ID: 964356231

View in Genome Browser
Species Human (GRCh38)
Location 3:155854241-155854263
Sequence GCTGCCCGGGGGTCTCCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964356231_964356244 23 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356244 3:155854287-155854309 TGTGTGCCGTGGTGCCAGGATGG 0: 1
1: 1
2: 3
3: 16
4: 245
964356231_964356238 -7 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356238 3:155854257-155854279 GGGCAGCAGCGCCGGGCTCGAGG 0: 1
1: 0
2: 1
3: 24
4: 310
964356231_964356240 0 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356240 3:155854264-155854286 AGCGCCGGGCTCGAGGCTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 176
964356231_964356239 -3 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356239 3:155854261-155854283 AGCAGCGCCGGGCTCGAGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
964356231_964356242 12 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356242 3:155854276-155854298 GAGGCTGGAGGTGTGTGCCGTGG 0: 1
1: 1
2: 6
3: 40
4: 468
964356231_964356243 19 Left 964356231 3:155854241-155854263 CCTGAAGGAGACCCCCGGGCAGC 0: 1
1: 0
2: 4
3: 19
4: 122
Right 964356243 3:155854283-155854305 GAGGTGTGTGCCGTGGTGCCAGG 0: 1
1: 0
2: 15
3: 259
4: 2484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964356231 Original CRISPR GCTGCCCGGGGGTCTCCTTC AGG (reversed) Exonic