ID: 964335269

View in Genome Browser
Species Human (GRCh38)
Location 3:155648206-155648228
Sequence GGGAACAATAGTAGTAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964335263_964335269 21 Left 964335263 3:155648162-155648184 CCACAAGGTCAGAGCTCAGGAAT 0: 1
1: 0
2: 3
3: 22
4: 219
Right 964335269 3:155648206-155648228 GGGAACAATAGTAGTAGTATTGG 0: 1
1: 0
2: 1
3: 10
4: 123
964335262_964335269 22 Left 964335262 3:155648161-155648183 CCCACAAGGTCAGAGCTCAGGAA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 964335269 3:155648206-155648228 GGGAACAATAGTAGTAGTATTGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964335269 Original CRISPR GGGAACAATAGTAGTAGTAT TGG Intronic
902534159 1:17109471-17109493 ATAAACAATAGTAGTAGTAGTGG - Intronic
905138212 1:35817850-35817872 GAGATCAATAGTAGTAGAAGTGG + Intronic
905404694 1:37724946-37724968 GGGAACATTAGGAGTAATAGTGG + Intronic
905703388 1:40036262-40036284 GGGGACAGTAGTAGTAGTTCTGG + Intergenic
909513251 1:76478651-76478673 GGAAAAAATAGTAGTACTAGGGG - Intronic
909816874 1:80005347-80005369 AGCAACAATAGTACTAGTAAAGG + Intergenic
915078528 1:153333509-153333531 GGGAACAATTTTAGTAGGGTTGG - Intronic
915285596 1:154850093-154850115 GGGAACAGTAGAACTGGTATGGG - Intronic
918494472 1:185118172-185118194 CGTAACAATAGTAGTAATTTGGG - Exonic
919224939 1:194685369-194685391 GTGAACAATAGTAGGAGAATTGG - Intergenic
919612704 1:199765334-199765356 GAGAATAATATTAGTAGTAAAGG + Intergenic
920458810 1:206121690-206121712 TTGAAAAATATTAGTAGTATGGG - Intergenic
920572550 1:207028668-207028690 TGTAACAATAGTAGTAGCAAAGG + Intronic
1066692031 10:38039051-38039073 TGGTACCAGAGTAGTAGTATTGG + Intronic
1069116520 10:64513712-64513734 GGAAACAATAGTGGCAGTAAAGG - Intergenic
1075748201 10:124743084-124743106 GGGAACAATGCTTGTAGTACGGG - Intronic
1077619639 11:3709195-3709217 GGCAATAATAGTAGTTATATTGG - Intronic
1078192018 11:9098747-9098769 GGGAACAGTAGTAGTAATTCTGG - Intronic
1079157946 11:17965967-17965989 TGGGAGAATAGTAGTAGTAATGG - Intronic
1080166195 11:29240787-29240809 AGGAACAAAATTAGTAGCATGGG - Intergenic
1080456663 11:32425742-32425764 GGGAAAAATAGTATTTTTATTGG + Intronic
1090143137 11:124287534-124287556 GGAAACAATTGTATCAGTATAGG + Intergenic
1090738717 11:129636787-129636809 GGTAGCAATAGTAGTAGTAGTGG + Intergenic
1091597903 12:1891076-1891098 GGGGACAGTAGTAGTAGTGGTGG - Intronic
1098126806 12:67305012-67305034 GGGAACATTAGCAGTACTATAGG + Intronic
1098599425 12:72312827-72312849 GGGAAAAATAGTGGAGGTATAGG - Intronic
1099585954 12:84513807-84513829 TGAAACAAATGTAGTAGTATTGG - Intergenic
1099794557 12:87382755-87382777 AGGAACAATAGTAATAAAATGGG - Intergenic
1100640809 12:96480872-96480894 GGGTACAATAGTTGTAGTAAAGG + Intergenic
1102248627 12:111370593-111370615 GGGAAGAATAGTAGGAAAATAGG + Intergenic
1106645480 13:31629604-31629626 GGGAACATTGGTGGTAGTCTGGG - Intergenic
1107734620 13:43385550-43385572 AGAAACAATAATAGTAGTTTTGG + Intronic
1107754598 13:43606646-43606668 GGGAAGAATAGTAGGAGCAGGGG + Intronic
1109869319 13:68312121-68312143 TGGAATAATTTTAGTAGTATTGG - Intergenic
1110123397 13:71911120-71911142 GGGCACAATAATACTAGCATAGG - Intergenic
1110276852 13:73650316-73650338 GGGAAAAATTGTAGGAGTGTGGG - Intergenic
1110671329 13:78182415-78182437 GAGAAGAATAATTGTAGTATAGG + Intergenic
1110739832 13:78981760-78981782 GGGAAAAATAGGAGGAGTCTTGG + Intergenic
