ID: 964327570

View in Genome Browser
Species Human (GRCh38)
Location 3:155563806-155563828
Sequence TAGGCTAGGAAGGGAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964327570 Original CRISPR TAGGCTAGGAAGGGAGCTGA GGG (reversed) Intronic
900435810 1:2630002-2630024 TGGGCCAGGAAGGGATCTGCAGG + Intronic
901804027 1:11726486-11726508 TTGGCTCGGAAGGAAGCTGCTGG - Intergenic
903633660 1:24797469-24797491 GAGGCTAAGATGGGAGGTGAAGG + Intronic
904383458 1:30126503-30126525 TAGGCTGGGATGGCACCTGAAGG - Intergenic
904475696 1:30763460-30763482 CAGGCTAGGAAGGCAGCAGGAGG - Intergenic
905511957 1:38529027-38529049 TTGGCTTGGAAGGGACTTGATGG - Intergenic
905766634 1:40607228-40607250 GAGGGAAGGGAGGGAGCTGAAGG - Intergenic
907907726 1:58799654-58799676 AAGGCAAGGAAGGGAAATGAAGG - Intergenic
908101625 1:60796957-60796979 TGAGCTAGGAAGGCAGCTGGGGG + Intergenic
909394272 1:75152126-75152148 AATGCTAGGAAGGAGGCTGAGGG - Intronic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
909598818 1:77439552-77439574 GAGGCTAGGAAGAGTGATGAGGG - Intronic
911152214 1:94606759-94606781 AAGGCGAGGAAGGAAGCAGAGGG + Intergenic
912195406 1:107391835-107391857 AATGCTAGGGAGGGACCTGATGG - Intronic
912447990 1:109751957-109751979 TAGGCTAGAAAAGGAGGTGGTGG - Intronic
912801111 1:112720238-112720260 TGGCCTTGGGAGGGAGCTGAGGG - Intergenic
913989592 1:143598504-143598526 TAGGCTCAGCAGGGAGCTGCTGG - Intergenic
913990685 1:143609002-143609024 TAGGGTAAGTAGGGAGGTGATGG + Intergenic
914226182 1:145721197-145721219 TAAACTAGGAGGGGAGATGAGGG - Intronic
914229582 1:145753280-145753302 TAAGCTGGAAAGGGATCTGATGG + Intronic
916177956 1:162058222-162058244 TAGGCTGGGAGGGGACCTGGGGG + Intergenic
916567964 1:165998228-165998250 CAGGCAAGGATGGGATCTGATGG + Intergenic
916886005 1:169069016-169069038 GAGGAAAGGAAAGGAGCTGAAGG - Intergenic
917619622 1:176782822-176782844 CTGGCTGGGAAGGGATCTGAAGG + Intronic
918072914 1:181146631-181146653 CAGGCCAGGAAGGGAGGGGAAGG + Intergenic
918414726 1:184294898-184294920 GAGGCAAGAAAGAGAGCTGAAGG + Intergenic
919774797 1:201187486-201187508 TCGGCTAGGCAGGCAGCTGGGGG + Intergenic
919820052 1:201466965-201466987 TAGGAGAGCAAGGGAGCTGAAGG - Intronic
920049075 1:203152438-203152460 CATGGTGGGAAGGGAGCTGATGG - Intronic
920349744 1:205329901-205329923 TAGCCTTGGAAGGGAGCACATGG - Intergenic
920669660 1:207993610-207993632 CAGGCTCTGAAGGGAGCTTAGGG + Intergenic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
922241339 1:223757155-223757177 TAAGTTAGGAAGGGAGGTGAGGG + Intronic
923209391 1:231789327-231789349 TAAGCAAAGAAGGGAGCTGTAGG + Intronic
923416054 1:233761435-233761457 TAAGCTAGGAAGAGAGATCAAGG + Intergenic
924809111 1:247385735-247385757 TAAGATAGGAAGGCAGCAGATGG + Intergenic
1062944572 10:1450706-1450728 GTGGCGAGGAAGGGAGGTGAGGG + Intronic
1063299681 10:4840431-4840453 TGGGCCAGGGAGGGAGCTGAGGG - Intronic
