ID: 964356217

View in Genome Browser
Species Human (GRCh38)
Location 3:155854188-155854210
Sequence CTAGAGGCCCAGAGGATGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964356210_964356217 10 Left 964356210 3:155854155-155854177 CCGGAGTGCTGAAGCCGGGAGCC 0: 1
1: 0
2: 0
3: 18
4: 166
Right 964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG 0: 1
1: 0
2: 3
3: 29
4: 267
964356212_964356217 -4 Left 964356212 3:155854169-155854191 CCGGGAGCCAGTCCTCTGGCTAG 0: 1
1: 0
2: 1
3: 19
4: 194
Right 964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG 0: 1
1: 0
2: 3
3: 29
4: 267
964356209_964356217 11 Left 964356209 3:155854154-155854176 CCCGGAGTGCTGAAGCCGGGAGC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG 0: 1
1: 0
2: 3
3: 29
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964356217 Original CRISPR CTAGAGGCCCAGAGGATGCC TGG Exonic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900419631 1:2550225-2550247 AAAGAGGCTCAGAGGAGGCCCGG - Intergenic
900425593 1:2577045-2577067 AAAGAGGCTCAGAGGAGGCCCGG + Intergenic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900784011 1:4636393-4636415 GCAGATGCCCAGAGGCTGCCTGG - Intergenic
901145639 1:7062773-7062795 CTGGAGCCCCAGCGGAAGCCTGG - Intronic
902374344 1:16023255-16023277 CTGGGGACCCAGAGGATACCTGG + Intronic
902379299 1:16045133-16045155 CTGGGGACCCAGAGGATACCTGG + Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903358581 1:22763020-22763042 CTCGAGGCCCAGAGAGTGCTGGG + Intronic
903700014 1:25240000-25240022 CTAGAGGAGGAGACGATGCCAGG + Intergenic
904697455 1:32338233-32338255 CCAGAGCCCCAGAGGGAGCCTGG + Intergenic
905280932 1:36849096-36849118 CTGGATGCCGACAGGATGCCTGG + Intronic
905884813 1:41485893-41485915 CCAGAGCCCCAGAGGAGGCAGGG + Intergenic
906518336 1:46452657-46452679 CGGGAGGCCCAGAGGAGGCCAGG - Intergenic
906695550 1:47820997-47821019 ACAGATGCCCAGAGGATGCAAGG - Intronic
907451213 1:54547151-54547173 CGAGAGGCCCTGAGGATGGAAGG + Intronic
908480656 1:64535803-64535825 CCAGAGGCCCAGAGGAAGCCAGG - Intronic
908923445 1:69224040-69224062 GTAGAGGCACAGAAGATGCAGGG + Intergenic
911187297 1:94916492-94916514 AGAGAGGCCCAGAGGATGACTGG - Intronic
913294751 1:117308458-117308480 TGAGAGGCCCAGGGAATGCCAGG + Intergenic
913667622 1:121063154-121063176 CTAGAGACCAAGAGGATGTTGGG + Intergenic
914019313 1:143850297-143850319 CTAGAGACCAAGAGGATGTTGGG + Intergenic
914657864 1:149758504-149758526 CTAGAGACCAAGAGGATGTTGGG + Intergenic
914987128 1:152470767-152470789 GTAGAGGCCCAGTGGGTGTCTGG + Intergenic
915340697 1:155175163-155175185 CTAAAGGCCCAGAGGAGGGACGG - Intronic
915768449 1:158391939-158391961 CTTGAAGCCTAGAGCATGCCTGG + Intergenic
916890294 1:169106750-169106772 CGAGCGGCGCAGAGGACGCCAGG + Exonic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918519940 1:185404335-185404357 CTGGAAGTCGAGAGGATGCCGGG + Intergenic
919780415 1:201217310-201217332 CTGGAGGCCGACAGGATGGCTGG - Exonic
