ID: 964329795

View in Genome Browser
Species Human (GRCh38)
Location 3:155589775-155589797
Sequence CTGCTGTCATTGCTAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964329795_964329798 26 Left 964329795 3:155589775-155589797 CCTCTTTTTAGCAATGACAGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 964329798 3:155589824-155589846 AAGTGCTAGGCAGTGTTCTAAGG 0: 1
1: 0
2: 9
3: 88
4: 440
964329795_964329797 13 Left 964329795 3:155589775-155589797 CCTCTTTTTAGCAATGACAGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 964329797 3:155589811-155589833 TAAACTGCTTATTAAGTGCTAGG 0: 1
1: 0
2: 3
3: 26
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964329795 Original CRISPR CTGCTGTCATTGCTAAAAAG AGG (reversed) Intronic
903545322 1:24120358-24120380 CTTCTGTCATTGTTCAAAGGTGG - Exonic
903731428 1:25498579-25498601 CTGTTGTCATTTTTAAAAAGGGG + Exonic
904133487 1:28292791-28292813 CAGCTTTCATAGCTAAAAATTGG - Intergenic
906567952 1:46813898-46813920 CTGCTGTCCCTGCTAAGCAGAGG - Exonic
907896924 1:58700628-58700650 CTGCTCTCACTGATAAAATGGGG + Intergenic
908069459 1:60442313-60442335 CTGCTGTCATCCCTAAAATTGGG - Intergenic
908485717 1:64590726-64590748 CTTCTATCATTTCTAAGAAGAGG + Intronic
908854971 1:68416659-68416681 CTGATGTCTTTACTAAAAGGGGG + Intergenic
909653154 1:77998380-77998402 CTACTGTCATTGCCTAAAAAAGG + Intronic
911517300 1:98882207-98882229 CTGCCTTCATTGCTTAAAAGTGG - Intergenic
921505577 1:215964959-215964981 CTTCTTCCCTTGCTAAAAAGTGG - Intronic
921506548 1:215978236-215978258 TTGTTGTCATTGCTGTAAAGAGG + Intronic
923286644 1:232502539-232502561 CTGCCATCTTTGATAAAAAGGGG - Intronic
923360302 1:233204501-233204523 CTGCTGCCATTGCTATATGGAGG - Intronic
1065638019 10:27751288-27751310 CTGGTGTCCTTTTTAAAAAGAGG - Intergenic
1068203510 10:53815575-53815597 ATTCTGTCTTTGCTAAAAAGAGG - Intronic
1071732148 10:88258882-88258904 CTGCTGTGATTGTGAAAATGTGG + Intergenic
1072220018 10:93318961-93318983 GTGCTTTCATTCCAAAAAAGGGG - Intronic
1075976553 10:126701156-126701178 CTTCTGTCATTGCTAAGACAGGG + Intergenic
1076002915 10:126926674-126926696 CTGGTGTCCTTGTTAAGAAGAGG + Intronic
1076003188 10:126928457-126928479 CTGGTGTCCTTGTTAAGAAGAGG + Intronic
1076416527 10:130293941-130293963 CTGCTGTAATTCCAAAAAATTGG + Intergenic
1076935169 10:133563897-133563919 CTGCAGTTATTACTAGAAAGGGG - Intronic
1084649924 11:70483121-70483143 CTGCAGACATTGCTTACAAGGGG + Intronic
1084711647 11:70847452-70847474 CTGCTGTCAGCGTTAAAAATAGG + Intronic
1087261723 11:96019641-96019663 CTGCTGAAATGGCTAAAATGGGG - Intronic
1088153379 11:106775428-106775450 CTTCTATCATTGCTAATAACAGG + Intronic
1088966107 11:114722872-114722894 CTTCTGTCATTTATAAGAAGTGG - Intergenic
1089284816 11:117398717-117398739 CTCCAGCCATTGCTAAAAGGGGG - Intronic
1090548028 11:127787131-127787153 CTGTTTTCTTTTCTAAAAAGTGG + Intergenic
1092764952 12:11844265-11844287 TTGCTATCAATGCTAAAAAAGGG + Intronic
1094168002 12:27462605-27462627 CTTCTGTCATTAATAAAATGGGG - Intergenic
