ID: 964331135

View in Genome Browser
Species Human (GRCh38)
Location 3:155604588-155604610
Sequence GGTTTAATACAAATAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964331135 Original CRISPR GGTTTAATACAAATAGAAAA AGG (reversed) Intronic
900888376 1:5431343-5431365 GTTTTAATACAAATATGAAAGGG + Intergenic
903672447 1:25044863-25044885 GGTATAAGACAAATAAAGAAGGG + Intergenic
904218865 1:28947955-28947977 GGTTTGCTACAAATTGAAATGGG + Intronic
904853387 1:33476373-33476395 GGTTTGTTTCAAATAGAAATCGG - Intronic
905025650 1:34847601-34847623 GGTTTCATATAAATACAAGAAGG + Intronic
907208004 1:52791751-52791773 TGTTTATTTCAAATAAAAAATGG - Intronic
908228702 1:62082537-62082559 GGTATAAAACAAAAAGAAACAGG - Intronic
908348360 1:63259399-63259421 TTTTTATTACAAATAGAAGAAGG - Intergenic
908704190 1:66932560-66932582 GGTTTTAAACAATTAGACAAAGG + Intronic
908920026 1:69179193-69179215 GGTTAAATAGAAAAAGGAAATGG - Intergenic
909367414 1:74844077-74844099 GTTTTAATACAAATATCAGATGG - Intergenic
909752645 1:79182358-79182380 GGTTTAATTCAACTAGAAATAGG - Intergenic
909762276 1:79305338-79305360 ATTTTAATACAATTAGTAAATGG - Intergenic
909798306 1:79772395-79772417 TATTTAATACAAATAGGATAGGG + Intergenic
909848614 1:80431995-80432017 GATTTAATACTAATTGCAAAAGG + Intergenic
910128695 1:83876173-83876195 GATTTATGACAAATAGGAAAAGG - Intronic
910176257 1:84434044-84434066 AGTTTAAAACAAAATGAAAAGGG + Intergenic
910223435 1:84912981-84913003 GGTATAATACAAATATTATAAGG - Intergenic
911685316 1:100769177-100769199 ATTTTAATACAAGTAGAAAATGG + Intergenic
911709279 1:101051034-101051056 GACTGATTACAAATAGAAAAAGG + Intergenic
911787292 1:101967049-101967071 AGTTTAATATAAATAGCAACTGG - Intronic
912043713 1:105426082-105426104 AATTTTGTACAAATAGAAAATGG - Intergenic
912273565 1:108233650-108233672 GGTTCAATACAAAGAGACATTGG + Intronic
912294655 1:108460672-108460694 GGTTCAATACAAAGAGACATTGG - Intronic
912968694 1:114260045-114260067 GGTTTAATTTAAAAAAAAAAAGG - Intergenic
913113408 1:115675924-115675946 GGTTCAGTATAAATAGAAATGGG + Intronic
914406790 1:147382868-147382890 GAATTAATACCAATGGAAAAAGG - Intergenic
915704340 1:157829547-157829569 GGAGTAATAGAAATAGAAATAGG + Intergenic
915845312 1:159257678-159257700 GGTTTATTACCTTTAGAAAAGGG - Intergenic
916233099 1:162560212-162560234 GGTTTAATACAACCACCAAATGG + Intergenic
918338215 1:183543174-183543196 GGTTTCATGTAAACAGAAAAGGG + Intronic
918505544 1:185249922-185249944 GAAGTAATACAAAAAGAAAAAGG - Intronic
918616656 1:186551623-186551645 GGTTCAAAACAAAAAAAAAAAGG - Intergenic
918988656 1:191667329-191667351 GGTGTGATACAAATATAAACAGG - Intergenic
919140826 1:193569441-193569463 AGTTTTATACAAATATAAAAAGG + Intergenic
919202868 1:194380235-194380257 GACTTAAGACCAATAGAAAAAGG + Intergenic
919435735 1:197557752-197557774 TATTGAATAAAAATAGAAAAAGG - Intronic
921922867 1:220688201-220688223 GGTTTTGTACAAAAAAAAAAGGG + Intergenic
923042530 1:230329685-230329707 GATTTAAAATAAATAGGAAAAGG + Intronic
923321775 1:232841584-232841606 GGACTAATACAAAATGAAAATGG - Intergenic
923994006 1:239471237-239471259 TTTTTGATACAAAAAGAAAAAGG - Intronic
924114271 1:240729905-240729927 AGTTTAATACCAATAGGAAGCGG - Intergenic
924354373 1:243154764-243154786 GTTGTAATACAAAGAGAAGAGGG - Intronic
924417987 1:243879054-243879076 GCTTTAAGAGAAATAGAAAATGG - Intergenic
924957031 1:248939516-248939538 GTTATAATACAAATATAAAATGG - Intergenic
1064529713 10:16295536-16295558 TGTTTCACAAAAATAGAAAATGG - Intergenic
1064666812 10:17661599-17661621 GGTTTAAAACAAAAAGAGACAGG - Intronic
1065416593 10:25494967-25494989 GGTTTCATATAAATGGAATATGG - Intronic
1066175608 10:32901793-32901815 GTTTATATAAAAATAGAAAATGG + Intronic
1066436547 10:35401208-35401230 GGTTTAATAAGAATAGAATAGGG + Intronic
1068170019 10:53381244-53381266 GCATTAACACAAAAAGAAAAAGG + Intergenic
1068399635 10:56510940-56510962 TGTTTAGAACAAATAGAATAGGG - Intergenic
1069164979 10:65143604-65143626 GTTCTAATACAAATAGACAAAGG - Intergenic
1069690205 10:70346802-70346824 GGTTTTATATAAATATAGAATGG - Intronic
1069760055 10:70803628-70803650 GGTTTAAGTCACATAGAGAATGG - Intergenic
1070539867 10:77408242-77408264 GGTTTGTTCCAAATAGCAAAGGG + Intronic
1070578130 10:77696001-77696023 GGCTTAATTGAAATAGAAAATGG + Intergenic
1071858436 10:89648688-89648710 GTTTTAATACAAATTTAAAAAGG - Intergenic
1074222136 10:111448432-111448454 GGTTGAAGACAAGGAGAAAATGG - Intergenic
