ID: 964333645

View in Genome Browser
Species Human (GRCh38)
Location 3:155631814-155631836
Sequence GAATAATGCAGAAGCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964333645 Original CRISPR GAATAATGCAGAAGCACCTG TGG Intronic
901988219 1:13092349-13092371 GCTTAAAGTAGAAGCACCTGTGG - Intergenic
901993593 1:13134418-13134440 GCTTAAAGTAGAAGCACCTGTGG + Intergenic
902145747 1:14397561-14397583 GAATAAGGCAGAAGCGCTGGGGG + Intergenic
905384141 1:37588348-37588370 GGATGATGCAGCAGCCCCTGTGG + Intronic
905565648 1:38962357-38962379 GAGTAATGGATAAGCACCTATGG - Intergenic
905615255 1:39392787-39392809 TAATCATTCAGAAGCAACTGAGG - Intronic
909148101 1:71964191-71964213 CCATAACGCAGAAGCATCTGTGG - Intronic
909299053 1:73987803-73987825 GAATAATCCAGAAAAACCTGTGG - Intergenic
909997414 1:82297767-82297789 GGATGAGGCAGAAGAACCTGGGG + Intergenic
910578782 1:88798033-88798055 AAAGAATGCAAAAGCACCAGAGG + Intronic
911143964 1:94534971-94534993 GACACAAGCAGAAGCACCTGGGG + Intronic
913330360 1:117662240-117662262 GGAAAATGCAGAAGCAACTTTGG + Intergenic
914198493 1:145463702-145463724 AATAAATGCAGAAGCAGCTGAGG - Intergenic
916467483 1:165086297-165086319 GAAGAATGCAGAAGCCTCAGGGG + Intergenic
918581657 1:186137834-186137856 GAAGAATGCACAAGGAGCTGTGG + Exonic
923214731 1:231838114-231838136 GAATACTGGAGAAGAACATGTGG + Intronic
924636673 1:245794676-245794698 AAATTATGCAAAAGCAGCTGAGG - Intronic
1063709903 10:8467501-8467523 AAATAAGCCAGAAGCATCTGAGG + Intergenic
1065361144 10:24890277-24890299 GAGCAATGCAAAATCACCTGGGG + Intronic
1065709736 10:28504272-28504294 GGATAATACAGAAGCCTCTGAGG + Intergenic
1068039916 10:51810589-51810611 GAATAAGGGAAAAGCACATGTGG - Intronic
1068049105 10:51926599-51926621 GAAAAATGCAGTAGCACCCAGGG - Intronic
1068324195 10:55462322-55462344 GAAAAATCCAGAAGGACCTGTGG - Intronic
1068966434 10:62916591-62916613 GAGTAATGCAGAAACACTAGTGG + Intronic
1069424745 10:68279255-68279277 CAATAAAGTAGAAGCAACTGAGG + Intergenic
1069904609 10:71725005-71725027 TAATATTTCAGAAGAACCTGGGG - Intronic
1070788605 10:79176612-79176634 GAATTTCCCAGAAGCACCTGGGG + Intronic
1070998860 10:80811780-80811802 GACTAATGCAGAAGGGCATGAGG + Intergenic
1073218654 10:101851572-101851594 GAACAGTGCAGAGGCACCTTTGG - Intronic
1074723344 10:116282970-116282992 GATTAATGCAGAAGCATTTTTGG + Intergenic
1075238864 10:120759253-120759275 GAATAATGCAGAATCATGTGTGG + Intergenic
1078968357 11:16374142-16374164 GAATAATGAAGAGGCACATAAGG - Intronic
1079668292 11:23134978-23135000 GTTTGATGCAGAAGCACCTGTGG - Intergenic
1082135201 11:48540624-48540646 GAATAATGCTGCAGTACCTATGG - Intergenic
1083380464 11:62264237-62264259 GAAGACTGAAGAAGGACCTGTGG + Intergenic
1084011957 11:66356510-66356532 GAATATTTCACAAGCACTTGAGG + Intronic
1084586952 11:70067883-70067905 GAAAAATGCTGAAGGACCAGGGG - Intergenic