1095462441 12:42456838-42456860 CTTCTGTTATTGCTACAAACTGG + Exonic
1095628389 12:44344811-44344833 ATGCTGTCATTGCTACATAGAGG + Intronic
1099420601 12:82454485-82454507 TTCCTGTTATTGCTAAAAACAGG + Intronic
1102198047 12:111038300-111038322 CTGCTGTCATCTATAGAAAGAGG - Intronic
1103930120 12:124445570-124445592 CTGCTGTCATTGCTTCTAGGTGG - Intronic
1105010208 12:132750648-132750670 AACCTGTCATTGCTAAAGAGTGG + Exonic
1106824753 13:33508346-33508368 TGGCTGTCTTTGCTAACAAGTGG + Intergenic
1107376647 13:39811255-39811277 GTGGTGTCATTGCTGAAATGGGG - Intergenic
1109766560 13:66907716-66907738 CTGTTTTCTTTGCTAAATAGGGG + Intronic
1109883480 13:68512045-68512067 CTCCAGTAATGGCTAAAAAGGGG + Intergenic
1111053005 13:82910044-82910066 ATGCTGTCTTTACTAATAAGAGG + Intergenic
1112452720 13:99526618-99526640 CTGCTGTCATTGATAAAGGCAGG + Intronic
1112659461 13:101490955-101490977 CTGGTCTCATTGTTAATAAGTGG + Intronic
1112712810 13:102149903-102149925 GTGCTGTCATAGCTAAGTAGAGG - Intronic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1113356661 13:109587650-109587672 TTGCTGTCATTGCCAGAAATAGG + Intergenic
1113405045 13:110031262-110031284 CTGGTGTCCTTGCAAAGAAGAGG - Intergenic
1114422676 14:22597982-22598004 CTTCTCTCATAACTAAAAAGTGG - Intergenic
1115465552 14:33710604-33710626 CTGCTGTCAGTGCCGACAAGGGG + Intronic
1116393693 14:44422901-44422923 CTCCAGTCATGGCTAAAAGGGGG - Intergenic
1116582175 14:46655744-46655766 CTATTGTCATGGCTAAAGAGTGG + Intergenic
1117660122 14:57995444-57995466 TCTCTGTCATTGTTAAAAAGAGG - Intergenic
1118496594 14:66313759-66313781 CTGCTGTCCTTACAAAAAGGGGG - Intergenic
1118503826 14:66389300-66389322 GTGATGTCATTCCTAAGAAGGGG + Intergenic
1118553723 14:66988365-66988387 CTGCTGACATAACTAACAAGGGG - Intronic
1120148558 14:81006415-81006437 CTGGTGTCCTTGATAAGAAGAGG - Intronic
1122715412 14:103693945-103693967 CTGGTGTCATGGCAAAAAGGTGG - Intergenic
1124398936 15:29331635-29331657 ATGCTGTCATTGCTGAATATCGG - Intronic
1126864905 15:52925807-52925829 ATGCTCTCATTTGTAAAAAGGGG + Intergenic
1126878583 15:53070634-53070656 CTGCTGTCAGAGCTGAAAATTGG - Intergenic
1128411928 15:67408122-67408144 ATGCTGTTATTGCGAAAAACTGG - Intronic
1128803535 15:70513570-70513592 TTTCTGTCATTGCTAGACAGAGG - Intergenic
1130869480 15:87959068-87959090 CTGCTGTCATGGCTCTAAGGTGG - Intronic
1131034588 15:89213509-89213531 TTGTTGTCATTGCTAAAAATGGG - Intronic
1131044450 15:89302364-89302386 CTGCTGTTTTTGCTGCAAAGAGG + Intronic
1132114913 15:99128627-99128649 CAGCTGCCATTCCTAAAGAGCGG + Intronic
1133343580 16:5055213-5055235 CTGCTGCCCTGGCTAAGAAGGGG - Intronic
1133979728 16:10624195-10624217 CTTCTGTCATTATTTAAAAGAGG - Intergenic
1134487504 16:14670101-14670123 CTGCTATGATTGGTAAGAAGAGG - Intergenic
1134847674 16:17454450-17454472 GTGCTGTCATAGCACAAAAGCGG + Intronic
1135925796 16:26693026-26693048 CTGCTGTCATTGCTTTCCAGTGG - Intergenic
1139070872 16:63381025-63381047 CTGTTGCCATTGGTGAAAAGTGG + Intergenic
1140778497 16:78272713-78272735 CTGCTGTTATAGGTAAAAATGGG - Intronic