1075814045 10:125250696-125250718 AGTATAATACAAAAAAAAAAAGG - Intergenic
1076082159 10:127591945-127591967 AGTCTACTACAAAAAGAAAAAGG + Intergenic
1076374087 10:129972167-129972189 GTTTTAATAAAAATAAATAAAGG - Intergenic
1076858894 10:133130393-133130415 GGTTTATTCCAAAAAGAAAAGGG + Exonic
1076962937 10:133781359-133781381 GTTATAATACAAATATAAAATGG - Intergenic
1077739822 11:4833131-4833153 TGTTTCATCCAAATAGGAAATGG + Intronic
1078097680 11:8310653-8310675 GATTTAATAAAAGGAGAAAATGG + Intergenic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1078847756 11:15136008-15136030 GAATTAATACCATTAGAAAAAGG - Intronic
1079503340 11:21127217-21127239 AGTTTAATACAATTATAAAAAGG + Intronic
1079883882 11:25961492-25961514 GGTTTAAGACTAATAGAGATGGG + Intergenic
1079993126 11:27267271-27267293 GTATTAATACATTTAGAAAATGG + Intergenic
1080782405 11:35442108-35442130 GGTACAATACAAATAGGAAATGG - Intronic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1081668868 11:44932375-44932397 TGTTTCTTACAAAAAGAAAAAGG + Exonic
1082890664 11:58135248-58135270 GTTTTTATTCAACTAGAAAATGG + Intronic
1082897473 11:58207156-58207178 GGTGTAATAGAGATGGAAAAAGG + Intergenic
1083057047 11:59832484-59832506 AGTTTAAAAAAAAGAGAAAATGG + Intronic
1086139443 11:83478914-83478936 GGTTTAAAATAAAATGAAAAAGG + Intronic
1086892654 11:92276183-92276205 ATATTAATACAAATAAAAAAGGG - Intergenic
1087392271 11:97552172-97552194 ACTTTAAAACAAATAGAAAATGG - Intergenic
1087601248 11:100318810-100318832 GTTTAAACACAAAAAGAAAAAGG + Intronic
1087651220 11:100870943-100870965 GGTTTAAAAAAAAAAAAAAAAGG + Intronic
1088048515 11:105481744-105481766 AGTTAAATACATTTAGAAAATGG - Intergenic
1088079127 11:105888587-105888609 AGTGTCATAAAAATAGAAAAAGG - Intronic
1089660020 11:119979660-119979682 GGTTTAATACGAATGGAACTGGG + Intergenic
1092588115 12:9920900-9920922 GGTAGAATGCAAATTGAAAAGGG + Intronic
1093128769 12:15363846-15363868 GTTTTAGTACAACTAGTAAAAGG - Intronic
1093132236 12:15405513-15405535 TGGTTAATACAAATGGGAAAAGG + Intronic
1095186540 12:39207554-39207576 GGTAAGATACAAAGAGAAAATGG + Intergenic
1096314141 12:50549166-50549188 GGTTTAAAAAAAAAAAAAAAGGG + Intronic
1096826993 12:54287213-54287235 GGTTTAATGAAAATAGAAATGGG + Intergenic
1097466430 12:59930331-59930353 AGTTTCATACAAGTAGAAAGAGG + Intergenic
1097626050 12:62001913-62001935 GTTTTAATACAAATAAAACTTGG + Intronic
1097887193 12:64741034-64741056 GGTCTACTACAATTAGAAAATGG + Intronic
1098220916 12:68268903-68268925 TCTGTAATAAAAATAGAAAAAGG - Intergenic
1098821327 12:75233860-75233882 GGTGTAATATAAAAAGCAAATGG + Intergenic
1098903125 12:76133131-76133153 GGTGTAAAAGAAAAAGAAAAAGG - Intergenic
1099130266 12:78820155-78820177 ATTTTAGTACAAATTGAAAAAGG - Intergenic
1099137508 12:78925789-78925811 GGTTTCATACATTGAGAAAAAGG - Intronic
1099386961 12:82025984-82026006 AGTTAAAGACAAATAGGAAATGG + Intergenic
1099535429 12:83837807-83837829 GATTTAGTAAAAATAGAAAAAGG + Intergenic
1100620560 12:96268258-96268280 GCTGTAATACAAATAGAGAGTGG + Exonic
1102563605 12:113780024-113780046 GCTTTAATACAAAAAGTAAAGGG - Intergenic
1102729485 12:115095648-115095670 GGTTTAAGAAAAATAGTGAAGGG + Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1106016366 13:25872899-25872921 GATTTAGTACAAAAAAAAAAAGG - Intronic
1106602792 13:31201253-31201275 GCTTAAATACAAATAAAAACAGG - Intronic
1107195021 13:37641176-37641198 ATTTTAATACAAATATAAAAAGG + Intronic
1107495415 13:40921580-40921602 GGTATAAAATAAATAGCAAAGGG + Intergenic
1107616761 13:42176935-42176957 AGTTTGAGTCAAATAGAAAAGGG + Intronic
1107663906 13:42669167-42669189 TGTTTAAGACAAAAATAAAAAGG + Intergenic
1107743951 13:43485574-43485596 GGATTATTACACAAAGAAAAAGG + Intronic
1108056852 13:46493837-46493859 GTGTTAATACAAAGATAAAAAGG + Intergenic
1108277760 13:48828287-48828309 GAATTAAGACAAATAGGAAAAGG + Intergenic
1109547426 13:63846760-63846782 GGATTAATACAACTATAAGATGG - Intergenic
1110560560 13:76907249-76907271 AGTCAAATACAAATAGAGAAAGG + Intergenic
1110596147 13:77322686-77322708 AATTTAACACAAGTAGAAAAAGG + Intronic
1110702902 13:78570428-78570450 GGATTATTATAAATGGAAAATGG + Intergenic
1110777073 13:79420072-79420094 GATTTATTACAAATAGAAGTTGG + Intergenic
1111649562 13:91072328-91072350 CATTTAAAGCAAATAGAAAATGG - Intergenic
1112725344 13:102297588-102297610 GGTTTATTACAAATAAAAAAGGG + Intronic
