ID: 964330086

View in Genome Browser
Species Human (GRCh38)
Location 3:155592582-155592604
Sequence CTCTCTGACCAAAGGGCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964330083_964330086 -5 Left 964330083 3:155592564-155592586 CCTAAAGCTGCAGCAGTTCTCTC 0: 1
1: 0
2: 1
3: 23
4: 197
Right 964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG 0: 1
1: 0
2: 2
3: 8
4: 160
964330082_964330086 26 Left 964330082 3:155592533-155592555 CCTCTGTTTAGGGCTGTGTTTAG 0: 1
1: 0
2: 1
3: 7
4: 152
Right 964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG 0: 1
1: 0
2: 2
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964330086 Original CRISPR CTCTCTGACCAAAGGGCAGT CGG Intronic
900462917 1:2809978-2810000 CACTGTGACCAAGGAGCAGTGGG - Intergenic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
910362143 1:86423685-86423707 CTATCTGACCCAAGGGCTGTAGG + Intergenic
911038364 1:93572873-93572895 CTCCCTGAGCAAAGGGCAGCAGG + Intronic
911370539 1:96989592-96989614 GTTTCTGACCAAAGGGAAGGAGG - Intergenic
915838782 1:159199161-159199183 CTATCTGATCTTAGGGCAGTGGG + Intronic
917251290 1:173064111-173064133 CTCTCTCATCATAGTGCAGTGGG + Intergenic
919306577 1:195848058-195848080 CTCACTGAACAAAGAGCAGGAGG + Intergenic
922210963 1:223486525-223486547 CTCTCAGAACAAAGGGGAGCAGG + Intergenic
922538945 1:226404513-226404535 CACCCAGACCAAAGGGCAGCAGG - Intronic
922975364 1:229779407-229779429 CTCACTGACCAAACGGCAGTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065627398 10:27645743-27645765 CTCTCTGCCCTAATGGCACTGGG - Intergenic
1067655809 10:48190356-48190378 TCCTTTGACCAAAGGGAAGTAGG + Intronic
1069550497 10:69360662-69360684 CTCCCTGCCCAAGGGGCTGTGGG + Intronic
1074167549 10:110897352-110897374 CTCTCTGACCCCAGGCCAATAGG - Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1075351146 10:121726124-121726146 CTCTGTCACCAAAGAGCTGTGGG - Intergenic
1075795603 10:125117309-125117331 ATCCCTGAGCAAACGGCAGTGGG + Intronic
1077881600 11:6354840-6354862 CTCTCTGGACAAAGGGCACAGGG - Intergenic
1078378000 11:10812355-10812377 ATCTCTGAGCAAAAGGCTGTTGG - Intronic
1079366742 11:19816378-19816400 CTCTCTGCCCAACGGGCTGGAGG + Intronic
1080446925 11:32345984-32346006 CTCTCTGCCCACAGGGAAGGTGG - Intergenic
1083997395 11:66279041-66279063 CTCCCTGACCAAGCAGCAGTTGG + Intronic
1084863066 11:72034739-72034761 CTCTCTGACCCAGGGCAAGTTGG - Intronic
1085310412 11:75513399-75513421 CTCTCTGACCTCAGGCAAGTTGG - Intronic
1089882622 11:121789423-121789445 CTCTCAGACCTCAGGGCTGTTGG - Intergenic
1090302404 11:125654986-125655008 CTCTCTGAGCTCAGTGCAGTAGG + Intronic
1095967752 12:47880263-47880285 CTCTGTCACCCAAGGGCAGGAGG - Intronic
1096594538 12:52686246-52686268 CTCTCAGAGCAAAGAGCAGCTGG + Intergenic
1096993122 12:55821118-55821140 CCCCCTCACCCAAGGGCAGTGGG + Exonic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099642013 12:85301945-85301967 CTCTCTCTCCAAAAAGCAGTGGG + Intergenic
1100596104 12:96073485-96073507 CTCACTGGCCAAGGGGCAATGGG + Intergenic
1101192706 12:102351685-102351707 CTCTAAGACCCAAGGGCAGGAGG - Intergenic