924076171 1:240339448-240339470 CTAGATCCCCAGTGGATGCTTGG - Intronic
1063629522 10:7720986-7721008 CCAGAGGCCCTGTGAATGCCTGG - Intronic
1064125413 10:12655692-12655714 CTAGAGGTCCAGCTGAGGCCTGG - Intronic
1065123917 10:22554805-22554827 CTAGACGCACAGAGGAGGACGGG - Intronic
1065747703 10:28857306-28857328 CTAGAGGCAGAGAAGATGCGGGG - Intronic
1067408532 10:46045025-46045047 CGAGTGGCCCAGAGGAGGCCCGG + Intronic
1067554796 10:47261282-47261304 CTAGAGGCCTACAGGAAGTCAGG - Intergenic
1068798671 10:61114348-61114370 ATAGTGACCCAGAGGGTGCCTGG + Intergenic
1070730882 10:78827440-78827462 CGGCAGGCCCAGAGGATTCCAGG + Intergenic
1072537093 10:96371942-96371964 CTCCAGGCCCAGAGGATGAGAGG - Intronic
1073283968 10:102376118-102376140 CCAGAGGGCCAAAGGATGGCCGG - Intronic
1074669886 10:115778272-115778294 CTAGATGACAAGAGTATGCCAGG + Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1076883048 10:133248724-133248746 GAAGAGGCCCAGAGGAGGCCAGG + Intergenic
1077176255 11:1192320-1192342 CGAGACCCCCAGAGGCTGCCCGG + Intronic
1077231506 11:1459946-1459968 CATGAGGCCCAGTGGATGACAGG - Intronic
1077371022 11:2181710-2181732 ACAGAGGCCCAGAAGATCCCGGG - Intergenic
1077488377 11:2849470-2849492 ATAGAGGCCCGGAGGAGGCCAGG - Intergenic
1077504417 11:2923522-2923544 CTAGAGGCCCGGATGTGGCCGGG + Intronic
1079443992 11:20543173-20543195 CTACAGGACCACATGATGCCCGG - Intergenic
1079680691 11:23293762-23293784 CCAGAGGCCAAGCAGATGCCAGG - Intergenic
1081585760 11:44382533-44382555 ACAGAGGCCCAGAGGAGGTCGGG - Intergenic
1082928699 11:58578328-58578350 CCAGAGGTGGAGAGGATGCCGGG - Intergenic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1085083970 11:73654734-73654756 CTAAGGGCCCAGAGTCTGCCTGG + Intronic
1085465658 11:76721728-76721750 CCAGAGGCTCAGCGGAAGCCAGG - Intergenic
1085772282 11:79336302-79336324 CTAGAGGCCTGGAGGAGGACAGG - Intronic
1086450143 11:86907539-86907561 CTAGAGCCCAAGAGGCTGCAGGG - Intronic
1088318433 11:108530748-108530770 CTAAAGGGCCAGAGGGTGCCTGG + Intronic
1089327087 11:117664761-117664783 CTAGAGGCTCTGAGAATGCTAGG - Intronic
1091565572 12:1645728-1645750 GAAGAGGCCCAGAGGGTGGCTGG - Intronic
1092961435 12:13600097-13600119 TTAGAGGACCAGAGGCTTCCTGG - Intronic
1095955459 12:47803229-47803251 CAGGAGACCCAGAGGCTGCCTGG + Intronic
1097630962 12:62061937-62061959 CAAGAGGCCCAGGGGAGGCTCGG + Intronic
1098209214 12:68145129-68145151 CTAGAGGTTCAGAGGAGGTCAGG - Intergenic
1099202196 12:79690318-79690340 CCTGCGGCCCCGAGGATGCCAGG + Exonic
1101503886 12:105329583-105329605 ATAGAGTCCCAGAGGATGCTGGG - Intronic
1101749382 12:107570870-107570892 ACAGAGGCCCAGAGGAAGCCTGG - Intronic
1102130366 12:110523968-110523990 ACAGAGGCACAGAGGATGGCAGG - Intronic
1102899815 12:116627577-116627599 CCAGTGGTCCAAAGGATGCCAGG + Intergenic
1103795879 12:123502860-123502882 TTAGAGGTCCAGAGGAAGCATGG - Intronic
