGCCTGG + Intronic
1156718894 18:40045953-40045975 CAATCTCCACACATTGGGTCTGG - Intergenic
1157854103 18:51088366-51088388 TGATTTTCAAACATGAAGTCTGG - Intergenic
1167581658 19:50347739-50347761 CAATTTCCAAACATGGCCTCAGG + Intronic
932470954 2:71956713-71956735 CAATCTCCCAAAATTGAGTCAGG + Intergenic
935666360 2:105516354-105516376 TGACCTCCAAACCTGGAGCCAGG + Intergenic
944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG + Intergenic
944284342 2:197931560-197931582 CCATCTCCAAACAGGAAGACAGG - Intronic
1176230923 20:64032537-64032559 CCTTCTCCAAACAAGGAGTTAGG - Intronic
1177486262 21:21760545-21760567 CAATTTCCAAACACTGAGTCAGG - Intergenic
1178073131 21:28991252-28991274 CTGTCTCCAAACCTGGAGTGTGG - Intronic
1181741925 22:24928101-24928123 CAGTCTCTAAACATGGACTCAGG + Intergenic
1181751746 22:24993705-24993727 CTATCACCAAACATGGAGTATGG + Intronic
1181837988 22:25626770-25626792 CGATCTTCAAACCTGCAGCCTGG - Intronic
954421094 3:50419405-50419427 AGAGCTCCAACCATGGTGTCAGG - Intronic
954559813 3:51547255-51547277 CGATCTCCTAACTGGGAGACTGG - Intronic
956836981 3:73103470-73103492 CGATGTCCATAGATGGAGGCTGG + Intergenic
960270606 3:115669910-115669932 GGATCCCCCAACATGCAGTCTGG - Intronic
962367001 3:134793474-134793496 CGAACTCCAAGGATGGAGTTTGG + Intronic
964320595 3:155492736-155492758 CGATCTCCAAACATGGAGTCTGG + Exonic
965419727 3:168443021-168443043 GGATCTCTGAATATGGAGTCAGG - Intergenic
965756423 3:172032312-172032334 CCATCTGCAAACCAGGAGTCAGG + Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
970067295 4:12113128-12113150 CAATATCCAAAGATGGAATCAGG - Intergenic
973049642 4:45579805-45579827 AGATCTCCAAAAATAGAGACTGG + Intergenic
977015586 4:91689080-91689102 CAATCTCCCAACATTGAATCAGG - Intergenic
978766481 4:112410235-112410257 CGGTTTCCTAACATAGAGTCAGG + Intronic
978811614 4:112855774-112855796 CCATATCCAGACATGGACTCTGG - Intronic
979289348 4:118962745-118962767 CCATTTCCAAACATGGAAGCAGG - Intronic
979962715 4:127039963-127039985 CTATCTCCTAACATTGAATCAGG + Intergenic
980002316 4:127504889-127504911 CACTCTCCAAACATGTAGTTAGG - Intergenic
981067360 4:140498820-140498842 AGATCTCAAAACAAGGAGCCAGG + Intergenic
983278852 4:165654683-165654705 GGATCTCCAAACAGAAAGTCAGG - Intergenic
985876395 5:2601816-2601838 CCATCGGCAAACATTGAGTCAGG - Intergenic
995481386 5:112596785-112596807 AGATCTGCAAACATGCATTCAGG - Intergenic
997991153 5:138545259-138545281 TGGACTCCAAAAATGGAGTCGGG - Intergenic
1001292276 5:170472093-170472115 TGAGCACCAAACATGGAGTCAGG + Intronic
1004009086 6:11664205-11664227 TGATTTCCAAATATTGAGTCAGG - Intergenic
1005834993 6:29702278-29702300 TGAGCTCCAAGCCTGGAGTCCGG - Intergenic
1010356800 6:74944160-74944182 AAATCTCCAAGGATGGAGTCTGG + Intergenic
1014321810 6:119939341-119939363 CAATCTCCAAATATTGAATCAGG - Intergenic
1020592115 7:10153023-10153045 CGATCTCCTAATATTGAGCCAGG + Intergenic
1026941528 7:74290184-74290206 CCATCTCCAAACCTGGGGTCTGG + Intronic
1041676603 8:60546453-60546475 AGATCTCCAAACAGGGAGAGAGG + Intronic
1041678494 8:60561584-60561606 CCATTTCCCAACATGGAGACAGG - Intronic
1041776874 8:61532774-61532796 AGATCTCCAAACATGCAGTCTGG - Intronic
1043420334 8:80091062-80091084 CTATCTCCAAACATGTCGTCTGG + Intronic
1052300817 9:26950440-26950462 CAATCTCCATACAAGGAGTTGGG + Intronic
1057473852 9:95382221-95382243 CCAGCTCCTAACATGGTGTCAGG - Intergenic
1058230914 9:102423382-102423404 CTATCACCAAACATTGAGTCTGG + Intergenic
1059621589 9:116011673-116011695 CATTCTCCAAACGTGAAGTCAGG + Intergenic
1061610762 9:131744122-131744144 CCATCTTCCACCATGGAGTCTGG - Intergenic
1188945072 X:36290600-36290622 CCATCTCTGAACTTGGAGTCAGG - Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1194072695 X:89347215-89347237 CAATCTCCAAAGATCGAATCAGG - Intergenic
1199747817 X:150785113-150785135 TGATCTTCAAACATGGAGAAAGG - Intronic
1201424891 Y:13838147-13838169 CATTCTTCAAAAATGGAGTCTGG + Intergenic
1201680141 Y:16636806-16636828 CAATTTCCAAACATGGCCTCAGG + Intergenic
1202201079 Y:22349476-22349498 AGAACTCCAAATAAGGAGTCTGG + Intronic