1067174121 10:43930527-43930549 TAGACTAAGAAGGGGTCTGAGGG + Intergenic
1067917847 10:50419967-50419989 GAGACTAGGAAGGGAGCTCTTGG - Intronic
1068573793 10:58660691-58660713 TAGCCAAGGAAGGGAGGTAATGG - Intronic
1069899741 10:71700659-71700681 GAGGCTGGGAAGGGAGAGGAGGG + Intronic
1070238127 10:74652013-74652035 TTGGCTATGAAGGGATATGAAGG + Intronic
1072074960 10:91961539-91961561 AAAGCAAGGAAGGGAGCAGAGGG - Intronic
1073061870 10:100738123-100738145 CAGGCCAGGGAGGGAGCTCAGGG - Intronic
1074434053 10:113418660-113418682 AAGACTGGGAAGGGTGCTGATGG + Intergenic
1075353444 10:121747301-121747323 AGGGCGAGGAATGGAGCTGAGGG - Intronic
1076620056 10:131781273-131781295 TGGGCTAGGAAGGGTTCAGAGGG + Intergenic
1076752607 10:132551146-132551168 TAGGCAAGGGAGGGTGCTCAGGG - Intronic
1077005756 11:355390-355412 CAGGGTAGGAAGGGAACAGATGG + Intergenic
1077318460 11:1929496-1929518 AAGGCTGGGAAGGGAGGAGACGG - Intronic
1077496977 11:2891158-2891180 TGGGCTAGGAAGGGGGCTCCCGG + Intronic
1077956718 11:7028565-7028587 TAAACTAGGAAGCCAGCTGAGGG - Intronic
1078086922 11:8239449-8239471 AGGGCTGGGAAGGGAGCAGAGGG + Intronic
1078575096 11:12494596-12494618 TGTGCTAGGAAGGGAGATCAAGG + Intronic
1078749121 11:14143258-14143280 TATACTAAGAAGGGAACTGAAGG + Intronic
1079103746 11:17557620-17557642 TGGGGTAGGCAGGGAGCAGAGGG + Intronic
1080114541 11:28607085-28607107 CAGCCTAGGAGGGGAGCTGCCGG + Intergenic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1080630757 11:34073311-34073333 TAGGATAGAAAGGGGGCTGATGG + Intronic
1080883543 11:36345071-36345093 GAGGCTAGGAAGGGAGGTCAGGG + Intronic
1081879167 11:46433409-46433431 TAGGCTTGGAAGGGTAATGAGGG - Intronic
1083193470 11:61068938-61068960 AAGGCGAGGAAGGGAGTTGAGGG - Intergenic
1083259646 11:61516186-61516208 TAGGCTAGCACGGGAGGTAAGGG - Intronic
1084585030 11:70054340-70054362 TAGGCCAAGAAGGTAGCTAAGGG + Intergenic
1085382257 11:76130781-76130803 TAGACTTGGAAGGGAGCTAAAGG - Intronic
1085865053 11:80281197-80281219 TAAGCCAGTAAGGGATCTGAAGG + Intergenic
1087384436 11:97452574-97452596 TAGGCTTAGAGGGAAGCTGAAGG + Intergenic
1087708149 11:101519035-101519057 GAGGCTGGGAAGGGTACTGAAGG + Intronic
1088113329 11:106287116-106287138 CAGGCTAGGCAAGGAGCAGATGG - Intergenic
1089881049 11:121774053-121774075 TAGGCCAGGAAGGGAGCCACTGG + Intergenic
1090900752 11:131028683-131028705 TAGGTTGGGGAGGGAGCTGAGGG + Intergenic
1091875364 12:3929194-3929216 TAGGCAAGGAAGGAATCTGTGGG - Intergenic
1091967615 12:4758350-4758372 AAGGTTAAGAAGGGAGATGATGG + Intronic
1094443487 12:30505121-30505143 TAGGTCAGGTAGGAAGCTGATGG + Intergenic
1095672788 12:44879424-44879446 TATGGTAGGAAGGGATCTAAGGG - Intronic
1096980355 12:55725098-55725120 TTGGCCAGGAAGGGAGGTGCTGG + Intergenic
1097455057 12:59790133-59790155 TAGGCTGGGAAGGGGTTTGAGGG - Intergenic
1098018350 12:66130196-66130218 TAAGCAGGGAAGGGAGCTTACGG - Intronic