1144076098 17:11720923-11720945 CTGAGGTCATTTCTATAAAGGGG - Intronic
1145790429 17:27623303-27623325 CTGCTGTTAATGCTGCAAAGAGG - Exonic
1148879917 17:50717994-50718016 CTGCTTTCCTTCTTAAAAAGAGG + Intergenic
1149867487 17:60158754-60158776 CTGCTTTCATTCCAAAACAGTGG + Intronic
1150836294 17:68567218-68567240 CTGCTGTTATTGCACGAAAGGGG + Intronic
1152086009 17:78219067-78219089 ATGCTTTCCTTGCTAAATAGAGG + Intronic
1153810994 18:8751423-8751445 CTACTGTTACTGCTCAAAAGTGG + Intronic
1156678818 18:39565007-39565029 CTGATCTCATAGGTAAAAAGGGG + Intergenic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1162593239 19:11606870-11606892 CTCCAGCCATTGCTAAAAGGAGG - Intronic
1163915911 19:20240210-20240232 CTGCCCTTGTTGCTAAAAAGTGG + Intergenic
1167028065 19:46936504-46936526 CTGCTCTCTTTTCTAGAAAGAGG + Intronic
928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG + Exonic
929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG + Intergenic
929477568 2:42267456-42267478 CAGCTATCATTGTCAAAAAGAGG - Intronic
932278527 2:70469953-70469975 CTCATGTCATTTATAAAAAGAGG - Intronic
934483870 2:94682493-94682515 CTGCTGTCATGGCCAACAAATGG + Intergenic
934977577 2:98815564-98815586 CTGCTGTCTGTGCTAATACGGGG + Intronic
935133756 2:100280464-100280486 CTGCTGTCTATGCTAAAACATGG + Exonic
935476133 2:103526849-103526871 CTGCTGCCATTGGTAAGTAGGGG + Intergenic
936959867 2:118061709-118061731 CTGCTGTGGTTTTTAAAAAGAGG + Intergenic
937797377 2:126039859-126039881 TGGCTGTCATTGCTAAAGAATGG - Intergenic
938215768 2:129512333-129512355 GTACTGTGATTGCTAAAAATTGG - Intergenic
939624652 2:144461982-144462004 CTGCTTTTATTGGTAAAAATGGG - Intronic
939783413 2:146477708-146477730 ATGCTGACAATGCTAGAAAGAGG - Intergenic
942399347 2:175584931-175584953 TTCCTGTCATTGCCAAAAATGGG - Intergenic
943366723 2:186973608-186973630 TTGTTGTCATTGCCAAAAATGGG - Intergenic
945923558 2:215780405-215780427 TTGCTGTCATTGCTATTAAAGGG - Intergenic
946532770 2:220590250-220590272 CTGCAGTCCTTGCATAAAAGTGG - Intergenic
946672829 2:222124516-222124538 CTTCTTTCATTTCTAAAAACAGG - Intergenic
946807766 2:223488788-223488810 TTACTATCAGTGCTAAAAAGGGG + Intergenic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
947411205 2:229841819-229841841 CTGATTTCATTGCTTTAAAGGGG + Intronic
948280570 2:236744533-236744555 CTTCTTTCTTTGCCAAAAAGCGG + Intergenic
1169126127 20:3128187-3128209 CTGGTGTCCTGGCCAAAAAGAGG - Intronic
1169163058 20:3398947-3398969 CTGCTGTCATAGCTAATACATGG + Intronic
1169668048 20:8061290-8061312 CTGCTGTCACTGCTAAAATTTGG + Intergenic
1169978072 20:11353160-11353182 CTGTTTTCATTGCCAAAAAGTGG + Intergenic
1172763059 20:37335765-37335787 CTTCTCTCATTGGTAAAACGGGG - Intergenic
1173409803 20:42800044-42800066 CTGTTGTTATTGTTAAGAAGAGG - Intronic
1173699302 20:45053810-45053832 CTGCAGTCATTTCTGAGAAGAGG + Intronic
1177852546 21:26365897-26365919 ATGTTATCATTGCTAAGAAGAGG - Intergenic
1178817574 21:35945808-35945830 CTGCTGTCCTTACAAAAAAGGGG + Intronic
1183096764 22:35556803-35556825 CTCTTGCCATTGCTAGAAAGTGG - Intergenic
