ID: 964356195

View in Genome Browser
Species Human (GRCh38)
Location 3:155854077-155854099
Sequence GTCGCGCTGGACCAGGGTTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964356188_964356195 -3 Left 964356188 3:155854057-155854079 CCAGTCCCAGGTCCAAGGCTGTC 0: 1
1: 0
2: 0
3: 23
4: 236
Right 964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG 0: 1
1: 1
2: 0
3: 4
4: 53
964356189_964356195 -8 Left 964356189 3:155854062-155854084 CCCAGGTCCAAGGCTGTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG 0: 1
1: 1
2: 0
3: 4
4: 53
964356187_964356195 1 Left 964356187 3:155854053-155854075 CCGTCCAGTCCCAGGTCCAAGGC 0: 1
1: 0
2: 0
3: 22
4: 315
Right 964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG 0: 1
1: 1
2: 0
3: 4
4: 53
964356184_964356195 22 Left 964356184 3:155854032-155854054 CCGAGGCTGAGCGTTTTGGATCC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG 0: 1
1: 1
2: 0
3: 4
4: 53
964356190_964356195 -9 Left 964356190 3:155854063-155854085 CCAGGTCCAAGGCTGTCGCGCTG 0: 1
1: 0
2: 1
3: 4
4: 65
Right 964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG 0: 1
1: 1
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964356195 Original CRISPR GTCGCGCTGGACCAGGGTTT CGG Exonic
902806576 1:18864916-18864938 GCAGAGCTGGACCAGGATTTTGG - Intronic
904814034 1:33181964-33181986 GTCGCGCTGGGCCAGGGTTTGGG - Intronic
906719713 1:47996617-47996639 GTCCCGTGGGACCATGGTTTGGG - Intronic
908270383 1:62416284-62416306 GTCGCGCTGGAGCCCGGTATTGG + Intergenic
914331600 1:146676443-146676465 GTGGCGCCAGACCAGGATTTTGG + Intergenic
919098071 1:193060134-193060156 GTCGCCCGGGATCTGGGTTTTGG + Exonic
922559452 1:226558578-226558600 CTCGCACAGGCCCAGGGTTTGGG - Intronic
1073607962 10:104914996-104915018 GTCTCTGTGGGCCAGGGTTTGGG + Intronic
1073725935 10:106230888-106230910 GTTGCGCTGGGACAGGTTTTAGG + Intergenic
1075312455 10:121426081-121426103 GGTGCTCTGGACCAAGGTTTTGG - Intergenic
1079304456 11:19310011-19310033 GCCTGGCTGGACCAGGGGTTGGG + Intergenic
1081691003 11:45078477-45078499 GTCGGGATGAACCAGGGTGTAGG - Intergenic
1083933222 11:65857335-65857357 GCCTCGCTGGCCCAGGGCTTCGG + Intronic
1089326645 11:117661960-117661982 GTCTCGCTGACCCAGAGTTTGGG - Intronic
1100218869 12:92482354-92482376 GTCTTGCTGGACCAGGGTCTTGG - Intergenic
1108809050 13:54198188-54198210 GTTGCCTTGGACCAGGTTTTTGG - Intergenic
1115620750 14:35137720-35137742 GTAGCGTTGGTCCAGAGTTTGGG + Intronic
1120335547 14:83149808-83149830 GTCAAGCTGGACCAGTATTTGGG + Intergenic
1121582226 14:95039689-95039711 ATCCCCCAGGACCAGGGTTTTGG - Intergenic
1131153524 15:90061570-90061592 GTCGTGCGAGACCAGGTTTTGGG + Intronic
1133098881 16:3467108-3467130 GAGGAGCTGGACCAGGGGTTGGG + Intronic
1137267419 16:46880673-46880695 GTTGGCCTGGACCAGGGTGTGGG - Intergenic
1140001955 16:71034457-71034479 GTGGCGCCAGACCAGGATTTTGG - Intronic
1142150818 16:88511880-88511902 ATCTCCCTGGACCAGGGTTCAGG - Intronic
1144788824 17:17846375-17846397 GTCTGGCTGGACCAGGGCCTGGG + Intronic
1152945672 17:83196195-83196217 GTCCCCCTGGACCTTGGTTTGGG + Intergenic
1155983972 18:32210071-32210093 TTGGAGCTGGACCAGGGTTTTGG + Intronic
1161395279 19:4042228-4042250 CACGCGCTGGAGCAGGGTTGGGG - Intergenic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166298788 19:41902742-41902764 GTTGCGATGGCCCAGGCTTTGGG - Intronic
1166630352 19:44401197-44401219 GGGGCGCTGGCTCAGGGTTTTGG - Intronic
927025271 2:19062388-19062410 GTGGCCATGGACCAGAGTTTTGG + Intergenic
928610513 2:32987422-32987444 GTCACTCTGGGCCAGGTTTTAGG + Intronic
932599170 2:73112371-73112393 GTGGCGCTGGACGAGGTCTTCGG - Exonic
936147135 2:109987463-109987485 GTCGGGCTGGACAGGGGTCTCGG + Intergenic
936197557 2:110384020-110384042 GTCGGGCTGGACAGGGGTCTCGG - Intergenic
938543387 2:132305160-132305182 GGGGCGCTGGCTCAGGGTTTGGG + Intergenic
942423511 2:175834534-175834556 GTCTGGTGGGACCAGGGTTTGGG - Intergenic
1168897869 20:1336424-1336446 GTCGGGAGAGACCAGGGTTTGGG - Intronic
1173219445 20:41119981-41120003 CTCGCTCTGGAACCGGGTTTGGG + Intronic
1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG + Intergenic
1179885403 21:44312172-44312194 GCCGTGCTGGACCAGGTTGTAGG - Exonic
952201822 3:31137155-31137177 GTGGCGCTGTACCAGTGTCTGGG - Intergenic
964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG + Exonic
974292001 4:59944826-59944848 GTAGGCCTGGCCCAGGGTTTAGG - Intergenic
985558200 5:568442-568464 GTCGCGATGACCCAGGGTTTAGG - Intergenic
994176974 5:96721514-96721536 GTGGCTCTGGACCAGGCATTAGG + Intronic
1000385565 5:160671844-160671866 GTCGGGCTGGACCCAGGTTCAGG - Intronic
1001581043 5:172798749-172798771 CACTCCCTGGACCAGGGTTTGGG - Intergenic
1003452294 6:6246024-6246046 GTCGCCCTGCAACAGGGTTCTGG + Intronic
1007324010 6:41046706-41046728 GTCGTGCTAGCCCAGGGCTTGGG - Intronic
1013643837 6:112115908-112115930 GTGGCCGTGGACCAGGGTTCCGG + Exonic
1020711649 7:11613706-11613728 GTGGCGCTGTGCCAGAGTTTAGG - Intronic
1042611876 8:70608545-70608567 TTCGCGCCGGGCCCGGGTTTGGG + Intergenic
1060235577 9:121860341-121860363 GTCCCGCTGGTCCAGGGTCATGG + Exonic
1061828999 9:133278665-133278687 GTCTCCCTGGACCTGGGTTTGGG - Intergenic
1186076638 X:5886850-5886872 GACGGGCTGGTCAAGGGTTTGGG - Intronic
1194723169 X:97364328-97364350 GGTGGGCTGGATCAGGGTTTTGG - Intronic