1098470483 12:70837775-70837797 AAGGAAAGGAAGGGATCTGAAGG - Intronic
1099125346 12:78748641-78748663 GAGGCTAGGAAGGGCAGTGAGGG + Intergenic
1099532167 12:83796880-83796902 TAAGCTAGAAAGAGAGCTGCAGG - Intergenic
1100455610 12:94748772-94748794 TAGGCAGGCAAGGGAGATGAGGG - Intergenic
1100661739 12:96707125-96707147 TAGGATAGGAAGGAAACTAAGGG + Intronic
1101877783 12:108607029-108607051 AAGGGGAGGAAGGGAGCGGAGGG - Intergenic
1102031278 12:109741476-109741498 CCTGCTGGGAAGGGAGCTGATGG + Intronic
1103726229 12:122998618-122998640 GGGGCAGGGAAGGGAGCTGAAGG + Intronic
1105294205 13:19074090-19074112 TGAGCTGGGAAGGGAGCTGTTGG - Intergenic
1106784736 13:33095383-33095405 GAGGCTAGGAAGGGTGTGGAGGG - Intergenic
1108802378 13:54115400-54115422 TAGGAGAGGAGGTGAGCTGATGG + Intergenic
1109367648 13:61377646-61377668 TAGGCGAGGAAGAGGGCAGAAGG + Intergenic
1113591927 13:111507385-111507407 TAGGCTCAGAAGGGAAGTGAGGG - Intergenic
1114974845 14:28082747-28082769 TTGGCAAGGCAGGGAGGTGATGG + Intergenic
1115026659 14:28755125-28755147 GGGGCTAGGAAGGGTGCAGAAGG + Intergenic
1115747789 14:36455535-36455557 TAGACAAGGAGGTGAGCTGAAGG + Intergenic
1116132897 14:40881420-40881442 TAGAATAGGAAGGGAACTTAGGG + Intergenic
1116265005 14:42676701-42676723 GAGGCTAGGAAGGGTAATGAGGG + Intergenic
1119234489 14:73008114-73008136 TAGGATAGGAGAGGAGCTGCAGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120044372 14:79789990-79790012 GAGGCCAGGAAGGCAGCAGAGGG + Intronic
1121055671 14:90850098-90850120 TAGTCTGGGAAGGGATCTGTGGG + Exonic
1121063941 14:90943502-90943524 TTGGCTATGAAGGCACCTGAAGG - Intronic
1121066025 14:90965817-90965839 TAGGTTAGTAAGGGTGCAGATGG + Intronic
1121191425 14:92034120-92034142 GAGGCTAGAAAGGGAGCTGGAGG + Intronic
1121566291 14:94912476-94912498 TTGGCAAGGAGGGGAGCTGGGGG - Intergenic
1122031935 14:98918745-98918767 GAGGATAGGAAGGGAGGTGAAGG + Intergenic
1122748442 14:103915096-103915118 TTGGATAGGAATGGGGCTGATGG - Exonic
1123024726 14:105419421-105419443 TAGGCCTGGAAGGGAGGTGTGGG + Intronic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1125440143 15:39692968-39692990 TAAGCTGGGAAGTGAGCGGAGGG - Intronic
1126548977 15:49906795-49906817 TAGGCTGGGATGGGAAATGAAGG - Intronic
1128421027 15:67491781-67491803 TGGGGCAGGGAGGGAGCTGAGGG - Intronic
1128886116 15:71289717-71289739 GAGGCTAGGAAGGCAGGTTAGGG - Intronic
1129042575 15:72702746-72702768 AAGGCAAGGAATGGATCTGAGGG - Intronic
1130106858 15:80935217-80935239 TGGGGTCAGAAGGGAGCTGATGG + Intronic
1131375563 15:91920257-91920279 GAGGCTGGGATGGGAGCTCAAGG + Intronic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1137624864 16:49901160-49901182 AAGGCTAGGAAGGGAGCATGGGG + Intergenic
1137881152 16:52049959-52049981 TGGGCTAGGAATGGAAGTGAGGG - Intronic
1138324391 16:56151785-56151807 TGGATAAGGAAGGGAGCTGAGGG + Intergenic
1138458373 16:57133900-57133922 CATGGTAGGAAGGGGGCTGAGGG + Intronic