1084703657 11:70803509-70803531 GAATGCTGCAAAATCACCTGAGG + Intronic
1089032420 11:115346165-115346187 GGATAATGCTGAACCACATGTGG - Intronic
1089581717 11:119485472-119485494 GAAAAATGCAGAGGCCCCTGGGG - Intergenic
1089633798 11:119799549-119799571 CACTAATGCAGAGGCTCCTGTGG - Intergenic
1089902289 11:121999713-121999735 GAAAAATGCAGAGGCACTTAGGG + Intergenic
1090409101 11:126495409-126495431 GGAGAAAGCAGAACCACCTGGGG - Intronic
1094643145 12:32296058-32296080 GAATGAGGCAGAAACACATGGGG - Intronic
1098512431 12:71332578-71332600 GAATAATTTAGCAGCACATGTGG + Intronic
1099502747 12:83433132-83433154 GAATCATGCACCAGCAACTGAGG - Intergenic
1100902185 12:99253867-99253889 GAAAAATGCAGAATCACTTTTGG + Intronic
1103110583 12:118274369-118274391 AAATAATGCAGAAGTAGCTGGGG + Intronic
1108341405 13:49501536-49501558 GAATAAAACAGAAGCACAGGAGG + Intronic
1108679107 13:52764097-52764119 GAAAGAAGCAGAAGAACCTGAGG + Intergenic
1109805568 13:67437054-67437076 TAATAATGCAGACACACCTTTGG + Intergenic
1110304788 13:73973153-73973175 TAACACTGCAGATGCACCTGTGG + Intronic
1110375179 13:74785355-74785377 GAGAAATGCAGAAGGCCCTGAGG + Intergenic
1113960908 13:114125674-114125696 GTCTACTGCAGCAGCACCTGTGG - Intronic
1114699306 14:24661384-24661406 GAATAATACAGAATTACTTGGGG + Intergenic
1115226293 14:31105443-31105465 GGATAATGCAGAAGAATATGTGG - Exonic
1117742987 14:58837072-58837094 AAATAATGCAGAATTACATGAGG - Intergenic
1119561451 14:75593200-75593222 TAAAAATGCAGAAGCAGCTTTGG - Intronic
1125880206 15:43186771-43186793 GAATAATGCAAAAGGAACTGGGG - Intronic
1128099491 15:64987184-64987206 GAATAATTCACAACCACCTCAGG + Intronic
1128579502 15:68798957-68798979 CAATCATGCAGAAGAACCTAAGG + Intronic
1130354900 15:83120288-83120310 GTGCAATGCAGAAGCTCCTGTGG - Intronic
1130702332 15:86197142-86197164 TAAAAATGCAGAAGCAGCTTTGG + Intronic
1130935415 15:88466446-88466468 GAATAAGGCAGAAGTAGCTCTGG - Intronic
1132065483 15:98727638-98727660 GTATAATGCAGGAGAAGCTGGGG - Intronic
1134395198 16:13856065-13856087 GGATAAGTCAGAATCACCTGAGG + Intergenic
1139391282 16:66607361-66607383 GAATAAGGCAGCAGGGCCTGAGG + Intronic
1140448892 16:75054133-75054155 GAAAAAGGCAGAAGCCCATGTGG + Intronic
1144671290 17:17134023-17134045 GAGAAAAGCAGAAGAACCTGGGG - Intronic
1147357465 17:39909071-39909093 TAATGATGTAGAAACACCTGGGG - Intronic
1150831008 17:68519155-68519177 CAAAAATGCAGAAGCAACTTTGG - Intronic
1150958587 17:69889808-69889830 TAATAATACATGAGCACCTGAGG + Intergenic
1153158692 18:2178700-2178722 GCATAATGCAGAAGCATCATAGG - Intergenic
1155042509 18:22076443-22076465 GGAGAATCCAGAAGCAGCTGAGG - Intergenic
1158127805 18:54121416-54121438 GAAGAATCCAGAAACACCTGAGG - Intergenic
1158504027 18:58030180-58030202 GAATAAAGCAGAAACAGCAGAGG + Intergenic
1160259068 18:77274230-77274252 GAAAAATGCAGATGGTCCTGTGG + Exonic