1103935623 12:124475011-124475033 ACAGAGGCCCTGAGGATGGCAGG - Intronic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1104849289 12:131863565-131863587 CTATAGGTCCAGAGGTTGCCTGG + Intergenic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1105895728 13:24716070-24716092 CTAGAGGCCCAGTGACTTCCTGG + Intergenic
1106594355 13:31123853-31123875 CTAGAGGCATAGAGGAGACCAGG + Intergenic
1107349498 13:39499457-39499479 AAAGAGGCGCTGAGGATGCCTGG - Intronic
1107964131 13:45584560-45584582 CCAGATCCCCAGAGGATGCTTGG - Intronic
1110375831 13:74793099-74793121 CAAGAAGCTCAGAGAATGCCTGG - Intergenic
1113005358 13:105695843-105695865 CAAGACTCCCAGTGGATGCCTGG - Intergenic
1113150457 13:107257663-107257685 CTGGAGGCCCTGAGGTGGCCAGG + Intronic
1113496758 13:110736832-110736854 CATGAGGACCAGAGAATGCCTGG - Intergenic
1113521659 13:110946213-110946235 CAAGAGGCCCAGAGAGGGCCAGG + Intergenic
1113656842 13:112072835-112072857 CCCGAGGCCCCGAGGAGGCCCGG - Intergenic
1114755852 14:25258989-25259011 CAACACGCCCAGTGGATGCCTGG + Intergenic
1115754092 14:36516715-36516737 CTAGGCGGCCAGAGGGTGCCGGG + Exonic
1116083892 14:40209573-40209595 CTAGAGGCTCAGAGAACACCAGG + Intergenic
1119434548 14:74589518-74589540 CTAGAGGCCTGGAGCCTGCCAGG - Intronic
1119483602 14:74974679-74974701 CTACAGGCCCAGGGGCAGCCTGG - Intergenic
1122006797 14:98711959-98711981 CTAGGGCCCAAGAGGGTGCCGGG - Intronic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122918531 14:104869930-104869952 CAAGAGGATCAGAGGACGCCTGG - Intronic
1125888957 15:43251637-43251659 CAAGAGGCCGAGAGCAGGCCTGG + Intronic
1126249925 15:46555496-46555518 ATAGAGGTCCAGAGGAGGCTAGG - Intergenic
1127957005 15:63862577-63862599 CTAGAGGCACAGGGGTTTCCTGG - Intergenic
1129300271 15:74621396-74621418 CGACTGGCCCAGAGGATCCCAGG + Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131601712 15:93855882-93855904 TTAGAGGCTCAGAGTATCCCAGG - Intergenic
1132889774 16:2197732-2197754 CCAGCTGCCCACAGGATGCCGGG - Intergenic
1133052257 16:3123963-3123985 CGAGAAGCCCCGAGGAAGCCAGG - Intergenic
1133247100 16:4456140-4456162 GTAGAGGCCCAGAGAGTCCCTGG + Exonic
1136029463 16:27492195-27492217 CCAGAGGCCCAGAGCACCCCTGG - Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1137793544 16:51195717-51195739 GTAGATGCCCAGCAGATGCCTGG + Intergenic
1138132516 16:54493028-54493050 CAAGAAGCCCAGAGGTTTCCAGG + Intergenic
1138561488 16:57803237-57803259 CTAGAGCCTCAGAAGAGGCCTGG + Intronic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1140205539 16:72929624-72929646 CTCTTGCCCCAGAGGATGCCTGG + Intronic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1141147961 16:81545079-81545101 CTAGACTCCTAGAAGATGCCAGG + Intronic
1141386467 16:83626267-83626289 CTAGAGGCCCCGAGGAATGCAGG + Intronic
1141641680 16:85345096-85345118 CTAGAAGCAGAGAGGAGGCCTGG - Intergenic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1145003733 17:19323269-19323291 GGAGAGGCCCAGAAGATGCCAGG + Intronic
1147224660 17:38967405-38967427 CTAGAGGCCGCGGGGACGCCTGG - Intergenic