1138610732 16:58121823-58121845 TGGGATAGGGAGGGAGCTGGTGG + Intronic
1138904193 16:61310747-61310769 TAGGCAAGGAAGAGAGAAGAGGG + Intergenic
1139433985 16:66925740-66925762 TAGGCGAGGTCCGGAGCTGAGGG + Intergenic
1139446009 16:66999199-66999221 TAGGCTAGGACAAGAGCAGAAGG + Intronic
1139652866 16:68371364-68371386 CAGGCCAGGAACGGAGCTGGCGG - Exonic
1140619159 16:76707024-76707046 GAGACTAGGAAGGGAAGTGAGGG + Intergenic
1142525058 17:534413-534435 TGGGGTAGAAAGGAAGCTGAGGG + Intronic
1145764778 17:27451034-27451056 AAGGCTAGAAAGGGTGCTTAAGG - Intergenic
1145990735 17:29077926-29077948 TAGGGCAGGAAGTCAGCTGATGG - Exonic
1147130635 17:38405985-38406007 TAGGCTAGAAAGGCAGCAGGAGG - Intergenic
1147266854 17:39239684-39239706 TGGGGTAGGAAGGGAGGTGTGGG + Intergenic
1147935706 17:44009560-44009582 CAGCCTAGAAAGGGAGCTGTGGG - Intergenic
1148774425 17:50087674-50087696 TAGGATAGGAAGGGTGAGGATGG + Intronic
1151544149 17:74781987-74782009 TACCCCAGGAAGGGAGCTGGAGG - Intronic
1155052724 18:22162937-22162959 TATGGTAGGAAAGGAGGTGAAGG - Intergenic
1155673374 18:28399274-28399296 GAGGCAAGGAAAGGAGATGAAGG - Intergenic
1155981685 18:32186834-32186856 GAGGCTAGGAAGGGAAGGGAAGG - Intronic
1156124412 18:33886163-33886185 GAGGCTAGGAAGGGGAGTGAGGG + Intronic
1156404294 18:36769889-36769911 TAGGGTAGCAAGGGATTTGATGG + Intronic
1157304271 18:46505778-46505800 TGGCTCAGGAAGGGAGCTGAGGG + Intronic
1157530648 18:48417957-48417979 TAGGCAAGGAGGAGACCTGAGGG + Intergenic
1157925987 18:51766835-51766857 TAGGATAGGATGGCAGATGAAGG + Intergenic
1159898770 18:74022560-74022582 TAGCATTGGAAAGGAGCTGAGGG + Intergenic
1160088540 18:75803340-75803362 TAGGCTTGGGAGGTAGCTGAGGG + Intergenic
1161781764 19:6297725-6297747 GAGCATAGGAAGGAAGCTGAGGG + Intergenic
1163818658 19:19483496-19483518 GATGCTAAGAAGGGAGTTGAGGG + Intronic
1164145675 19:22511105-22511127 TAGGCTGGGAAAGGAGCAGCGGG + Intronic
1164382745 19:27749084-27749106 TGGGCCAGGAAGAGAGCTGTGGG - Intergenic
1167147901 19:47693998-47694020 TGGGCTAGGAAGGGGGCTTCTGG + Intronic
1167388296 19:49177692-49177714 CAGGCAGGGAAGGGAGATGAAGG - Intronic
1167454619 19:49591733-49591755 AAAGCTAGGTAAGGAGCTGAGGG + Exonic
925599400 2:5592097-5592119 TTGGCTAGGAAGAGAGGAGAGGG + Intergenic
926103778 2:10137590-10137612 TATGCTAGAAAGGTAGCTTATGG + Intergenic
926228868 2:10987719-10987741 CAGGCCAAGAAGGGAACTGAAGG - Intergenic
926676356 2:15625319-15625341 TAGGCTGGGAAAGGATATGAGGG + Intronic
928589729 2:32801851-32801873 GAGACTAGGAAGGGAGTTGATGG + Intronic
930527877 2:52553486-52553508 GAGGCTAGGAAGGGTAGTGAGGG + Intergenic
930873483 2:56189724-56189746 TGGGGTAGGAAGGGAGGTAAGGG - Intronic
931222972 2:60304953-60304975 TAGAGTAGGAAGGAACCTGAGGG - Intergenic
931500013 2:62855345-62855367 GAGCATAGGAGGGGAGCTGATGG + Intronic
933554629 2:83816616-83816638 TAGGCTGGGAAGGGTAGTGAGGG - Intergenic