1163713010 19:18857991-18858013 GACTCTTGCAGAAGCACCAGGGG - Intronic
1164617548 19:29675948-29675970 GACTAGTGCAGAAGCACTCGTGG - Intergenic
925180873 2:1816301-1816323 GAATGAAGCAGAAGCACTTGGGG + Intronic
925289836 2:2740154-2740176 GGCTAATGGAGGAGCACCTGTGG + Intergenic
931168332 2:59775567-59775589 GTCTGAGGCAGAAGCACCTGGGG + Intergenic
931186822 2:59960481-59960503 GAATAATGTAGAAACACTTCAGG + Intergenic
932959912 2:76401043-76401065 AAATAATGCTCAAGGACCTGTGG + Intergenic
933062468 2:77754953-77754975 GAAGAATGCAGAAGCCTCAGGGG + Intergenic
933756884 2:85646717-85646739 GATTAAGGCAGAGGCACCTCTGG - Intronic
934831190 2:97526750-97526772 GAAGAATGCAGAAGCCTCAGAGG + Intronic
935227120 2:101062182-101062204 TAATCTTGCACAAGCACCTGGGG + Intronic
937600322 2:123723845-123723867 GAATTATGCTGAATCACATGGGG + Intergenic
937657459 2:124392851-124392873 GAATTATAAAGAAGCACCTTTGG + Intronic
940192073 2:151052041-151052063 GACTAATGCAAAGCCACCTGTGG + Intergenic
940578942 2:155551070-155551092 TGAAAATGCAGAAGCAACTGTGG - Intergenic
941590550 2:167415525-167415547 TAAAAATGCAGAAGCAGCTTTGG + Intergenic
943130795 2:183850728-183850750 GAAGAATGCAGAAGCCTCAGGGG + Intergenic
943306008 2:186263781-186263803 GATTAATCCTGAATCACCTGAGG + Intergenic
943867992 2:192954030-192954052 GAAAAATGCATAAGCAACAGAGG + Intergenic
947676322 2:231984204-231984226 GAATAATGATAAAGCACCAGAGG - Intronic
1175333960 20:58182935-58182957 GAACGATGCAGCGGCACCTGAGG - Intergenic
1177820978 21:26030671-26030693 GAATTAAGGAGAAGCACCTAAGG + Intronic
1178049484 21:28732373-28732395 GAATAAAGCAGAAGCACACATGG + Intergenic
1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG + Intronic
1179495706 21:41770059-41770081 GAATAAAGCTGGAGCCCCTGGGG + Intergenic
1182349458 22:29691086-29691108 TAATGAAGCAGAAGCACCTCAGG - Intronic
1184032244 22:41901957-41901979 GCATGCTGCAGAAGCACCTGTGG - Intronic
1184533234 22:45070276-45070298 GAATGAGGCAGAAGCAGCTGGGG + Intergenic
949488106 3:4560532-4560554 GAATAATCCAGAAGCATAAGAGG + Intronic
951442797 3:22742532-22742554 GAAGAATGCAGAAGCCTCAGGGG - Intergenic
952341249 3:32449448-32449470 AAATAGTGCAGAAGTTCCTGGGG - Exonic
953475372 3:43201534-43201556 GAATATATCACAAGCACCTGTGG + Intergenic
955815947 3:62843313-62843335 TAATAATGCAGAAATACTTGTGG - Intronic
955996693 3:64686344-64686366 GAAACATCCAGAAGCCCCTGGGG + Intronic
957144320 3:76403547-76403569 GAAGAATGCAGAACCCTCTGGGG - Intronic
958033328 3:88140969-88140991 CTGTAATGCAGAAGCACTTGAGG + Exonic
960639191 3:119810459-119810481 GAATGATGCAGGAGCAACTGAGG - Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961404876 3:126672054-126672076 GGAAAAGGCAGGAGCACCTGGGG + Intergenic
964146824 3:153473855-153473877 AAAGCATGCAGAAGAACCTGAGG + Intergenic
964333645 3:155631814-155631836 GAATAATGCAGAAGCACCTGTGG + Intronic