951132875 3:19069034-19069056 CTCCAGCCATGGCTAAAAAGGGG + Intergenic
951694396 3:25430344-25430366 CTGTTTTAATTGCTACAAAGAGG - Intronic
953495812 3:43386160-43386182 CTACTCTCCTAGCTAAAAAGAGG - Intronic
955592997 3:60557933-60557955 CTGGTTTCATTGCAAAAATGAGG + Intronic
957880199 3:86201955-86201977 CTGCTGTCATTGACAAATAGAGG + Intergenic
958541957 3:95489085-95489107 CTGCAGTGAAAGCTAAAAAGAGG + Intergenic
960212059 3:114981457-114981479 TTGCTGTCACTTCTAAAATGTGG - Intronic
960788123 3:121397242-121397264 CTGCTATAATTCCTAAAAATTGG - Intronic
961167906 3:124776266-124776288 CTGCTGCCAAGGCTCAAAAGTGG - Intronic
961323434 3:126094572-126094594 CTGCTGTAATTCCAAAAAAATGG + Intronic
962032961 3:131620732-131620754 GTGCTGTGATTGCTAGAAGGGGG + Intronic
963669111 3:148229946-148229968 CTGGTGTCCTTATTAAAAAGAGG - Intergenic
963893037 3:150657400-150657422 CTGCTATCGTTGTGAAAAAGAGG - Intergenic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
964828960 3:160861854-160861876 CTGATGCCATTGCTAGAAGGTGG - Intronic
965270725 3:166613999-166614021 CTCCATTCATGGCTAAAAAGGGG - Intergenic
966978534 3:185107805-185107827 CTGCTGTAATTCCAAAAAATTGG + Intronic
967182788 3:186921074-186921096 CTGTTGTAAATGCTAATAAGGGG - Intergenic
967341056 3:188398471-188398493 CAGCTGGCATTGCTCAGAAGAGG - Intronic
970705825 4:18801004-18801026 GTGATGTCTTTGCTAAAATGAGG + Intergenic
972845275 4:42982002-42982024 CTGCTATTATTGCTTTAAAGAGG + Intronic
973655334 4:53041911-53041933 ATGCTGTCACTACTGAAAAGAGG - Intronic
980636247 4:135507926-135507948 CTGCTGTTTTTTTTAAAAAGGGG - Intergenic
984106702 4:175556579-175556601 CTGTAGTAATTGTTAAAAAGGGG + Intergenic
984278161 4:177635069-177635091 CTGCTGCTATTGATATAAAGAGG - Intergenic
990590609 5:57259500-57259522 CTGCTATCATTGCTTACAAAAGG - Intronic
991246529 5:64514167-64514189 CTACTGTCCTTGTAAAAAAGAGG - Intronic
992071289 5:73151513-73151535 CTGCTTTCATTGCCAAGGAGAGG - Intergenic
993279041 5:85901421-85901443 CTGGTGTCATTTTTAAAAATTGG - Intergenic
994204160 5:97014443-97014465 CTGCTGTGATTCCTATAAAATGG + Intronic
994946685 5:106402894-106402916 CTGTTGTCATTGATATAAAAAGG + Intergenic
995592549 5:113714398-113714420 CTGCTGTAATTCCAAAAAATTGG + Intergenic
995967553 5:117927302-117927324 CTGCTTTCATTGCATAAAAAAGG - Intergenic
998883324 5:146667785-146667807 ATGAAGTCATTGGTAAAAAGAGG - Intronic
999572626 5:152937841-152937863 CTCTTGTCCTTGCTGAAAAGAGG - Intergenic
1001831036 5:174789598-174789620 CTGCTGTCATAGCACAAAAGTGG - Intergenic
1002963679 6:1941621-1941643 CTGCTGTCAGTGAGAGAAAGGGG + Intronic
1003682492 6:8269698-8269720 CTGCTGTCATTGCTGGGAAAAGG + Intergenic
1004555789 6:16696512-16696534 ATGCTGACATTGTTAGAAAGGGG - Intronic
1004680244 6:17886869-17886891 TTGTTGTCGTTGTTAAAAAGAGG + Intronic
1005345675 6:24887638-24887660 CTGCTGTCATTGCTTTGAAGAGG - Intronic
1007623345 6:43228330-43228352 CTGCAGTCCTTGCTAATAGGAGG + Intronic
1014288590 6:119531941-119531963 CTGCTGCTGTTGCTAAAGAGAGG - Intergenic