935831600 2:107006477-107006499 AAGGAGAGGAAGGGAGGTGATGG - Intergenic
936793614 2:116181782-116181804 GAGGCTAGGAAGGGTAGTGAGGG - Intergenic
937608419 2:123829470-123829492 AAGGCTGGGAAGGGAGCAAATGG - Intergenic
937987029 2:127642531-127642553 TGGGCGAGGACGGGGGCTGAGGG + Intronic
938297709 2:130188767-130188789 TAGCATAGAAAGGGAGCTGGAGG + Intronic
938459061 2:131485899-131485921 TAGCATAGAAAGGGAGCTGGAGG - Intronic
939606596 2:144262615-144262637 TAGGAGAGGAAGGGAGGGGAGGG + Intronic
940678334 2:156752602-156752624 TAACCCACGAAGGGAGCTGAAGG + Intergenic
940712634 2:157180743-157180765 TTGGGAATGAAGGGAGCTGATGG + Intergenic
945033596 2:205686013-205686035 AGGGCTAGGAGGAGAGCTGAGGG - Intronic
945056382 2:205872915-205872937 GTGGCTAAGAAGGGAGGTGAGGG - Intergenic
945328368 2:208510515-208510537 TAGCCGAGGATGAGAGCTGAAGG + Intronic
946020198 2:216635289-216635311 TAGGGAAGGAAGCGAGCCGAGGG - Intronic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
947624562 2:231611664-231611686 TAGGCTAGGAGGTGGGCTGAGGG + Intergenic
947818900 2:233057312-233057334 GAGGCTTGGAAAGCAGCTGAGGG - Intergenic
948243457 2:236457797-236457819 GAGGCAAGGAAGGGAGCTTCTGG + Intronic
948602950 2:239117617-239117639 TAGACTAGGAAGGGCGCACAGGG + Intronic
949036358 2:241817286-241817308 CAGCCTCGGAAGGGAGCTGTGGG - Exonic
1169045690 20:2533022-2533044 TAGGCTGGGGAGGGAACTGAGGG - Intergenic
1169259024 20:4121758-4121780 TAGGCTATGAATAGAACTGATGG + Intronic
1170739558 20:19043355-19043377 TTGGCTATCAAGGGAGGTGATGG - Intergenic
1174558256 20:51412093-51412115 AAGGCTGGAAGGGGAGCTGAAGG - Intronic
1174985837 20:55451015-55451037 TAGGCTAGAAGTGGGGCTGATGG + Intergenic
1176289036 21:5034563-5034585 TGGCCTTGGAAGGGAGATGAAGG - Intronic
1179868199 21:44229041-44229063 TGGCCTTGGAAGGGAGATGAAGG + Intronic
1181328100 22:22066903-22066925 TAGACAAGGAAGGAAGCGGATGG - Intergenic
1183333904 22:37235899-37235921 GAGGCCAGGCAGGGGGCTGAGGG + Intronic
1184703336 22:46192966-46192988 GAGGCTGGGAAGGGTGGTGAGGG + Intronic
949921084 3:9001073-9001095 GAGGCTAGGAAGGAAGGGGAGGG + Intronic
953757780 3:45662596-45662618 TAGGGAAGGAAGGGAGAGGATGG - Intronic
953930783 3:47004767-47004789 GAGGCTAGGCAGGGAGGGGAAGG - Intronic
954034339 3:47842836-47842858 TGGGCTAGGAGGGCAGGTGATGG + Intronic
954448432 3:50558993-50559015 CAAGCTAGGATGGGAGCTGAGGG - Exonic
955600714 3:60642241-60642263 TAGGCTAGGAAGGCGGGGGATGG + Intronic
956880193 3:73502555-73502577 AAGGCAAGGGAGGGAGTTGAAGG - Intronic
957226809 3:77459827-77459849 TTGGGAAGGAAGGGAGCAGAAGG + Intronic
958195269 3:90235523-90235545 AAGCATGGGAAGGGAGCTGAGGG + Intergenic
958418678 3:93906929-93906951 AAGCATGGGAAGGGAGCTGAGGG + Intronic
959445896 3:106439052-106439074 TAGGCTAAGAAAGGAGGGGAGGG + Intergenic
961324971 3:126104481-126104503 TAGGGTTAGGAGGGAGCTGAGGG + Intronic
961544256 3:127621232-127621254 TGGGCCCGGAAGGGAGGTGAGGG + Intronic