1112739985 13:102462030-102462052 GGTCAAATAAAAATAAAAAAAGG - Intergenic
1112786144 13:102953750-102953772 GGTTGAATACAAATGGGCAAAGG + Intergenic
1112849153 13:103682932-103682954 GGTTTAACAAAAATAAATAAGGG + Intergenic
1115124890 14:29980439-29980461 GGTTTTTTACAAATAGAAATTGG - Intronic
1115528756 14:34306444-34306466 CGTTTCAAAAAAATAGAAAAAGG - Intronic
1115702005 14:35962905-35962927 GGTTCAATAATAACAGAAAAAGG - Intergenic
1115793446 14:36905875-36905897 AGTTATATACAAATGGAAAAAGG + Intronic
1118160262 14:63281612-63281634 GGTTTAAAAGGAATAGACAATGG - Intronic
1118505808 14:66410410-66410432 GGTATAATAAAAATATCAAAAGG - Intergenic
1118510555 14:66467275-66467297 GTTTTAGTAAAAATATAAAACGG - Intergenic
1119216176 14:72870901-72870923 GGACTAATACAAATAGAGACAGG - Intronic
1119277310 14:73370192-73370214 GGATTAACACCAATATAAAAGGG + Intronic
1120395675 14:83964267-83964289 CTTTGAATACAATTAGAAAAAGG + Intergenic
1123192463 14:106584519-106584541 TGTTTAATATAATTAGAAAATGG - Intergenic
1125129441 15:36264968-36264990 AGTTAAAAACAAATAGAGAATGG - Intergenic
1126097394 15:45099312-45099334 GGTATAATAGAAAAAGAAATAGG - Intronic
1126308200 15:47285360-47285382 GGTTGAAAAGAAAAAGAAAATGG + Intronic
1126436307 15:48642081-48642103 GGTTCTATACAACAAGAAAATGG + Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127687042 15:61356688-61356710 GATTTAGTACAAATGAAAAACGG + Intergenic
1128169285 15:65496467-65496489 GGTTTCATACAAATGAAAGATGG - Intronic
1128667495 15:69549093-69549115 GGTTTGAAAGAAATAGAAAGAGG + Intergenic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1130239309 15:82170989-82171011 GTTTTAAGACAAAAAGAAAGGGG + Intronic
1130789763 15:87141512-87141534 GGTTAAAAAAAAATAGAAAAAGG - Intergenic
1135882553 16:26272653-26272675 GGTTTAACACAGAAAGAAGAAGG - Intergenic
1136118329 16:28110506-28110528 GGCTTAATACAAGAAGAAAAAGG - Intronic
1136528216 16:30847011-30847033 GAGTTATTACAAAGAGAAAATGG + Intronic
1137233111 16:46587151-46587173 TGTTTAAGACAATTATAAAAAGG + Intronic
1137375381 16:47947639-47947661 GCTTCAAAACAAATAGGAAACGG - Intergenic
1137532907 16:49294245-49294267 GGTTTAATATACCTTGAAAATGG + Intergenic
1139049836 16:63111256-63111278 TGTTTAAAAAAAATAGGAAATGG - Intergenic
1139286434 16:65818942-65818964 GGTTAAAAAGAAATGGAAAAAGG - Intergenic
1139344516 16:66293888-66293910 AGTTTAAAAGAAAAAGAAAAAGG + Intergenic
1140025336 16:71284622-71284644 GTTGTAGTACAAATACAAAATGG - Exonic
1140081949 16:71756561-71756583 GGTGTAATAAAAGTAGAATATGG - Intronic
1140647643 16:77050343-77050365 TGATTTATACAAATATAAAATGG - Intergenic
1140815767 16:78619378-78619400 AGTGTAATGCAAGTAGAAAAGGG + Intronic
1143837477 17:9703583-9703605 TGTTTAATACTAAAAGCAAAGGG + Intronic
1149573097 17:57689321-57689343 GAGTTAATAGAAAAAGAAAAGGG + Intergenic
1150713828 17:67554601-67554623 GGTTCAATCCAAATAGCCAAAGG + Intronic
1151753755 17:76058559-76058581 AATTTAAAACAAATAGAAATTGG - Intronic
1152952080 17:83243588-83243610 GTTATAATACAAATATAAAATGG - Intergenic
1153856457 18:9152912-9152934 TATTTCATACAAAAAGAAAAAGG - Intronic
1154279084 18:12985208-12985230 GACATAATACAAATGGAAAAGGG - Intronic
1154513248 18:15133693-15133715 GCTTTAATTCAAGAAGAAAATGG + Intergenic
1155653454 18:28169119-28169141 GGTTTAATACTAACAGACATTGG + Intronic
1155654720 18:28178652-28178674 GTAGTAATAGAAATAGAAAACGG - Intergenic
1155810693 18:30230259-30230281 CGCTCAATACAAATATAAAAAGG - Intergenic
1156295583 18:35786782-35786804 GGTTTTAAAGAAATAGAAGAGGG + Intergenic
1156430263 18:37065209-37065231 GTTTGAATAGAAATAGAAAATGG + Intronic
1156688977 18:39683617-39683639 AGTTTAAGAAAAATAAAAAATGG + Intergenic
1156689374 18:39687662-39687684 GAATTAATACAAACAGTAAAAGG + Intergenic
1156840983 18:41609079-41609101 GGTCTAGAAAAAATAGAAAAGGG - Intergenic
1158021481 18:52847196-52847218 AGATTAATACAAGAAGAAAATGG - Intronic
1158526896 18:58223035-58223057 GGTTTAAAAAAAAAAAAAAAAGG - Intronic
1159213145 18:65355849-65355871 GATTTAATACAATTTTAAAATGG - Intergenic
1159504909 18:69323539-69323561 GGTTTACAACTAATATAAAAAGG - Intergenic
1159732968 18:72054669-72054691 GAGTGAATATAAATAGAAAAGGG - Intergenic
1160441598 18:78897296-78897318 TGTGTAATACAAATAAAATAAGG + Intergenic
1164162502 19:22636935-22636957 GGTTTACTAAAAATAAAACATGG - Intronic
1165021978 19:32932412-32932434 AGTTTTATATAAATAGAAAAAGG + Intronic
1165577912 19:36837604-36837626 GAATTAAAAAAAATAGAAAAGGG - Intronic