1115182603 14:30646672-30646694 TGGAATAATATTAGTAGTATTGG + Intronic
1116280223 14:42897222-42897244 TGGAATAATATTAGTAGGATGGG + Intergenic
1117910244 14:60630483-60630505 TGGAATAATTGTAGTTGTATTGG - Intergenic
1118434831 14:65761036-65761058 GGCTACAGTAGTAGTAGTTTTGG - Intergenic
1118821839 14:69350861-69350883 GGGAAGAATAATAGTAAGATAGG - Intronic
1119610746 14:76059798-76059820 GGGGATAATAGTAGTACTACGGG - Intronic
1120579083 14:86224074-86224096 GGTAATAATAGTAATAGTAGTGG - Intergenic
1123585913 15:21760624-21760646 GGGAAGAATAGGAGTAGGAACGG + Intergenic
1123622554 15:22203214-22203236 GGGAAGAATAGGAGTAGGAACGG + Intergenic
1124492298 15:30165493-30165515 GGAAACAAAAGAAGGAGTATGGG - Intergenic
1124751237 15:32372824-32372846 GGAAACAAAAGAAGGAGTATGGG + Intergenic
1125729917 15:41887254-41887276 GGGAGCAGTAGTGGTAGTAGAGG + Exonic
1126048538 15:44666621-44666643 GGGGACAATGGTAGTAGTAACGG - Intronic
1128005411 15:64235112-64235134 GGGACCAAGAGTAGTTGTCTTGG + Intronic
1130558703 15:84942566-84942588 GGGAATAATAGTAGTTGCCTGGG - Intronic
1131833682 15:96369785-96369807 GGGATCAATTGGAGTAATATTGG - Intergenic
1136336066 16:29611641-29611663 GGGAAAAATCGTAGTAGGACAGG - Intergenic
1137027203 16:35488968-35488990 AGGAAGAATAGAAGTAGTGTTGG - Intergenic
1141773776 16:86108297-86108319 GGTAACAGTAGTAGTAGTAATGG - Intergenic
1144148334 17:12419855-12419877 GGAGACAATACTAGTAGTCTGGG - Intergenic
1146428876 17:32771713-32771735 GGGAACCATGATTGTAGTATTGG + Intronic
1150099329 17:62408357-62408379 GGGGACAATAGTAGAAGCAAGGG - Intronic
1150340162 17:64360051-64360073 GGGAACAATAAGAGAAGTAGGGG - Intronic
1153729368 18:7992919-7992941 GGCAGTAGTAGTAGTAGTATTGG + Intronic
1156025967 18:32655482-32655504 GGGAACATTACTGGTAGTCTGGG - Intergenic
1157078887 18:44499563-44499585 GGTATCAATAGTAGTAATAGTGG - Intergenic
1159109473 18:64040600-64040622 GGGAACAATGCTAGAAGAATAGG + Intergenic
925395487 2:3530361-3530383 GAGAGTATTAGTAGTAGTATGGG + Intergenic
925546539 2:5022877-5022899 AGTAATAATAGTAGTAGTAGTGG - Intergenic
925546540 2:5022907-5022929 GGTAGTAATAGTAGTAGTAGTGG - Intergenic
926673461 2:15597663-15597685 GGGAACACTATTAGTATTTTAGG - Intronic
928450756 2:31376838-31376860 AGTAATACTAGTAGTAGTATCGG + Intronic
928802953 2:35116021-35116043 GGGAGCATTGGTAGTAGTCTGGG + Intergenic
929963955 2:46519773-46519795 GAGGACAATAATAGTAGTAGTGG - Exonic
931915756 2:66953760-66953782 GGTAAAAATAGTAGTAGTCATGG + Intergenic
933043321 2:77498720-77498742 TGCCACAATAGTAGTACTATAGG - Intronic
933836053 2:86246432-86246454 GTGGACTATAGTAATAGTATTGG + Intronic
937102031 2:119279086-119279108 GGGAACAACATTGGCAGTATTGG - Intergenic
938822362 2:134972241-134972263 GGGAATGATAGTAGGAGGATAGG - Intronic
945145110 2:206729831-206729853 GTGAAAAATAGTAGTAGGAGAGG + Intergenic
948471785 2:238186615-238186637 GGGAATAAGAGTAGTAAGATAGG - Intronic
1172114916 20:32568070-32568092 GGTAACAATAGTGGTATTAATGG - Intronic
1174937807 20:54891188-54891210 GAGAATAATAGTAATTGTATCGG + Intergenic
1175639372 20:60614697-60614719 GGGAACAATAGTAGTCCTAAAGG - Intergenic
955084106 3:55686113-55686135 AGGAACAGTAGTAGTGATATTGG - Intronic
957276394 3:78095687-78095709 AGGAAAAAAAGTAGTAGTAAAGG - Intergenic
959181533 3:102986416-102986438 GGGAACACTAGTAGTAGACATGG - Intergenic
963201448 3:142590524-142590546 GGCAAAAATAGTAGTAGTTGGGG - Intergenic