961853412 3:129844700-129844722 TGGTCTAGGCAGGCAGCTGATGG + Intronic
964327570 3:155563806-155563828 TAGGCTAGGAAGGGAGCTGAGGG - Intronic
965601918 3:170463152-170463174 AATGCTAGGAAGGCAGGTGAGGG - Exonic
965729900 3:171760728-171760750 CAGCCTAGGATGGGAGCTTAAGG + Intronic
967228899 3:187319101-187319123 AAGGTTAGGCATGGAGCTGATGG - Intergenic
968462462 4:732294-732316 TAGGGAGGGAAGGGAGGTGAGGG - Intronic
969439334 4:7208146-7208168 CAGGCCAGGGAGGGAGCTGGGGG - Intronic
969728500 4:8939700-8939722 GAGACTGGGAAGGGAGCTGCAGG - Intergenic
969809430 4:9636600-9636622 TAGGGCAGGATGGGAGCTGACGG - Intergenic
972001047 4:34033854-34033876 TTGGCTTGTAAGGGAGCTGTGGG - Intergenic
973175156 4:47196495-47196517 TATGCAAGCAAGGGAGCAGATGG + Intronic
975299672 4:72775036-72775058 GAGGCTAGGGAGGTAGCTAAGGG + Intergenic
977588500 4:98801487-98801509 AAGGGTGGGAAGAGAGCTGAGGG - Intergenic
979554111 4:122025272-122025294 GAGGTTAGGCAGGGAGGTGAGGG + Intergenic
979597928 4:122555121-122555143 TAGGCTGGGAAGGGAGCAAGTGG - Intergenic
979819947 4:125158581-125158603 TAGGATAGAAAGGGAGCTGAGGG + Intergenic
980842765 4:138285852-138285874 TAGGATAGGCACAGAGCTGATGG - Intergenic
981954708 4:150455811-150455833 GAGGCTGGGAAGGGTGGTGAGGG - Intronic
981976227 4:150731685-150731707 GAGGCTAGGAAGGGTAGTGAGGG + Intronic
983595046 4:169457052-169457074 GAGGCTAGGAAGGGTGGTGGTGG + Intronic
984383171 4:179020925-179020947 TAGACTAGGCAGTGAGCTGGAGG + Intergenic
986782255 5:11077320-11077342 TAAGCAGGGAAAGGAGCTGAGGG + Intronic
987219871 5:15780092-15780114 GAGTCTACAAAGGGAGCTGAAGG + Intronic
988733261 5:33994693-33994715 TAAACTATGAAGGGAGATGAGGG + Intronic
989673111 5:43942892-43942914 GAAGCTAGGAAGGGAACTGGGGG + Intergenic
990237276 5:53781703-53781725 GAAGGTAAGAAGGGAGCTGAGGG + Intergenic
992057485 5:73005437-73005459 TAGGGTAGGTTGGGAGCTTAAGG - Intronic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
993231682 5:85245872-85245894 TAGGCTAAGAAGGGAGTTACAGG - Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
995635204 5:114180769-114180791 TTGACTAGGAAGGGGGCTGAGGG - Intergenic
995673382 5:114633493-114633515 GAGGCTGGGAAGGGAAGTGAGGG - Intergenic
997763069 5:136469171-136469193 CAAACTAGAAAGGGAGCTGATGG - Intergenic
998670301 5:144346002-144346024 GAGGCTAGGAAGGGTAATGAGGG - Intronic
998849691 5:146340957-146340979 TAGGCAAGGAAGGGAGTATAAGG - Intergenic
999064852 5:148674529-148674551 TGGGCTAGAAATGGAGATGATGG + Intronic
999186601 5:149715293-149715315 CAGGCCACAAAGGGAGCTGAGGG + Intergenic
999676026 5:154003622-154003644 TTGGCTAGGAAGGGACATGAAGG - Intronic
999736603 5:154517759-154517781 GAGGCTAGGATGGGAGCTAAGGG - Intergenic
1000794519 5:165648348-165648370 GAGTATAGGAAGGGAGGTGAGGG + Intergenic
1001407279 5:171484935-171484957 ATGGCTGGGATGGGAGCTGAAGG + Intergenic
1003419280 6:5941126-5941148 TAGGCCAGGAAGGGTTCTGATGG + Intergenic