1165659400 19:37562375-37562397 GGTTTCAAACAAAAAAAAAACGG - Exonic
1166538423 19:43590704-43590726 GGTTAAATACCAGGAGAAAAAGG + Exonic
1167225074 19:48232893-48232915 GGCATAATACAAAGAGAAGAAGG - Intronic
1168728068 19:58601806-58601828 GTTATAATACAAATATAAAATGG - Intergenic
928470035 2:31566285-31566307 ACCTTAATAAAAATAGAAAAAGG + Intronic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
928830244 2:35473366-35473388 GGTTTGTTACACATAAAAAAAGG + Intergenic
928858760 2:35830702-35830724 GTTTTAAGAAAAATAAAAAAGGG + Intergenic
929310893 2:40422831-40422853 CTTTTATTTCAAATAGAAAAGGG + Intronic
929910880 2:46088529-46088551 GGTTTAATAAAAAGAAGAAATGG - Intronic
930293376 2:49524243-49524265 GGTTTAAGATACATAGAAATAGG - Intergenic
930338935 2:50086543-50086565 AGTTTAAGGAAAATAGAAAATGG - Intronic
930490920 2:52070687-52070709 GGGTTAATCTAAAGAGAAAATGG - Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
931523597 2:63127728-63127750 GGAGTAATACATATAGAATAGGG - Intronic
932642974 2:73468829-73468851 TGTAGAAAACAAATAGAAAAAGG - Intronic
932763590 2:74456470-74456492 GGTTTATGACAAAAAGAAAAGGG + Intronic
933078820 2:77963093-77963115 AGTTTAATATAAACAAAAAAGGG + Intergenic
933254158 2:80061406-80061428 TGTTTAAAACAAACAGAAAACGG - Intronic
933994470 2:87657747-87657769 GGTTTCATACATTTAGAACACGG - Intergenic
936275069 2:111088879-111088901 GTTTATGTACAAATAGAAAAGGG + Intronic
936299388 2:111293166-111293188 GGTTTCATACATTTAGAACACGG + Intergenic
936441618 2:112558916-112558938 GGTTTAAAAAAAAAAAAAAAAGG - Intronic
936570485 2:113609199-113609221 GTTATAATACAAATATAAAATGG + Intergenic
937523753 2:122742271-122742293 GGTAGAATACAACTACAAAATGG - Intergenic
937623854 2:124022107-124022129 GGTTGAATACTAACAGAAAATGG - Intergenic
938513496 2:131978307-131978329 GCTTTAATTCAAGAAGAAAATGG + Intergenic
939433131 2:142136849-142136871 TGTTGAATTCAAATAGAAATTGG - Intergenic
939606432 2:144260879-144260901 GATTTAAAAAAAAAAGAAAAAGG + Intronic
939825966 2:147015834-147015856 GTTTTTATGCAAATAGGAAAAGG + Intergenic
940033884 2:149292987-149293009 TGTTTTATTCAAATATAAAATGG + Intergenic
940131793 2:150390001-150390023 AGTATAATACAACTAGATAATGG + Intergenic
940165158 2:150762590-150762612 TGTGTTGTACAAATAGAAAAGGG - Intergenic
941938046 2:171002160-171002182 GGTTTAATAATTTTAGAAAAAGG - Intronic
943143424 2:184011917-184011939 GATTTAATACAAGTCAAAAATGG - Intergenic
943184720 2:184592968-184592990 GGTTAAAAACAAAGGGAAAAAGG - Intergenic
943247882 2:185478426-185478448 GGTGTAAAGTAAATAGAAAATGG + Intergenic
943497776 2:188645557-188645579 AGTTTTGTACAAATAAAAAAAGG - Intergenic
944118811 2:196218207-196218229 GGTTTGGCACAAATAGCAAAAGG - Intronic
944663194 2:201938151-201938173 GGTTTAAAAAAAAAAAAAAAAGG + Intergenic
944969735 2:204978420-204978442 GTCTGAATACAAATAGAAAAGGG - Intronic
945323737 2:208458405-208458427 GATCTTATACAAATAGAAAATGG + Intronic
945774691 2:214091040-214091062 TGTGTGATAAAAATAGAAAAAGG + Intronic
945835199 2:214831418-214831440 GATTTAATAAAAGTATAAAATGG + Intergenic
946081697 2:217125707-217125729 TGTGTAGTACAAATAGAAATCGG + Intergenic
946475488 2:220002688-220002710 GGTATAATATAAACAGAAAGGGG + Intergenic
947126552 2:226874595-226874617 TATTTAACACAGATAGAAAAAGG - Intronic
947263907 2:228254601-228254623 GCTTTAATTCAAGAAGAAAATGG - Intergenic
947607478 2:231497375-231497397 GGTTTAGAACATGTAGAAAAAGG + Intergenic
949088331 2:242177451-242177473 GTTATAATACAAATATAAAATGG - Intergenic
1169996912 20:11568412-11568434 GGTTTATTCCAAATATAAGATGG + Intergenic
1170168829 20:13388519-13388541 GTTTAAATATAAATGGAAAAAGG + Intergenic
1170239272 20:14145258-14145280 GGTTTAGAACATGTAGAAAAAGG - Intronic
1172454319 20:35055430-35055452 AGTTTAATACAAACATGAAAAGG - Intronic
1173384485 20:42575074-42575096 GGTCTAATACACAGGGAAAAAGG + Intronic
1173496396 20:43521854-43521876 AGTTTACTATAAATAAAAAAGGG - Intronic
1173979239 20:47210469-47210491 AAGTTAATACAAATATAAAAAGG + Exonic
1174029335 20:47609265-47609287 GGTGTCATCCACATAGAAAAAGG - Intronic
1174315802 20:49700229-49700251 GGTTTGCAACAAATATAAAATGG + Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1174918880 20:54681449-54681471 TGTTTATAACAAATAGAATATGG + Intergenic
1176341645 21:5703907-5703929 GGTTTAATTAAAATATAAATCGG - Intergenic
1176473899 21:7136059-7136081 GGTTTAATTAAAATATAAATCGG - Intergenic