1147738110 17:42653726-42653748 CAAGAAGCCCAGAGGATTCTGGG + Intergenic
1148163813 17:45468412-45468434 CTTGAGTTCCAGAGGCTGCCTGG + Exonic
1148677295 17:49452734-49452756 AGAGAGGCCAAGAGGATGCTGGG - Intronic
1148677508 17:49453740-49453762 AGAGAGGCCAAGAGGATGCTGGG - Intronic
1150395043 17:64815066-64815088 CTTGAGTTCCAGAGGCTGCCTGG + Intergenic
1151801000 17:76379752-76379774 CCAGAGGCCCAGAAGAGACCTGG + Intronic
1152170857 17:78747204-78747226 CTGAAGGCCCAGAGTATGCCAGG + Intronic
1152192950 17:78899559-78899581 CTCTAGGCCCAGAGATTGCCAGG - Intronic
1152319878 17:79602807-79602829 CTATAGGCTCAGAGGAGCCCGGG + Intergenic
1153754080 18:8262498-8262520 CTGGAGGCCTGGAGGATGGCAGG - Intronic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1156016658 18:32554090-32554112 CTAAAGGCACAAAGTATGCCGGG + Intergenic
1160595324 18:79969462-79969484 CTGGAGGTTCAGAGGATCCCTGG - Intronic
1160736001 19:662729-662751 CGAGAGGCCGCGAGGATCCCAGG - Intronic
1160829208 19:1095112-1095134 CGGGAGGCCCAGAGGTCGCCGGG - Intronic
1160965209 19:1744441-1744463 CTGGAGGCCAGGAGGAGGCCGGG - Intergenic
1161196924 19:2992014-2992036 TCTGAGGACCAGAGGATGCCTGG - Intronic
1161258960 19:3325117-3325139 CTAGAGGCCCTGAGAAGGCTAGG - Intergenic
1161339607 19:3734010-3734032 CTAGAGGCTCAGAGAGTGACAGG + Intronic
1161415881 19:4146019-4146041 CGTGACGCCCAGCGGATGCCCGG - Intergenic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1163540029 19:17902977-17902999 GCAGAAGCCCAGAGGATACCCGG - Intergenic
1163795498 19:19335505-19335527 ATAGAGCCCCAGTGGGTGCCTGG - Intronic
1164616230 19:29668276-29668298 CTCAGGGCCCAGAGGCTGCCAGG + Intronic
1164752592 19:30667706-30667728 CTGGAAGCCCAGAGCATGTCAGG + Intronic
1167047957 19:47062268-47062290 CTAGAGCCTCAGAGGCAGCCTGG + Intergenic
1167868572 19:52348698-52348720 CAAGATGCCCAGTGGATGCCTGG - Intronic
1168287018 19:55340192-55340214 GGAGAGGCCCTGAGGATGCAGGG - Intronic
1168338944 19:55613052-55613074 CCAGAGGCCCCCAGGATGCTTGG + Intronic
1168654182 19:58115159-58115181 CTAGAGGGCCAGTTGATTCCAGG - Intronic
926103524 2:10136244-10136266 GTTGAGGCCCAGATGATACCAGG + Intergenic
926148584 2:10411897-10411919 CAACAGGCCCAGAGGAAGGCTGG - Intronic
926255154 2:11187456-11187478 CAAGACCCCCAGTGGATGCCTGG - Intronic
926920697 2:17937160-17937182 CTAGAAGCCAAGCAGATGCCAGG + Intronic
931785148 2:65611524-65611546 ATAGAGGCCCATGGGATGACTGG + Intergenic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
935111498 2:100098743-100098765 CTGGGGCCCCAGAGGATACCAGG - Intronic
935347399 2:102121269-102121291 CCAGAGGAACAGAAGATGCCTGG - Intronic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
936123470 2:109766421-109766443 CTGGGGCCCCAGAGGATACCAGG + Intergenic
936221215 2:110605043-110605065 CTGGGGCCCCAGAGGATACCAGG - Intergenic
937021637 2:118662340-118662362 CCAGCGGCCCAGAGGAAGTCAGG + Intergenic
937289328 2:120772586-120772608 CCATAGGCCCAGAGGTTCCCAGG + Intronic