1004210922 6:13642891-13642913 TAAGATAGGAAGGGACCTGGGGG - Intronic
1006112938 6:31759756-31759778 TGGGTGAGGAAGGGAGCTGGAGG - Intronic
1006185630 6:32180169-32180191 TAGGCTGGGAGGGGGCCTGAGGG - Intronic
1006424541 6:33956024-33956046 TTCGTTAGGAAGGGACCTGAGGG + Intergenic
1006453741 6:34120371-34120393 GAGGCAAGGAAGGCAGGTGAGGG + Intronic
1006974667 6:38088385-38088407 GAGGCTGGGAAGGGTACTGAAGG + Intronic
1008249715 6:49225211-49225233 GAGGCTAGCAAGGGGGCTGTGGG - Intergenic
1008304849 6:49888506-49888528 TGGGCCAGGAAGTGAGCTGTGGG + Intergenic
1009823926 6:68841857-68841879 GAGGCTAGGAAGGGTAGTGAGGG + Intronic
1012026501 6:94000047-94000069 AAGTCCAGGAAGTGAGCTGATGG - Intergenic
1012202368 6:96422882-96422904 GAGGCTGGGAAGGGAAGTGAGGG - Intergenic
1012986343 6:105880389-105880411 CAGGCTGGGAAGGTGGCTGAGGG - Intergenic
1013613501 6:111818879-111818901 TAGGCAATGGAGGAAGCTGATGG - Intronic
1014578189 6:123100396-123100418 CATGTTAGGGAGGGAGCTGATGG - Intergenic
1015097123 6:129429073-129429095 TAGGCAAAGAAGAGAGGTGAAGG - Intronic
1016762503 6:147753705-147753727 GAGGCTGGGAAGGGTGGTGAGGG - Intergenic
1019868304 7:3734055-3734077 TGGGCAAGGAAAGGAGCTGTGGG - Intronic
1020061618 7:5156726-5156748 TAGGATGAGAAGGGAGGTGAGGG - Intergenic
1020166540 7:5811935-5811957 TAGGATGAGAAGGGAGGTGAGGG + Intergenic
1021610856 7:22456762-22456784 TAGGCCAAGAAGGGAACAGAAGG + Intronic
1022260563 7:28700380-28700402 TAGCCAAGGAAGTCAGCTGAGGG - Intronic
1022324536 7:29319058-29319080 GAGGCTAAGACGGGAACTGAGGG + Intronic
1022648114 7:32250463-32250485 TAGGCTGGGAAGGGAGCCAGGGG - Intronic
1023828332 7:44024589-44024611 TGGGCCAGGAAGGGAGGGGAGGG + Intergenic
1025951073 7:66145920-66145942 TGAGCAAGGAAGGGAGCTGATGG - Intronic
1029210237 7:98901993-98902015 TAGTCAAGGAAGGCTGCTGATGG - Intronic
1029519122 7:101049030-101049052 TAGGGTAAGAAGGTAGCTGGGGG + Intronic
1029756633 7:102578036-102578058 TGGGCCAGGAAGGGAGGGGAGGG + Intronic
1029774575 7:102677105-102677127 TGGGCCAGGAAGGGAGGGGAGGG + Intergenic
1030320433 7:108162041-108162063 TAGGCTAGGCACTGTGCTGAAGG + Intronic
1032130786 7:129225463-129225485 TAGGAGAGGAAGGGAGGGGAGGG + Intronic
1033921722 7:146401324-146401346 TAGGCAAGTAACGGAGCTGGTGG + Intronic
1035373523 7:158393861-158393883 TTGGCTGGGGAGGGAGGTGATGG - Intronic
1036212418 8:6853188-6853210 GAGGCTAAGCAGGGAGTTGATGG - Intergenic
1037359016 8:18053795-18053817 CAGGCTGGGAAGGGAGGTGTGGG - Intergenic
1037635649 8:20699481-20699503 TTGGCTAGGAAGGTAGCTCCTGG - Intergenic
1037727001 8:21491067-21491089 TTCGCTAGAGAGGGAGCTGATGG + Intergenic
1039064766 8:33598831-33598853 GAGGCCAGGAAGGGAGTGGAAGG - Intronic
1039880964 8:41625419-41625441 TTGGCCAGGAAGGAAGCTAAAGG - Intergenic
1040866032 8:52049992-52050014 TATGCTAGGTGGGGAGGTGAGGG - Intergenic
1043751035 8:83934495-83934517 TAGTCTACTAAGGGAGCTGAGGG + Intergenic