963492614 3:146019693-146019715 GGGAAAAATAATATTAGTTTTGG - Intergenic
963654387 3:148026243-148026265 GGAAACAAGAGTGGTAGAATGGG + Intergenic
963788244 3:149557026-149557048 GGGAACACTAGGAGTTTTATGGG - Intronic
964335269 3:155648206-155648228 GGGAACAATAGTAGTAGTATTGG + Intronic
966542105 3:181103243-181103265 GGGAACAATGTTAGAAGTGTCGG + Intergenic
966627425 3:182033418-182033440 GGGAAGATTTGAAGTAGTATGGG - Intergenic
967049813 3:185772546-185772568 GGGAAGAAAAGGAGTTGTATAGG - Intronic
969529798 4:7724344-7724366 GGTAACAGTAGTGGTAGTAATGG + Intronic
971890212 4:32510479-32510501 GGTAACAATAGTACTAATTTTGG - Intergenic
972028647 4:34422196-34422218 AGGAACATTAGTAATTGTATTGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978490525 4:109306662-109306684 GGTAACAATAGTACTAGTGGTGG - Intergenic
979930798 4:126627873-126627895 GGGAACATTAGTTCTAGGATCGG + Intergenic
979959801 4:127004126-127004148 AGAAACAATGGTAGTACTATGGG - Intergenic
983162184 4:164430038-164430060 GGGAACAGTAGCAGTAGTTGCGG + Intergenic
988736783 5:34030517-34030539 GGCAACAATAGTAGTAGTGGTGG - Intronic
993701916 5:91128664-91128686 GGAAAAAATAGTAATAGCATGGG + Intronic
996133360 5:119809245-119809267 GGGAACATCAGTGGTAGTCTGGG - Intergenic
1004059607 6:12179646-12179668 TGGAACAATAGTAGTCATAATGG - Intergenic
1007587658 6:43001542-43001564 GGAAATAATAGTAATAGTAGTGG + Intronic
1008417734 6:51262623-51262645 GGCAACAATATGAGTAGTTTTGG + Intergenic
1009328197 6:62380444-62380466 GGGAACAATAAGAAGAGTATGGG + Intergenic
1010407946 6:75526958-75526980 AGGCACAAAAATAGTAGTATTGG + Intergenic
1010726382 6:79338617-79338639 GGAAACAATAGTCGTGTTATGGG + Intergenic
1011296057 6:85827347-85827369 AGCATCAATAGTAGTAGTAGGGG - Intergenic
1012081948 6:94770155-94770177 AGGTACAATAGAAGTAGCATTGG + Intergenic
1014391046 6:120864846-120864868 GGGAAAAGTAGTAGCAGGATGGG + Intergenic
1016322330 6:142859145-142859167 GGGATCAAAAGTTATAGTATTGG - Intronic
1022581655 7:31561161-31561183 GGGAATGATAGTAGAAGAATTGG + Intronic
1023595258 7:41822835-41822857 GGGAAATATATTGGTAGTATGGG - Intergenic
1024099272 7:46013122-46013144 AGCAACAATAGTAATAATATTGG + Intergenic
1027628941 7:80578551-80578573 GGAAACAATAATAGTGGCATAGG - Intronic
1033112123 7:138589456-138589478 GGGAACAACAGTAGTAGTAATGG - Exonic
1033116608 7:138631467-138631489 GGGAAGAATAGTGGAAGGATGGG - Intronic
1034683442 7:152948707-152948729 GGTAACAACGGTAGTAGTAGTGG - Intergenic
1038560142 8:28569437-28569459 GGGAACAAGAGAATTAGTTTAGG + Exonic
1038568974 8:28643334-28643356 GGGAACAAAGGGAGTAGAATGGG - Intronic
1045677061 8:104618830-104618852 GGCAGCAATATTAGTAGCATGGG + Intronic
1049731915 8:144182591-144182613 GGGAAAAATAATAGAAGAATTGG + Intronic
1050709959 9:8450205-8450227 GGTAACAACAGTCTTAGTATTGG - Intronic
1059266315 9:113034749-113034771 GGCTAGAATAGTAGTTGTATGGG + Intergenic
1060114191 9:120928036-120928058 GGGAAAAATAGTACTACTTTTGG + Exonic
1060374500 9:123106379-123106401 GGGAAGAATAGTAGTAAAGTCGG + Intergenic
1190456034 X:50628560-50628582 GGGACTAATAGTAGTAGCATTGG - Intronic
1193140746 X:78024326-78024348 GAGAACATTAGTAGTTTTATAGG + Intronic
1194273150 X:91845513-91845535 GGAAACCATAGTAATGGTATAGG + Intronic
1194803203 X:98296596-98296618 AGCAATAATAGTAGTAATATAGG + Intergenic
1197587673 X:128369382-128369404 GGGAAGAATGGATGTAGTATAGG + Intergenic
1200590392 Y:5066911-5066933 GGAAACCATAGTAATGGTATAGG + Intronic