938973997 2:136458312-136458334 CTAGAAGCCAAGCAGATGCCAGG - Intergenic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943306700 2:186271481-186271503 CAAGAACCCCAGTGGATGCCTGG + Intergenic
946327830 2:218993746-218993768 CCCGAGGCCCAGGGGAGGCCAGG - Intergenic
948370806 2:237487885-237487907 TTAGACGCCCAGAGGAAGCCAGG - Intronic
948886858 2:240888952-240888974 AGAAAGGCCCAGAGGATGCTGGG - Intronic
1169985708 20:11441578-11441600 CAAGACTCCCAGAGGATGACTGG + Intergenic
1170575910 20:17661354-17661376 TGGGAGGCCCAGAAGATGCCAGG + Intronic
1173159823 20:40644174-40644196 CTGGAGGCCCCTAGCATGCCAGG - Intergenic
1174176645 20:48649615-48649637 CCAAAGGCCCAGTGGATGCTGGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175857629 20:62131068-62131090 CTAGAGGAACCGGGGATGCCAGG + Intronic
1175948985 20:62572382-62572404 CTTGAGGCACAGAGCAAGCCTGG - Intergenic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1177762225 21:25414914-25414936 CCAGAAGCCCAGCAGATGCCAGG - Intergenic
1178394930 21:32234767-32234789 CTAGAAGCCCAGCAGATGGCCGG + Intergenic
1178454172 21:32731789-32731811 CTAGAGTCCCAAAGCAGGCCAGG + Intergenic
1178640358 21:34340305-34340327 CTCAAGGCAGAGAGGATGCCTGG - Intergenic
1179284273 21:39963242-39963264 CTGAGGACCCAGAGGATGCCAGG - Intergenic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1180734834 22:18008393-18008415 CTAATGGCCCCCAGGATGCCTGG + Intronic
1180945170 22:19688651-19688673 GCAGAGGCCCAGAGGCTGCCGGG + Intergenic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1182354334 22:29715588-29715610 GTGGAGGCCCAGAGGACGCCAGG + Intergenic
1182624039 22:31633161-31633183 CTAGAGGCTTTGAGGAGGCCAGG - Intronic
1183456867 22:37927622-37927644 CTAGTTCCCCAGAGGAGGCCAGG - Exonic
1184583855 22:45434643-45434665 CAAGAGGCCCAGTGGGAGCCTGG - Intergenic
1185007316 22:48288739-48288761 CAGGAGGCCCTGAGGACGCCCGG - Intergenic
952356704 3:32591531-32591553 GGAGAGGCCCAGATGATGCTGGG - Intergenic
953753752 3:45629704-45629726 CTGGATGGCGAGAGGATGCCAGG + Intronic
954623296 3:52007805-52007827 CCACAGGCCCACAGGGTGCCGGG + Intergenic
955863237 3:63354981-63355003 CTAAAGTCCCAGAGCAGGCCAGG + Intronic
956016465 3:64889074-64889096 ATAGAGTCACAGAGGCTGCCAGG + Intergenic
956710921 3:72038123-72038145 CCAGACCCCCAGTGGATGCCTGG + Intergenic
960144579 3:114186998-114187020 CTAGAGGCTCAAAAGTTGCCTGG + Intronic
961360553 3:126364690-126364712 CTCCAGGCCCAGCTGATGCCAGG + Intergenic
961714528 3:128849532-128849554 CTAGAGTCGCACAGGCTGCCTGG + Intergenic
961818001 3:129561238-129561260 CCCGAGACCCAGAGGATCCCGGG + Intronic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
964876444 3:161372835-161372857 CTCGAGGCCCAGGGGAGTCCGGG + Exonic
965922391 3:173933228-173933250 CTAGAAGCTCAGAGAATGGCAGG + Intronic
966152297 3:176877809-176877831 GTAGTGGCCCAGAGGTTCCCTGG + Intergenic
967085617 3:186092659-186092681 CTAGAGGATCATATGATGCCAGG - Intronic
969355186 4:6620937-6620959 CAAGAGGCCCACAGGAGTCCTGG + Intronic
