ID: 964344139

View in Genome Browser
Species Human (GRCh38)
Location 3:155738859-155738881
Sequence AAGGACCTCTTGAGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16701
Summary {0: 1, 1: 3, 2: 134, 3: 1992, 4: 14571}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964344134_964344139 2 Left 964344134 3:155738834-155738856 CCAGCTACTCAGGAGGCTGAGGG 0: 1034
1: 101354
2: 208048
3: 241971
4: 153021
Right 964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG 0: 1
1: 3
2: 134
3: 1992
4: 14571
964344132_964344139 3 Left 964344132 3:155738833-155738855 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG 0: 1
1: 3
2: 134
3: 1992
4: 14571
964344129_964344139 11 Left 964344129 3:155738825-155738847 CCCGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG 0: 1
1: 3
2: 134
3: 1992
4: 14571
964344130_964344139 10 Left 964344130 3:155738826-155738848 CCGTAGTCCCAGCTACTCAGGAG 0: 876
1: 2939
2: 4168
3: 4468
4: 3527
Right 964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG 0: 1
1: 3
2: 134
3: 1992
4: 14571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964344139 Original CRISPR AAGGACCTCTTGAGCCCTGG AGG Intronic
Too many off-targets to display for this crispr