964597407 3:158450591-158450613 GAATGAGGCAGAGGTACCTGAGG + Intronic
964966262 3:162496968-162496990 GAAAAATGTAGAAGCAACTTTGG - Intergenic
965691656 3:171363405-171363427 GAATAATGCAGAGCTAACTGAGG - Intronic
965952896 3:174332366-174332388 GACTAAGGCACAAGCCCCTGTGG - Intergenic
969648860 4:8451147-8451169 CATTATTGCTGAAGCACCTGTGG + Intronic
970534224 4:17012636-17012658 AAATAAATCAGAAGCCCCTGAGG + Intergenic
970801427 4:19977280-19977302 GAAAAATGCAGAAGCAACTTTGG - Intergenic
974887490 4:67837803-67837825 GAAAAATGAAGAAGCCTCTGAGG + Intronic
975353836 4:73376189-73376211 GCATTATGCAGAGGCCCCTGTGG - Intergenic
976989266 4:91344531-91344553 GAATAATGCAGAGCTTCCTGTGG + Intronic
977815555 4:101410464-101410486 GAAGAATGCAGAAGCCTCAGGGG - Intergenic
978857834 4:113413315-113413337 GACTATTTCAGAAGCACCAGTGG + Intergenic
985650997 5:1107504-1107526 GAGTCAAGCAGAGGCACCTGAGG - Intronic
988226845 5:28424037-28424059 GAATAATGTGTGAGCACCTGTGG + Intergenic
989348332 5:40454263-40454285 GAATCCTGCAGAAGCAACTGAGG - Intergenic
992272383 5:75078250-75078272 ACATAAAACAGAAGCACCTGTGG + Intronic
993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG + Intergenic
993390629 5:87316455-87316477 GAAAAATGAAGAAGAACCTTTGG - Intronic
994097965 5:95864232-95864254 CACCAAGGCAGAAGCACCTGTGG - Intergenic
994561721 5:101382380-101382402 CAAAAATGCAGAAGCAGCTTTGG - Intergenic
994561979 5:101386099-101386121 GAATAGTGCAGAAGAGGCTGTGG + Intergenic
998557105 5:143136131-143136153 GAATGAAGCAGAAGCAGCTTTGG + Intronic
998986029 5:147757774-147757796 TGATAATGCAGTTGCACCTGAGG + Intronic
999460337 5:151752295-151752317 GATGAAAGCAGAATCACCTGGGG - Intronic
999680058 5:154049011-154049033 AAATAATGCAGGGACACCTGAGG - Intronic
1003839549 6:10105831-10105853 AGATAATCCAGAACCACCTGAGG - Intronic
1008837972 6:55860816-55860838 GCAAAATGCAGAAGTACATGAGG - Intronic
1009451732 6:63809218-63809240 GAATTAGGCAGAAGAACGTGAGG + Intronic
1012120396 6:95359270-95359292 GAAAGATGCAGAAAAACCTGAGG + Intergenic
1012362996 6:98406750-98406772 GAATCATGAAGAAGGCCCTGAGG - Intergenic
1013001323 6:106025350-106025372 AAATAATCCAGAAGCACAAGAGG + Intergenic
1016300565 6:142625990-142626012 GTATAATTCATAAGCACTTGGGG + Intergenic
1018024888 6:159797308-159797330 GCATCATGTAGAAGCACTTGTGG + Exonic
1019006244 6:168799131-168799153 GAAAAATCCAGACACACCTGTGG + Intergenic
1019768862 7:2870902-2870924 CAGGAATGCAGTAGCACCTGGGG - Intergenic
1020748108 7:12103705-12103727 GAATAATGCAGCAGCATCTATGG - Intergenic
1022323998 7:29313472-29313494 GAAAAATGCAGAAGCAGCCCTGG + Intronic
1024905032 7:54367849-54367871 GCATAATTCAGGATCACCTGAGG + Intergenic
1029148127 7:98461205-98461227 AAATAATGCCGAAACACATGTGG + Intergenic
1029249693 7:99226948-99226970 GAATAAGCAAGAAGCACCTCGGG + Intergenic