969860714 4:10033541-10033563 CCAGATGCTCAGAGGAAGCCAGG - Intronic
970841994 4:20484531-20484553 CTAGAGACCCAGATCATGCATGG - Intronic
972245538 4:37243299-37243321 GTGCAGGCCCAGAGGAGGCCGGG + Intergenic
974620532 4:64347968-64347990 CTAGAGGCTCAGAAGAAGACAGG - Intronic
974715243 4:65660992-65661014 GTAGAGGAGCAGAGGAAGCCTGG - Intronic
976768201 4:88620735-88620757 CCAGAGGAACAGAGTATGCCAGG - Intronic
979715223 4:123829639-123829661 CTATAGGTTCAGAGGATGCATGG + Intergenic
980406618 4:132361141-132361163 CTAGAAGCACAGCAGATGCCTGG + Intergenic
984685221 4:182659480-182659502 CAAGATCCCCAGTGGATGCCTGG - Intronic
987306439 5:16642089-16642111 CTAAAGGACCAGAAGATGCAGGG - Intergenic
992211524 5:74484293-74484315 CAAGATCCCCAGAGAATGCCCGG - Intergenic
992268998 5:75046747-75046769 CTAGAAGCACAGAGGATTCCTGG + Intergenic
992500276 5:77335456-77335478 CCAGAGGCCCAGGGAAAGCCAGG + Intronic
995355907 5:111237640-111237662 CTAGAGGGGTAGAGGAAGCCAGG - Intronic
997234704 5:132266058-132266080 GTAGATGCCCAGAGGATGCGTGG + Intronic
997359123 5:133283210-133283232 TTAAAGGCCCAGAGGACCCCAGG - Intronic
999393803 5:151213882-151213904 CTACATGCTCAGAGGAAGCCAGG - Intronic
999443621 5:151621524-151621546 CCAGAGCCCCACAGGATCCCCGG + Intergenic
999961707 5:156763023-156763045 ACACAGGCTCAGAGGATGCCTGG + Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1001796872 5:174509683-174509705 CTAGATGTCCAGTGGATGTCTGG - Intergenic
1002333447 5:178461385-178461407 CTAGAGGCACTGGGGATGGCAGG - Intronic
1003338229 6:5195196-5195218 CTAGAGACCTGGAGGGTGCCAGG + Intronic
1003570617 6:7254180-7254202 TTACAGGGCCAGAGGAGGCCAGG - Intergenic
1005126399 6:22451228-22451250 CTAGAAGCCCAGTGGATGCCAGG - Intergenic
1005686628 6:28259322-28259344 CTACAGACCCAGAGGCTGGCTGG - Exonic
1007369839 6:41419479-41419501 AGAGAGGCCCTGAGGATGCCTGG + Intergenic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1017723334 6:157259399-157259421 CAAGAGGCCCACAGGAGCCCTGG + Intergenic
1018111278 6:160539037-160539059 CTAGAGTGTCAGAGGATTCCAGG + Intronic
1018178044 6:161196016-161196038 CTAGAGCCCCTGAAGGTGCCAGG + Intronic
1018433937 6:163744515-163744537 CTGCAGGTCCTGAGGATGCCCGG + Intergenic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018681980 6:166271949-166271971 CAAGAGGCCCACAGGAGACCTGG + Intergenic
1018924830 6:168198715-168198737 CTAAACTCCCAGAGGATGCCTGG - Intergenic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019306384 7:337268-337290 ACAGAGGCCAGGAGGATGCCTGG - Intergenic
1019348976 7:544350-544372 CTTCAGGCCCACAGGATGCTGGG + Intergenic
1019467857 7:1200182-1200204 CTCGAGGCCAAGTGGAGGCCGGG - Intergenic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1020069461 7:5216559-5216581 CTAGAGGCTGATAGTATGCCTGG + Exonic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1020430558 7:8112814-8112836 CTAGAGGCCCAGAGTAGGGGTGG - Intergenic
1024410656 7:49037535-49037557 CAAGAGGGCCAGTGGATGGCAGG + Intergenic