1176503182 21:7620549-7620571 GGTTTAATTAAAATATAAATCGG + Intergenic
1176535966 21:8101976-8101998 GGTTTAATTAAAATATAAATCGG - Intergenic
1176991217 21:15498517-15498539 ATTTGAATACAAATAGAAATTGG - Intergenic
1177143934 21:17387231-17387253 GGTTTACTAAAAATAAAAAGAGG - Intergenic
1177597837 21:23268563-23268585 GGTTTAAAAAAAATAAAAAGAGG + Intergenic
1177832045 21:26149948-26149970 GGTTTAATACTTGTAGAAAAGGG + Intronic
1177977951 21:27873612-27873634 GCTTTAATTCAAGAAGAAAATGG - Intergenic
1180263493 21:46693412-46693434 GTTATAATACAAATATAAAATGG - Intergenic
1181337559 22:22151102-22151124 TGTTTATTACAAATGGGAAAAGG + Intergenic
1181738674 22:24902324-24902346 GCTTAAAGAAAAATAGAAAAAGG - Intronic
1182155252 22:28065717-28065739 ACTTTAATTCTAATAGAAAATGG + Intronic
1182757998 22:32696438-32696460 TCTTCAATACAACTAGAAAATGG - Intronic
1182961382 22:34478495-34478517 GGACTAATACAAATACAAACAGG + Intergenic
1185429723 22:50801773-50801795 GTTATAATACAAATATAAAATGG - Intergenic
1203240915 22_KI270733v1_random:18373-18395 GGTTTAATTAAAATATAAATCGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950944455 3:16930146-16930168 TGTTTTATACTAAGAGAAAAGGG - Intronic
951025419 3:17823487-17823509 TGTTGAATAAAATTAGAAAAAGG + Intronic
951659872 3:25051085-25051107 TGTTTAACACAAGTAGAATAGGG + Intergenic
952068980 3:29609753-29609775 AGTTTAATACAAATTTTAAAAGG - Intronic
952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG + Intergenic
953111702 3:39947090-39947112 GTTTTAATACTAAGAGAAATAGG + Intronic
955613473 3:60781479-60781501 ATTTTAAAAAAAATAGAAAAGGG + Intronic
955631410 3:60979423-60979445 GGTTTAATAAAGAGGGAAAAAGG + Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
955759794 3:62267055-62267077 CCATTAATACAAATATAAAAGGG - Intronic
955870926 3:63437522-63437544 GGTTTAAGCAAAAAAGAAAAGGG + Intronic
956156212 3:66300475-66300497 TGTTTAAGACAAATAGGAAAAGG - Intronic
956921323 3:73932720-73932742 GGATTAACACAAATAAGAAACGG + Intergenic
958267539 3:91457145-91457167 AGTTTAATAAAAATAGCCAAAGG + Intergenic
959261823 3:104091684-104091706 GATTAAATAAAAATAGAAAAGGG - Intergenic
959818064 3:110699414-110699436 GATATAATACAAATAGCAAAAGG + Intergenic
960606285 3:119508757-119508779 GGTTTATTACACATATAATAAGG - Intronic
961338264 3:126198561-126198583 GGTTTAAAACAAGGAGAAGATGG + Intergenic
961345664 3:126261694-126261716 GGTTAAATTAAAATAGAAAACGG - Intergenic
961967122 3:130916726-130916748 GGCTGAATAAAAAAAGAAAAAGG - Intronic
962810057 3:138951876-138951898 CTTTTAATAGAATTAGAAAATGG + Exonic
963584553 3:147168785-147168807 GGTTTTATTTAAATAAAAAATGG - Intergenic
963690691 3:148497876-148497898 TATTTAATATAAATATAAAATGG + Intergenic
964272039 3:154966995-154967017 TCTTTAATATAAATTGAAAAAGG - Intergenic
964323777 3:155525146-155525168 TTTTTAATAAAAATAGAAATGGG - Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964599533 3:158481799-158481821 GAGTTCATCCAAATAGAAAATGG - Intronic
965040199 3:163498664-163498686 GCTTTAATCCACAGAGAAAAGGG + Intergenic
965041002 3:163507009-163507031 GGTTTAATAACGTTAGAAAAAGG - Intergenic
965125850 3:164628000-164628022 GGTTTAAAAGAAAAAGAAAGGGG + Intergenic
965439398 3:168694339-168694361 GGTTTAATAACAAAATAAAAAGG - Intergenic
965509477 3:169552668-169552690 CCTTTAATGCAAATAGGAAAAGG + Intronic
965841053 3:172906159-172906181 GGCTTAAAGTAAATAGAAAAAGG - Intronic
966366898 3:179198163-179198185 GAATCAATACAAAAAGAAAAAGG + Intronic
966481811 3:180417957-180417979 GGTTTAATGCCATTACAAAAGGG - Intergenic
966986963 3:185189675-185189697 GGTTAAGGACCAATAGAAAATGG - Intergenic
967421917 3:189282727-189282749 GGTTTTATGCGAAAAGAAAAGGG - Intronic
968239130 3:197059910-197059932 GGTTTAATAAAAATGGAGATAGG + Exonic
969894942 4:10294937-10294959 GCTTTAATACAAAAAGTAAAAGG - Intergenic
970521193 4:16885543-16885565 TCTTTAATTCAAAAAGAAAAGGG - Intronic
970819148 4:20192553-20192575 GGTTAAAAACAAACCGAAAAAGG + Intergenic
970906778 4:21225291-21225313 AGTATAATACAAACATAAAAAGG + Intronic
971467768 4:26982866-26982888 AGTGAAGTACAAATAGAAAAAGG - Intronic
971820721 4:31550532-31550554 CTTTTAATTCAAAAAGAAAAAGG - Intergenic
971940126 4:33203174-33203196 GATTTAATACAAATGGAGGAAGG - Intergenic
971981694 4:33759343-33759365 AAATTTATACAAATAGAAAAAGG - Intergenic
972420587 4:38882659-38882681 GCTTTACTAAAAAAAGAAAACGG + Intronic
972988471 4:44794340-44794362 GGATTAATACCATTATAAAAGGG - Intergenic