1043886751 8:85609750-85609772 TTGAGTAGGACGGGAGCTGAAGG + Intergenic
1044562795 8:93629729-93629751 GACCCTAGGAAGGGAGCTGCAGG - Intergenic
1044805664 8:96005831-96005853 CAGGTTAGGAAAGGAGGTGAGGG + Intergenic
1045165943 8:99605113-99605135 AAGACTAGTAAGGGAGGTGAAGG - Intronic
1047305493 8:123649762-123649784 TAGCCTGAGAAGGGGGCTGATGG + Intronic
1047437132 8:124844001-124844023 TGGAGTAGGGAGGGAGCTGAGGG + Intergenic
1047922969 8:129654189-129654211 TAGGCCAGGAAGGGAGAAGGTGG - Intergenic
1050162331 9:2731589-2731611 TAGGCTTGGGAAGGAGCTCAAGG + Intronic
1050285158 9:4093681-4093703 TGGGTTAGCAAGGAAGCTGAAGG - Intronic
1050578117 9:7020956-7020978 GAGGCTAGGAAGGGTGGTGGGGG - Intronic
1052433146 9:28392949-28392971 AAGGCTATGAATGGTGCTGAGGG + Intronic
1053035418 9:34823459-34823481 TAGGCAAGGATGGGACCCGAAGG - Intergenic
1055419233 9:76119947-76119969 GAGGCTGGGAAGGGTGGTGATGG - Intronic
1057265661 9:93615894-93615916 TGAGCTGGGAAGGGAGCTGTCGG + Intronic
1059461491 9:114433425-114433447 CAGGCTTGGGAGGGTGCTGAAGG - Intronic
1060227634 9:121804099-121804121 GAGGCTGGGAAGGGTGTTGAGGG - Intergenic
1060227800 9:121806067-121806089 GAGGCTGGGAAGGGTGTTGAGGG + Intergenic
1060361258 9:122959724-122959746 TAGCCCAGAATGGGAGCTGATGG - Intronic
1060823812 9:126676244-126676266 CAGGCAAGGATGGGAGGTGACGG - Intronic
1062448909 9:136607387-136607409 TGGGGCAGGAGGGGAGCTGACGG + Intergenic
1186944540 X:14550872-14550894 CTGGCTAAGAAGTGAGCTGATGG - Intronic
1187314349 X:18178787-18178809 TAGGTTAGGAAAGTGGCTGAAGG + Intronic
1187945782 X:24425269-24425291 CAGGCAAAGAAGGGAGCTGAGGG + Intergenic
1189103801 X:38217047-38217069 TTGGACAGGAAAGGAGCTGAGGG - Intronic
1190279052 X:48917751-48917773 TAGGTTAGGAAGGGCTCCGAAGG + Intronic
1190322852 X:49188633-49188655 GGGGCTTGGAAGGGCGCTGAGGG - Exonic
1192078210 X:68021857-68021879 TAGCCTAGGGAGGCAACTGAGGG - Intergenic
1192582889 X:72299545-72299567 GGAGCTAGGAAGGGAGGTGAAGG - Intronic
1192795389 X:74421258-74421280 TAGTTTGGGAAGGGAGCTGGGGG + Intergenic
1193149975 X:78114901-78114923 TTGACTAGAAAGGAAGCTGAAGG + Intronic
1194615827 X:96102687-96102709 CAGACTAGAAAGGGAGCTTAAGG + Intergenic
1194836132 X:98685534-98685556 AAGGCTGGGGAGGGAGCTGTAGG + Intergenic
1195507780 X:105678495-105678517 GAGGCTAGGAAGGGTAATGAGGG - Intronic
1198784651 X:140273947-140273969 TGGACTGGGAAGGGAGGTGAGGG - Intergenic
1200891826 Y:8332204-8332226 TAGGCTAGGCATGCAGGTGATGG + Intergenic
1202246494 Y:22825642-22825664 TAGGCTAGGCATGCAGGTGATGG + Intergenic
1202258672 Y:22946459-22946481 TGGGCTAGGAAGTAAGCTGTGGG - Intergenic
1202399482 Y:24459390-24459412 TAGGCTAGGCATGCAGGTGATGG + Intergenic
1202411661 Y:24580217-24580239 TGGGCTAGGAAGTAAGCTGTGGG - Intergenic
1202459121 Y:25089855-25089877 TGGGCTAGGAAGTAAGCTGTGGG + Intergenic
1202471298 Y:25210696-25210718 TAGGCTAGGCATGCAGGTGATGG - Intergenic