1026506821 7:70991802-70991824 TTAGAGGCCAAGAAGATGCTAGG - Intergenic
1026781059 7:73267774-73267796 CAAGACCCCCAGTGGATGCCTGG - Intergenic
1029490276 7:100866874-100866896 CCAGAGTCACAGAGGAGGCCTGG - Exonic
1034236026 7:149570220-149570242 CCAGAGGCTCAGCAGATGCCCGG - Intergenic
1034432660 7:151048896-151048918 CCTCAGGCCCAGAGGAGGCCCGG + Exonic
1034746817 7:153530238-153530260 CTAGAAGCGCAGAGGCTTCCAGG + Intergenic
1035302212 7:157904934-157904956 CCTGAGACCCACAGGATGCCGGG - Intronic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1035568611 8:658311-658333 CGGGAGGCCCAGTGGAGGCCAGG - Intronic
1036041543 8:5087789-5087811 CGAGAGGACAAGAGGGTGCCAGG + Intergenic
1036429834 8:8679821-8679843 TTAGAGGCTCAGAGGAAGCGCGG + Intergenic
1036572987 8:9998074-9998096 CTTGACCCCCAGAGGACGCCAGG - Intergenic
1036785360 8:11681863-11681885 CTGAAGGCGCAGAGTATGCCAGG - Intronic
1042838700 8:73101902-73101924 CAAGAGTCACAGAGGATGCAGGG + Intronic
1043109529 8:76161701-76161723 CAAGATGTCCAGGGGATGCCTGG - Intergenic
1044609036 8:94073890-94073912 TTAGAGGCTAAGAGGATGGCAGG - Intergenic
1045339176 8:101236495-101236517 CTAGCAGCCCAGAGGATACTCGG + Intergenic
1045371621 8:101529822-101529844 CCACAGGCTCTGAGGATGCCTGG + Intronic
1047335960 8:123936556-123936578 CTGGAGGACCAGAAAATGCCAGG - Intronic
1047448138 8:124938013-124938035 TCAGAGGCCCAGAGCAGGCCAGG - Intergenic
1047622304 8:126620431-126620453 ATAACGGCCCAGAAGATGCCTGG - Intergenic
1047647488 8:126884028-126884050 CTTGAGGGTCAGAGGATGGCAGG + Intergenic
1048329143 8:133460494-133460516 CTAGTGGCCCTGAGGGCGCCTGG - Intronic
1048386633 8:133918365-133918387 CTAGGGGTTCAGTGGATGCCTGG - Intergenic
1050574355 9:6977659-6977681 CTGGAGGCCCAGCAGATGACAGG - Intronic
1052306518 9:27016156-27016178 CTAGAGTCTCAGAGGAAGCATGG - Intronic
1056432313 9:86540131-86540153 TTAGAGGGCCAGAGGATGCTAGG - Intergenic
1059776441 9:117480104-117480126 CCAGAGGTCCAGAGCATCCCAGG + Intergenic
1060541066 9:124430567-124430589 CTAGAGTCCAGAAGGATGCCAGG + Intergenic
1061412366 9:130428525-130428547 CTGGAAACCCAGAGGTTGCCAGG + Intronic
1062333878 9:136056504-136056526 CAAGAGCCAGAGAGGATGCCTGG + Intronic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1062495637 9:136830329-136830351 GCAGAGGCCCAGAGCATGGCTGG - Intronic
1062635345 9:137487687-137487709 CCAGAGGAGCAGAGGCTGCCAGG - Intronic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1186103902 X:6185445-6185467 CTACAGGTCCACAGCATGCCAGG + Intronic
1188430081 X:30096774-30096796 TTTGAGGTCAAGAGGATGCCAGG - Intergenic
1189962187 X:46334095-46334117 CAAGAAGCCCAAAGAATGCCTGG + Intergenic
1190258444 X:48782834-48782856 CTAGAACCCCAGAAGATGCCAGG + Intergenic
1192477443 X:71455130-71455152 CCCGAGACCCAGAGGATGGCTGG - Intronic
1198517900 X:137427394-137427416 CTAGAGGCCCAGAGGCTAGGAGG + Intergenic
1200088835 X:153625010-153625032 TAAGGGGCTCAGAGGATGCCTGG + Intergenic
1201367695 Y:13226592-13226614 CAAGAAGCCCAGAGAATTCCTGG - Intergenic