973117736 4:46482372-46482394 GGTTCATTTCAAATATAAAAAGG + Intergenic
973159455 4:46997091-46997113 GTTTTAATACAAATGAGAAAAGG - Intronic
973210661 4:47611865-47611887 GGTTCAATACAAAAAGAACTAGG - Intronic
974202600 4:58660703-58660725 GGTTTAAAACAAGAAGAAAGAGG - Intergenic
975720092 4:77240857-77240879 GGGTTAATGTAAATGGAAAATGG + Intronic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
976429908 4:84950408-84950430 AGTTTAATAAAAAAAAAAAAAGG + Intronic
977126103 4:93170387-93170409 TGTTTATTACAATTAAAAAAGGG - Intronic
978204607 4:106065972-106065994 GGCCAAATACAAATACAAAAGGG + Intronic
978703097 4:111673008-111673030 TGTTTAAAACAAATAAAAAGGGG - Intergenic
978854242 4:113375411-113375433 GGTTTCCAACAATTAGAAAATGG + Intronic
978880611 4:113697799-113697821 AGTTTAATTCAAGGAGAAAATGG - Intronic
979247430 4:118524881-118524903 GTTGTAATACAAAGAGAAGAGGG + Intergenic
980497278 4:133602867-133602889 TGTTTAATAGAAATAGAAATAGG - Intergenic
981185341 4:141795402-141795424 GATTAAAAACAAATTGAAAAAGG + Intergenic
981254477 4:142645403-142645425 GGTTTTATACTAAAAGAAAAAGG - Intronic
981455957 4:144953721-144953743 GGTCTAATACAGATAGATACAGG + Intergenic
981674939 4:147332001-147332023 GCTATAAAACAAATAAAAAATGG + Intergenic
981690620 4:147505031-147505053 TGAATAATCCAAATAGAAAATGG + Intronic
982456467 4:155615440-155615462 GGGAAAATAAAAATAGAAAAAGG - Intergenic
983277173 4:165631970-165631992 TGTGTAATAAAAATAGAAACAGG + Intergenic
983427651 4:167607903-167607925 GGCTTAAAACATAAAGAAAAAGG - Intergenic
984003355 4:174278780-174278802 GCTTTTATACAAATAAAACAAGG + Intronic
985080243 4:186257669-186257691 GATTTATTTCAGATAGAAAAGGG + Intronic
985466158 4:190198654-190198676 GTTATAATACAAATATAAAATGG - Intergenic
986277572 5:6291733-6291755 GGTGCAATAAAAATAGAAAAAGG + Intergenic
986391413 5:7290704-7290726 GGTTTAATGCAGAAAAAAAAGGG - Intergenic
986649327 5:9948160-9948182 GGTTTGATATAAATAGCACAGGG - Intergenic
987065498 5:14286065-14286087 GATTTAATACAATTAGAAGCTGG + Intronic
987295478 5:16546617-16546639 GATTAAATACAAATAAAAATTGG + Intronic
987450322 5:18075853-18075875 GGTTTAAAAAAAAAAAAAAAAGG - Intergenic
987593617 5:19966004-19966026 GCTTTCATAAAAAAAGAAAAAGG + Intronic
988213756 5:28244383-28244405 CGTTTATTTTAAATAGAAAATGG - Intergenic
988273245 5:29045421-29045443 AGTTTAAGATAAATAGAATATGG - Intergenic
988297592 5:29385849-29385871 GGTATGATAAAAGTAGAAAAAGG + Intergenic
988388227 5:30594215-30594237 TGTCTGATACAAATAGACAAAGG - Intergenic
988422332 5:31021917-31021939 AGTATAATAAAAAAAGAAAATGG - Intergenic
988898653 5:35707366-35707388 GAATTAAGACAAGTAGAAAAGGG - Intronic
989267435 5:39493244-39493266 GGTTTAATAAACATAAAACAAGG + Intergenic
989666395 5:43859118-43859140 GATGTAATACCTATAGAAAATGG + Intergenic
990028393 5:51224366-51224388 GGTGTAATTTAAAAAGAAAAAGG - Intergenic
990857311 5:60283524-60283546 GTTTTAAAAGAAATAAAAAATGG + Intronic
991113685 5:62929430-62929452 AGTCTAATACAAATATAATATGG - Intergenic
991635534 5:68700674-68700696 TTTTTAACAAAAATAGAAAAGGG - Intergenic
991645188 5:68794462-68794484 TGTTTTAGACAAATAAAAAATGG - Intergenic
992046008 5:72890358-72890380 TGTATAAAACAAATAGAAATTGG + Intronic
992916321 5:81456974-81456996 TTTTTAATACAAATAGGTAAAGG + Intronic
993787370 5:92159890-92159912 GGACTAATACAAATAGCAAGGGG - Intergenic
994109306 5:95982290-95982312 AATTGAATACAAGTAGAAAATGG - Intergenic
994527962 5:100930087-100930109 GGTATAATAAAAAAAAAAAAAGG - Intergenic
995299609 5:110563564-110563586 GTTCTAACAGAAATAGAAAATGG - Intronic
995378140 5:111501500-111501522 GAATTAATAAAAATAGAAACAGG + Intronic
995830680 5:116351732-116351754 GGTTTAATAATTTTAGAAAAAGG - Intronic
995961848 5:117851348-117851370 AGTATAATAATAATAGAAAAAGG - Intergenic
995981129 5:118105591-118105613 GGTAAAATGCAAACAGAAAAAGG - Intergenic
996585110 5:125078977-125078999 GTTTTAATACAAAGAGAATAAGG - Intergenic
997074793 5:130660679-130660701 GGTTTTATACACCTAGAAAATGG - Intergenic
997324357 5:133007757-133007779 GGATTAATACATATAATAAATGG + Intronic
997622910 5:135311049-135311071 CATTTCATACAAATATAAAATGG + Intronic
997839134 5:137222526-137222548 GATTTAATACAACTATAAGAGGG + Intronic
998291519 5:140919498-140919520 GAATTAAAACATATAGAAAAAGG - Intronic
998302075 5:141032082-141032104 AGTTTAAAAGACATAGAAAATGG - Intergenic
999914891 5:156247685-156247707 AGTTCAATACAAATACACAACGG + Intronic