1029888069 7:103894690-103894712 GAAAAATGCAGAGGCAGCTGTGG + Intronic
1030092356 7:105868653-105868675 GAAGAATACACAAGCAACTGGGG + Intronic
1031203818 7:118727390-118727412 GAATAATGAGGAAGCATCTTAGG + Intergenic
1031562929 7:123260299-123260321 GAATAATTAAGAAGTATCTGAGG - Intergenic
1031654793 7:124341398-124341420 GAATTATGCAGAATCAACTCTGG - Intergenic
1032831257 7:135629042-135629064 GACTGAAGCAGAATCACCTGAGG + Intronic
1034104682 7:148480249-148480271 GAATGATGGAGTAGCAGCTGAGG - Intergenic
1035360466 7:158310176-158310198 TAAAAATGCAGAAGCAACTTTGG + Intronic
1035627144 8:1079398-1079420 AAATAATGCAGAAGAACTTAAGG - Intergenic
1037002916 8:13742735-13742757 CTGTAATGCAGAAGCACTTGAGG + Intergenic
1039250838 8:35662364-35662386 CAGTAATGCAGCATCACCTGAGG - Intronic
1040083349 8:43312078-43312100 GAAGAATGCAGAAGCCTCAGGGG - Intergenic
1041785105 8:61622954-61622976 AAATAAGGAAGAAGCCCCTGGGG - Intronic
1042510132 8:69602633-69602655 GTATGATGCAGCAGCACATGTGG - Intronic
1042932659 8:74029216-74029238 GCATCATGCAGAGCCACCTGGGG + Intergenic
1043370239 8:79583116-79583138 CAAAAATGCAGAAGCAACTTTGG + Intergenic
1044538451 8:93383717-93383739 GAATGAAGCAGAGGCTCCTGGGG - Intergenic
1045499881 8:102737058-102737080 GAAGAATGGAGAAGCATGTGAGG - Intergenic
1045950070 8:107841403-107841425 GAAGAATTCTGAAGCACGTGGGG - Intergenic
1046830092 8:118735819-118735841 GAATAAACCAGAAATACCTGAGG - Intergenic
1048064166 8:130950637-130950659 GAAGAATGGAGAAGTACATGAGG - Intronic
1056256391 9:84803521-84803543 CAATAAGGCAGCAGCACATGGGG + Intronic
1058455301 9:105132862-105132884 GAATAAAGCTGAAGGTCCTGAGG + Intergenic
1058572907 9:106366653-106366675 GAAAAATGTAGAAGCAGCTTTGG - Intergenic
1059746424 9:117206178-117206200 GAAGAGTGGAGAAGCATCTGTGG + Intronic
1059899879 9:118911908-118911930 GAAGCATGCAGAAGCACAGGAGG + Intergenic
1060113330 9:120922022-120922044 GAATTATGCAGAACCACCCCTGG + Intronic
1060141554 9:121214730-121214752 AACTAATGCAGTAGCTCCTGGGG - Intronic
1186083734 X:5963033-5963055 TAAAAATGCAGAAGCAGCTCTGG + Intronic
1187425842 X:19176545-19176567 GAATAATCTGGAAACACCTGAGG + Intergenic
1191775278 X:64807381-64807403 GAATACTGCACCAGCAACTGAGG + Intergenic
1192492842 X:71591265-71591287 GAGTTATGCAGCACCACCTGAGG - Intronic
1192493094 X:71593478-71593500 GAGTTATGCAGCACCACCTGAGG - Intronic
1193395120 X:80974635-80974657 GAATAATGCAGAAGCCCAAATGG + Intergenic
1195681373 X:107549456-107549478 GAATAATGAAGAATCATCAGAGG + Intronic
1196610549 X:117709441-117709463 GAATAATTTAGAGGCATCTGAGG - Intergenic
1198610872 X:138398849-138398871 GAACAAGGCAGAACCATCTGTGG - Intergenic
1198777605 X:140197409-140197431 GAATAATGCAAAAGCAGATGAGG + Intergenic
1200745809 Y:6903093-6903115 GAATACTGGAGATCCACCTGAGG - Intergenic
1201713147 Y:17014126-17014148 GCAAAAGGCAGAAGCACATGAGG + Intergenic