1014390108 6:120851396-120851418 CTGCTGTCTATGATAAAATGTGG + Intergenic
1014466006 6:121757933-121757955 GTGCTATCATTGCTGAATAGAGG - Intergenic
1015553571 6:134437618-134437640 CTTCATTCATAGCTAAAAAGTGG - Intergenic
1016660049 6:146567676-146567698 CTGATGTCCTTACTAAAAGGTGG + Intergenic
1018489136 6:164273656-164273678 CTGCTGTCGTAGCACAAAAGTGG - Intergenic
1020407428 7:7853334-7853356 CTGATTTCATTGTAAAAAAGTGG - Intronic
1021359784 7:19697454-19697476 CTGCTTTCATTGAGAAAATGTGG - Exonic
1021850322 7:24801708-24801730 CTGCTTTCAATGCTGAACAGCGG + Intronic
1022987146 7:35666757-35666779 CTGCTGTAATTGCTAAATATAGG + Intronic
1027553061 7:79623310-79623332 TTGCTGTCAATACTAAAGAGCGG - Intergenic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1028796677 7:94910355-94910377 CTGCAGTCATTGCCAAAACAAGG + Exonic
1028909130 7:96188253-96188275 CAGCTGGCCTTGCTTAAAAGAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030562393 7:111105854-111105876 GAGCTGTCAGTGATAAAAAGTGG - Intronic
1033007514 7:137583351-137583373 ATGCTGTCATTACTAAGAACTGG - Intronic
1033127562 7:138718784-138718806 CTGCTTTCATTGCTAAATTGAGG - Intronic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1035722232 8:1800815-1800837 CTGCTGTAATTTCTGAAAGGTGG - Intergenic
1043943866 8:86228215-86228237 GTGCTGTCATTGCAGACAAGGGG + Intronic
1045074282 8:98545396-98545418 ATGCCATCATTGCTAAAAACAGG + Intronic
1047175062 8:122532674-122532696 ATGCTGTCACTGGAAAAAAGAGG + Intergenic
1048828556 8:138453689-138453711 CTTCTACCATTTCTAAAAAGGGG - Intronic
1049026317 8:139991813-139991835 CTGCTCTCTTTGCTGAAAAAGGG - Intronic
1049581467 8:143413053-143413075 CTGGTGTCATTGCTAAGAGAAGG - Intergenic
1049873978 8:145003334-145003356 CTGCTGCCATCGCTTAAATGAGG + Intergenic
1052495359 9:29217000-29217022 ATGTTGTTAATGCTAAAAAGAGG + Intergenic
1053311819 9:37025361-37025383 CTGCTGCCTTTGTTAAATAGGGG + Intronic
1053673914 9:40401893-40401915 CTGCTGTCATGGCCAACAAATGG - Intergenic
1053923717 9:43028261-43028283 CTGCTGTCATGGCCAACAAATGG - Intergenic
1054385017 9:64541959-64541981 CTGCTGTCATGGCCAACAAATGG - Intergenic
1054510712 9:65974397-65974419 CTGCTGTCATGGCCAACAAATGG + Intergenic
1056819629 9:89829586-89829608 CTGCTGTCACTGCTAAAGTCTGG - Intergenic
1057861573 9:98644919-98644941 CTCCTGTCCCTGCTACAAAGAGG + Intronic
1059980089 9:119762076-119762098 CAGCTGACATTGATAACAAGGGG - Intergenic
1187811252 X:23179832-23179854 CTGCTGTCATTAAAAACAAGTGG + Intergenic
1188072432 X:25733339-25733361 TTGATGTCATTACAAAAAAGTGG - Intergenic
1189644320 X:43110252-43110274 CTGCTTTCATTCCTAAGAAGGGG + Intergenic
1191879594 X:65831607-65831629 CTGCTGGCACTGAAAAAAAGAGG + Intergenic
1194286546 X:92018115-92018137 CTGCTGTCATAGCTGATGAGAGG + Intronic
1195509207 X:105694824-105694846 TTGATGTGATTACTAAAAAGTGG - Intronic
1196022188 X:111002122-111002144 TAGCTGTCCTTTCTAAAAAGAGG - Intronic
1198022740 X:132675237-132675259 GTGCGGTCATTGCTCCAAAGTGG + Intronic
1200604091 Y:5242672-5242694 CTGCTGTCATAGCTGATGAGAGG + Intronic