1000876247 5:166641896-166641918 TGTTTAAGAAATATAGAAAAGGG - Intergenic
1001151752 5:169235246-169235268 GCTTTAAAAGAAATAGAAGATGG - Intronic
1001346553 5:170905465-170905487 GATTGAACACAAGTAGAAAATGG - Intronic
1001515378 5:172351768-172351790 GTTTTAATGCAAAAAAAAAAAGG + Intronic
1001742497 5:174065457-174065479 GGTTTAATACTAAAAGCAACAGG + Intronic
1002403839 5:179013188-179013210 GCTTTCTTACAAATATAAAATGG + Intergenic
1002571360 5:180141115-180141137 TGTGTAATACAGACAGAAAAGGG - Intronic
1002746110 5:181474989-181475011 GTTATAATACAAATATAAAATGG - Intergenic
1004049952 6:12067250-12067272 ACTTCAATAAAAATAGAAAATGG - Intronic
1005051733 6:21690470-21690492 CGTTTAAAACAAAAAGAAACAGG + Intergenic
1005375637 6:25179753-25179775 TGTTTAAAACAACTAAAAAAGGG + Intergenic
1008764115 6:54890348-54890370 AGTTTTACAAAAATAGAAAAAGG - Intronic
1008787363 6:55185072-55185094 GGTTTAATATAATAACAAAATGG - Intronic
1008987676 6:57564445-57564467 AGTTTAATAAAAATAGCCAAAGG - Intronic
1009176280 6:60463050-60463072 AGTTTAATAAAAATAGCCAAAGG - Intergenic
1009295112 6:61937268-61937290 AGTATAATAAAAAAAGAAAAAGG - Intronic
1009538289 6:64919485-64919507 GTTTTAATATTAATAGAAAAAGG + Intronic
1009713190 6:67351352-67351374 AGTTCAGTACAAACAGAAAAAGG + Intergenic
1009717111 6:67412109-67412131 GGGCTAATAAAGATAGAAAAAGG - Intergenic
1010578856 6:77568549-77568571 TTTTGCATACAAATAGAAAAAGG + Intergenic
1010694682 6:78956203-78956225 TGTTAAAGAAAAATAGAAAAAGG - Intronic
1011925545 6:92640315-92640337 AGTATAATAAAAAAAGAAAAAGG - Intergenic
1013248889 6:108314723-108314745 AGTTTAATAATAATAAAAAAAGG + Intronic
1013673920 6:112435920-112435942 GCTTTCATAAAAGTAGAAAAAGG - Intergenic
1014076014 6:117234977-117234999 ATTTTTATACAAAGAGAAAAAGG - Intergenic
1014120467 6:117719945-117719967 GGTGCAATAAAAAAAGAAAAAGG - Intergenic
1015043951 6:128757044-128757066 GGTTGAGAACAACTAGAAAATGG - Intergenic
1015219229 6:130785067-130785089 AGTGTCATACAAAGAGAAAAAGG - Intergenic
1015243527 6:131052439-131052461 GCTTTAACAAAAAAAGAAAACGG + Intronic
1015937264 6:138416161-138416183 GGGTTTATACAACTAGATAAAGG + Exonic
1016315899 6:142786516-142786538 TGTTTATTACAAATAGGAGATGG - Intronic
1016803212 6:148187331-148187353 GGTTTATTAAAAATGGGAAAGGG - Intergenic
1017989746 6:159475979-159476001 AGTTTAAGAATAATAGAAAATGG + Intergenic
1018318583 6:162583020-162583042 GGATTAATACCATTATAAAAGGG + Intronic
1019235001 6:170604260-170604282 GTTATAATACAAATATAAAATGG - Intergenic
1019781552 7:2943202-2943224 TCTTTACTAAAAATAGAAAAAGG + Intronic
1020031105 7:4933391-4933413 TGTTTTATACTAAAAGAAAATGG + Intronic
1020750607 7:12136466-12136488 TGTTAAATAAAAATAGACAATGG - Intergenic
1022002592 7:26240229-26240251 GATTTAATACAAAGTAAAAAAGG + Intergenic
1022586450 7:31617919-31617941 TCTTTACTACAAATAGAAAAGGG - Intronic
1022776932 7:33536483-33536505 GCTGTCTTACAAATAGAAAATGG + Intronic
1022866254 7:34424226-34424248 TATTTAATACAAATAGAATTTGG + Intergenic
1023278790 7:38548361-38548383 TGTTTAATACAAAGATAAAAAGG - Intronic
1023337476 7:39185509-39185531 GGTTTTATAAAAATAGAACCAGG + Intronic
1023666194 7:42525978-42526000 TGTTTAAAACAAAAAAAAAATGG - Intergenic
1024587100 7:50851381-50851403 GGTTAAATCAAAATAGAATAGGG - Intergenic
1025741272 7:64198379-64198401 GGTTTGATACACAGAGAAAGTGG - Intronic
1027635106 7:80662060-80662082 ATTTTAAGAAAAATAGAAAACGG + Intronic
1027728755 7:81842100-81842122 GGTTTAATAACAATAACAAAGGG - Intergenic
1028059602 7:86294923-86294945 TATTAAATACAAATAGAAATTGG + Intergenic
1029004783 7:97197434-97197456 GGGTAAATTCCAATAGAAAATGG + Intergenic
1030002049 7:105075187-105075209 GGTTTAAAAAAAAAAAAAAAAGG - Intronic
1030321781 7:108176973-108176995 CATTTTCTACAAATAGAAAATGG - Intronic
1031465298 7:122102594-122102616 GTATTAAAATAAATAGAAAATGG + Intronic
1031604643 7:123753891-123753913 GGTCTAATACAGAAAGATAAAGG - Intergenic
1032539931 7:132694473-132694495 GGTTCATTACAAAAAGTAAATGG + Intronic
1033937999 7:146612465-146612487 GGTTTAATATAAGAACAAAAAGG + Intronic
1035102212 7:156409627-156409649 GGTTAAAGACAAATAATAAATGG - Intergenic
1035513589 8:211697-211719 GTTATAATACAAATACAAAATGG + Intergenic
1035986369 8:4436620-4436642 GGATTAAAAAAAATAGAAGAAGG - Intronic
1036399061 8:8392280-8392302 AGACTAATACATATAGAAAAGGG - Intergenic
1036616978 8:10395834-10395856 TCTTTAATAAAAATATAAAATGG + Intronic