1101324720 12:103705520-103705542 CTCTCTGACTAAAGTGTTGTGGG - Intronic
1101757697 12:107634007-107634029 CTTTATAACCAAAGGGCATTCGG - Intronic
1101900738 12:108789490-108789512 CTCACTGACCAAAAGGCAGGAGG - Intronic
1103933786 12:124464671-124464693 CTGTCTGTCCTAAGGGCACTAGG + Intronic
1103993551 12:124814890-124814912 CTCTCTGCACAAGGGGCAGGCGG + Intronic
1107392637 13:39982996-39983018 CCCTCTGAACAATAGGCAGTTGG + Intergenic
1108430111 13:50344883-50344905 CTCTCTAACCACATGGCAGGAGG - Intronic
1108591570 13:51917235-51917257 CTCTCTCAACAAATGGCAGCAGG + Intergenic
1109477298 13:62897921-62897943 CTGACTGACCAAAGGTCTGTTGG - Intergenic
1109887005 13:68556133-68556155 CTCTCTGACCAAGCGGCTGGTGG - Intergenic
1113614758 13:111672157-111672179 CCCTATTACCCAAGGGCAGTTGG + Intronic
1113620227 13:111757071-111757093 CCCTATTACCCAAGGGCAGTTGG + Intergenic
1113975478 13:114224955-114224977 CTCTCTGAGCAAAGTCCAGAAGG - Intergenic
1114396156 14:22363936-22363958 CCATCTGACCAAAAGACAGTTGG - Intergenic
1119022100 14:71124670-71124692 CTCACGGAGCAAAGAGCAGTAGG - Intergenic
1120169171 14:81232031-81232053 CTCTTTGTCCAAAGGGCTCTGGG - Intergenic
1121362339 14:93273095-93273117 CTCACTGACCAAATGGCAAAAGG + Intronic
1121758529 14:96423584-96423606 TTGTCTGTCCAAAGGGGAGTGGG + Intronic
1122346450 14:101064005-101064027 CTCTATGACCAAATGACATTCGG - Intergenic
1122773881 14:104108728-104108750 CACTCCTACCCAAGGGCAGTCGG + Intronic
1124215982 15:27807312-27807334 CTCTCAGACCACAGGGCAGCTGG + Intronic
1128289065 15:66462978-66463000 TTCTCTGTCCAGAGGGCAGGAGG + Intronic
1129259188 15:74354593-74354615 CTCACTGAGCAAAGAGCAGGAGG - Intronic
1132224037 15:100126850-100126872 CTCTCAGCTCAAAGGCCAGTGGG + Intronic
1136038437 16:27559087-27559109 CTCTCTTTCCAAATGGGAGTAGG + Intronic
1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136784524 16:32926714-32926736 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136885259 16:33927092-33927114 GTCTCTGCCAAGAGGGCAGTGGG - Intergenic
1138078882 16:54069756-54069778 ATCTCTGCCCCAAGGGAAGTGGG + Intronic
1139039724 16:62985026-62985048 CTCACGGAGCAAAGGGCAGGAGG + Intergenic
1141348973 16:83275325-83275347 CTTTCTGTCCAAATGGCTGTTGG + Intronic
1203087183 16_KI270728v1_random:1190720-1190742 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1143248440 17:5504691-5504713 CTCTCTGACCCAAGGGTAAGAGG + Intronic
1143365694 17:6406968-6406990 CTCTCTGACCTGAGGCCAGGAGG - Intronic
1143367033 17:6415143-6415165 CTCCCTGGCCAGAGGGCACTAGG + Intronic
1143586844 17:7854697-7854719 CTCTCTGCCCCAGGGGCAGAGGG + Exonic
1144107174 17:11997030-11997052 CTCTCTCATCAGAGTGCAGTCGG - Exonic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1146687740 17:34852814-34852836 AGCTCTGACCAATGGGCTGTGGG + Intergenic
1147144822 17:38478865-38478887 GTCTCTGCCAAGAGGGCAGTGGG + Intronic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1148737915 17:49875216-49875238 CTCTCTGTCCAAAGTGCCTTAGG - Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1151191757 17:72403817-72403839 CTCTCGGACCTTAGGGCTGTTGG - Intergenic