1036809700 8:11859130-11859152 GGGTTAAAAAAAACAGAAAAGGG + Intronic
1037152342 8:15653007-15653029 GTTTTAATAAAAATAGGAGAAGG - Intronic
1037250115 8:16882311-16882333 TGTTAAATACAAATAGTAAGTGG - Intergenic
1037956278 8:23062650-23062672 GGTTTAATTAAAAAAGAAGAAGG - Intronic
1038309182 8:26432496-26432518 GGTTTAATATAAATTAAAAATGG - Intronic
1039623196 8:39020317-39020339 TGTTATATACAGATAGAAAATGG + Intronic
1040640148 8:49323759-49323781 AGATTAATACAAATATAAAAGGG + Intergenic
1041193675 8:55378829-55378851 ATTTTAATACAAATATTAAATGG + Intronic
1041207732 8:55515275-55515297 GGTTTAAAACAGAGATAAAATGG + Intronic
1041551992 8:59113486-59113508 GGTAGATTCCAAATAGAAAATGG + Intronic
1041952590 8:63520632-63520654 GGTTTAAAACAAAAAAAAATGGG - Intergenic
1043745949 8:83873693-83873715 GGTAGAATACAAATATAAAATGG - Intergenic
1043912216 8:85876123-85876145 GGTTTGATCCAGACAGAAAAGGG - Intergenic
1044000828 8:86879256-86879278 GGTTCAAGATGAATAGAAAATGG + Intronic
1044354924 8:91209827-91209849 GGTTTTAAACAACTAGAAGATGG + Intronic
1044488752 8:92786923-92786945 GGTAAAATACAACTAGAAATTGG - Intergenic
1045718945 8:105082935-105082957 GGTTTAATGCACATAAAAATGGG - Intronic
1047739719 8:127796763-127796785 GATATAAAACAAATAGCAAAGGG - Intergenic
1048130347 8:131689264-131689286 GGTTTAATGCATTTAGAAAGGGG + Intergenic
1048263390 8:132964630-132964652 GTTTTAAGAGAAATAGGAAATGG + Intronic
1048781479 8:138006938-138006960 TGTTAAACACAAATACAAAAGGG + Intergenic
1048872262 8:138809309-138809331 GTTTTAAGACAAATAGAATTTGG - Intronic
1049855680 8:144860374-144860396 TGTTTCATACAGAAAGAAAAGGG + Intergenic
1049943486 9:572068-572090 AGTTTAAAACAAATTAAAAATGG + Intronic
1050176057 9:2870462-2870484 GGTTTATGACAAGTAGATAATGG - Intergenic
1050391029 9:5144689-5144711 GGTTCAATTCAACAAGAAAATGG - Intronic
1051054038 9:12962420-12962442 GGATTAATAGAAAAAAAAAATGG + Intergenic
1051275882 9:15398046-15398068 TGTTTAATACAGCAAGAAAAAGG - Intergenic
1051322703 9:15925911-15925933 TGTTAAATACAGGTAGAAAATGG - Intronic
1055459237 9:76502078-76502100 GGTTTAAAACAAAAACAAAGTGG - Intronic
1055566626 9:77575723-77575745 GACTTAAAACCAATAGAAAATGG - Intronic
1055614799 9:78060351-78060373 AGTATAATAAAAAAAGAAAAAGG + Intergenic
1058241303 9:102564627-102564649 GATTTAAAACAAATAGAACTGGG - Intergenic
1058364657 9:104194771-104194793 GGTTTAAATAAAATAGAAAATGG - Intergenic
1058527176 9:105871206-105871228 GCTTTAATAGAAAGAGAAAGGGG + Intergenic
1058817878 9:108702574-108702596 GGTTTGGTATAATTAGAAAATGG - Intergenic
1059218863 9:112592982-112593004 GTTTTAGTACACATAGAAAAAGG + Intronic
1059385974 9:113964553-113964575 GATTTAATTCAATTATAAAATGG - Intronic
1059841790 9:118225477-118225499 GCTTTAAAACAAATTTAAAAGGG + Intergenic
1203457242 Un_GL000220v1:1460-1482 GGTTTAATTAAAATATAAATCGG - Intergenic
1203580579 Un_KI270745v1:41043-41065 GTTATAATACAAATATAAAATGG - Intergenic
1187063488 X:15810592-15810614 GCTTAAATTCAAAAAGAAAAAGG - Intronic
1188267736 X:28098191-28098213 TGTTTGATAGAAACAGAAAAGGG - Intergenic
1188409742 X:29857021-29857043 AGTTTCATAGAAACAGAAAATGG + Intronic
1190093497 X:47460630-47460652 GCTTTAATAAACATAAAAAAAGG + Intronic
1191090868 X:56619227-56619249 AGTTTAATAAAATTAGAAATGGG + Intergenic
1191233651 X:58117161-58117183 GGTTTGTTACAGATAGAGAATGG - Intergenic
1192241606 X:69334630-69334652 TGTTTAATAGAAATAGTGAAAGG + Intergenic
1192780378 X:74288118-74288140 GGTTTTATACAAAGATAAGATGG + Intergenic
1193507089 X:82357932-82357954 AGTATAATAAAAAAAGAAAATGG + Intergenic
1193892724 X:87070546-87070568 GATTAAATGCAAAGAGAAAATGG + Intergenic
1194057939 X:89161065-89161087 TATTAAAAACAAATAGAAAAAGG - Intergenic
1194146639 X:90273948-90273970 GGTTTAATAACAATGTAAAAAGG - Intergenic
1195895258 X:109739702-109739724 GGATTAATACAAAAAGCCAATGG - Intergenic
1197003761 X:121471307-121471329 GGTTTAATTCTGAAAGAAAACGG - Intergenic
1197924973 X:131636715-131636737 GTTTTAACACTTATAGAAAATGG - Intergenic
1198056458 X:133000460-133000482 GGTTTATTTCAAATAGTAAATGG - Intergenic
1199367698 X:147006519-147006541 GGTTTGATACAATGATAAAATGG + Intergenic
1199368674 X:147019689-147019711 ACTTGAATACAAAAAGAAAAAGG - Intergenic
1200492382 Y:3843127-3843149 GGTTTAATAACAATGTAAAAAGG - Intergenic
1201450508 Y:14107463-14107485 GACTGAATACAAACAGAAAAGGG - Intergenic
1201954249 Y:19604973-19604995 GGTCTAATAGAGGTAGAAAATGG + Intergenic