1151714531 17:75824756-75824778 TTCTCTGCCAAAAGGCCAGTGGG - Exonic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1156976777 18:43231721-43231743 CTCTCTGGCCAAAGGTTAGAAGG - Intergenic
1157440882 18:47710811-47710833 CTCACTAACCAAAGGGAAGAGGG + Intergenic
1159219384 18:65439994-65440016 CACTTTGACCAATGGGCTGTGGG - Intergenic
1159260701 18:66008392-66008414 CTCTTTTATCAAAGAGCAGTTGG - Intergenic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1163479583 19:17546974-17546996 CTCTCTGAAGGAAGGGCCGTTGG + Intronic
1163977274 19:20864148-20864170 CTCTCTGGGCAAAGGGCAAGGGG - Intergenic
928093085 2:28388237-28388259 TTCTCTGGCCAAATGGCAGGGGG - Intergenic
929216535 2:39420070-39420092 CTCTCTGACCCTAGGCCAGGGGG - Intronic
930186900 2:48420019-48420041 CTCGGTGAGCACAGGGCAGTGGG + Intergenic
931224313 2:60316433-60316455 ATGTCTGCCCAAAGGACAGTTGG - Intergenic
934614916 2:95764804-95764826 CTCTGTTACCAATGGGCTGTGGG + Intergenic
934645987 2:96059683-96059705 CTCTGTTACCAATGGGCTGTGGG - Intergenic
934839390 2:97615773-97615795 CTCTGTTACCAATGGGCTGTGGG - Intergenic
936607988 2:113976685-113976707 CTCCCTAACCAAAAGGAAGTTGG - Intergenic
941039186 2:160601046-160601068 ATCTCTGCCCTAAGAGCAGTAGG - Intergenic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
946462167 2:219878412-219878434 ACCTCTGACAAAAGGTCAGTTGG - Intergenic
947991341 2:234489850-234489872 CTTCCTGATCAAAGGGCAGCAGG + Intergenic
1178479870 21:32970716-32970738 CACCCTGACCAAACGGGAGTGGG + Intergenic
1182097943 22:27638536-27638558 GACTCTGCCCAAGGGGCAGTCGG + Intergenic
1182294153 22:29303365-29303387 CCCTCTGGCCAAAGGCCAGAAGG + Intergenic
1184208802 22:43023278-43023300 CTCCCTGCCCCAAGGGGAGTTGG + Intergenic
1185113849 22:48920103-48920125 CTCTCTGGCCACGGGGCACTGGG + Intergenic
949558387 3:5179379-5179401 CTCTATCACCAGATGGCAGTTGG + Exonic
949898074 3:8785116-8785138 CTCTCTGGCCTAAAGGCAGCTGG + Intronic
950221696 3:11201218-11201240 CTCTCTGGCCGTAGGGCAATTGG - Intronic
951516496 3:23565634-23565656 CCCTCTGGCTAAAGGGAAGTTGG + Intronic
955859291 3:63310592-63310614 CTCTCAGATCCAAGGCCAGTGGG + Intronic
957060176 3:75475257-75475279 CTCTCAGAGCAAAGAGCAGGAGG + Intergenic
960298096 3:115968385-115968407 CTTTCTGACTAAAGAGCACTTGG - Intronic
961124389 3:124403173-124403195 CACTCTGACCACATGGCAGATGG - Intronic
962334735 3:134517010-134517032 CTCTCTGAGGAATGGGAAGTTGG - Intronic
963072580 3:141316838-141316860 CCCTCTCACCAAAGGGCCTTTGG + Intergenic
964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG + Intronic
964435968 3:156654101-156654123 CTCGCTGACCAACGGGTTGTTGG + Intergenic
964734991 3:159907895-159907917 CTCCCTTCCCAAAGGGCAGTGGG - Intergenic
967607999 3:191471025-191471047 CTCTCTGCCCATAGAGCATTGGG + Intergenic
967853332 3:194098302-194098324 CTCACTGACCACAGGGCAGTGGG + Intergenic
968517608 4:1021441-1021463 CTCTCTGACCCCAGGGCCTTGGG + Intronic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
974443432 4:61948578-61948600 CTCCAGGACCAAAGGCCAGTGGG + Intronic
979111417 4:116762113-116762135 CTCTCTCCCTTAAGGGCAGTAGG - Intergenic
979483212 4:121241621-121241643 CTCACTGACTGAAGGGCATTTGG + Intergenic
980305908 4:131061301-131061323 CTCACTGAACTATGGGCAGTGGG - Intergenic
980834240 4:138171376-138171398 CACTTTGAACAAAGGTCAGTGGG - Exonic
985063981 4:186104460-186104482 CTCTCTGACGATAGGGAAGGTGG - Intronic
989678498 5:44002241-44002263 CTCTCTGGTGAAAGGACAGTAGG - Intergenic
990176694 5:53115820-53115842 ATATCTCACCAAAGGGAAGTTGG + Intergenic
995250689 5:109989925-109989947 GTCTCTGAGCCAAGTGCAGTGGG - Intergenic
996572903 5:124951732-124951754 CTCTCTGATCACATGGCAGGAGG - Intergenic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1002983560 6:2165594-2165616 ATGTCTGACCAAATGTCAGTTGG + Intronic
1004198090 6:13523870-13523892 CTCTCAGAACAGAAGGCAGTTGG - Intergenic
1006643340 6:35499633-35499655 CTCTTTGAACAAAGAGGAGTTGG + Intronic
1008745487 6:54664927-54664949 CTCTCTTACCAAATGGCCTTTGG - Intergenic
1010688515 6:78879636-78879658 CTCTCATACCAAAATGCAGTGGG - Intronic
1011388987 6:86830136-86830158 CTTTCTGACCTTAGGGCATTTGG + Intergenic
1011520646 6:88201029-88201051 CTCTCTGAAAATAGGGCAGCTGG + Intergenic
1017561708 6:155635377-155635399 CTTTCTGAACAAAGGCCCGTGGG - Intergenic
1017727422 6:157285224-157285246 CTAGCTGAGCAAAGGGCATTGGG + Intergenic
1018639365 6:165892345-165892367 CTCTCTGACCAAAGTGGACATGG + Intronic
1019413823 7:918534-918556 CTCTCTTACACAAGGGCAGTGGG + Intronic
1022820251 7:33952712-33952734 TTCTCTGATCAAAGTCCAGTGGG - Intronic
1023849428 7:44141798-44141820 CCCTCTGACCAAGGGGCAGAAGG + Intergenic
1024192630 7:47028377-47028399 CTCTCTGAAAGAAGGGCATTAGG + Intergenic
1032263116 7:130352189-130352211 CCCTCTGATCACAGGGCAGAGGG - Intronic
1032329292 7:130962758-130962780 CTTTCTGTTCATAGGGCAGTTGG - Intergenic
1034085095 7:148315128-148315150 CTCACAGACCAAAGAGCAGGAGG + Intronic
1034865390 7:154637258-154637280 CTTACTGAAAAAAGGGCAGTTGG - Intronic
1035293301 7:157853709-157853731 CCCTCAGACCTACGGGCAGTGGG - Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1036510886 8:9399118-9399140 CTATCTGACCAAGGGCCCGTTGG + Intergenic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG + Intergenic
1043162072 8:76858140-76858162 ATGACTGACCAAAGAGCAGTTGG - Intronic
1045149511 8:99388250-99388272 CTCTGGGAGGAAAGGGCAGTAGG + Intronic
1047677947 8:127223486-127223508 CTCTCGGACCATATGGCTGTGGG - Intergenic
1047804021 8:128340102-128340124 CTCTCTGATCTGAGGGGAGTTGG - Intergenic
1051353154 9:16217295-16217317 TTCTCTGATCAAAGGAAAGTGGG + Intronic
1051666230 9:19469343-19469365 CTCTGTGACCAATGGGCATGTGG - Intergenic
1052072711 9:24102216-24102238 CTCGCAGACCAAGGGGGAGTGGG + Intergenic
1054456000 9:65430728-65430750 CTCCCTGACCACTGGGCTGTGGG + Intergenic
1055360817 9:75488567-75488589 CTCTCTGACCAGAGGCCAAAGGG - Intergenic
1056502801 9:87226331-87226353 TTCTCTGACCAAAGGGAACACGG - Intergenic
1059075799 9:111192778-111192800 CTCTGTGACCAATTGTCAGTTGG + Intergenic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1188301293 X:28507385-28507407 CTCACAGAGCAAAGGGCAGGAGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic