ID: 964356293

View in Genome Browser
Species Human (GRCh38)
Location 3:155854564-155854586
Sequence GGCTGCCGGAACCTTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964356282_964356293 17 Left 964356282 3:155854524-155854546 CCCAGTTCGGAAACAATGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 80
Right 964356293 3:155854564-155854586 GGCTGCCGGAACCTTCGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 82
964356284_964356293 16 Left 964356284 3:155854525-155854547 CCAGTTCGGAAACAATGCTTGGT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 964356293 3:155854564-155854586 GGCTGCCGGAACCTTCGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964356293 Original CRISPR GGCTGCCGGAACCTTCGGGG AGG Intergenic
900328998 1:2124563-2124585 GGATGACGGAACCTGCAGGGCGG - Intronic
902640477 1:17763392-17763414 GGATGCCAGCACCTCCGGGGAGG - Intronic
906141103 1:43533936-43533958 AGATGCCTGAACCTTAGGGGTGG - Intronic
913969314 1:143402466-143402488 GGCTGCCAGAGCCTTTGGGCAGG - Intergenic
914063691 1:144228065-144228087 GGCTGCCAGAGCCTTTGGGCAGG - Intergenic
914115459 1:144738289-144738311 GGCTGCCAGAGCCTTTGGGCAGG + Intergenic
915562072 1:156693241-156693263 GGCTGCCGGCCCCTTTGTGGCGG - Intergenic
919838781 1:201594401-201594423 GTCTGCAGGAACCTGCGGGAGGG + Intergenic
920903095 1:210132087-210132109 GGCTGCCAGAACCTTCTGCAGGG - Intronic
923106862 1:230861051-230861073 GGCTGCCAGAGCCTGGGGGGCGG + Intronic
1065101215 10:22334959-22334981 GCCTTCGGGAACCTTCAGGGTGG - Intergenic
1069943091 10:71968758-71968780 GGCTGCTGGAGCCTTCTGTGTGG + Intronic
1076741305 10:132487088-132487110 GGCTGCAGGAAGGTTGGGGGAGG - Intergenic
1076993893 11:289257-289279 GGCGGCCGGGAGCTGCGGGGCGG - Intronic
1084446391 11:69205937-69205959 GGCGGACGGAACATTCGGAGTGG + Intergenic
1084683624 11:70681128-70681150 GGCTGCCGGCACCTGCTGGGAGG + Intronic
1084774502 11:71366462-71366484 AGCTGCAGGAACATTCGAGGTGG + Intergenic
1086654616 11:89338095-89338117 GGTTGCCAAAGCCTTCGGGGAGG - Intronic
1090076128 11:123581070-123581092 GACTCCCGGAGCCTTCGCGGTGG + Intronic
1092897103 12:13022493-13022515 GGCTGCAGGTCCCTTTGGGGAGG + Intergenic
1096533827 12:52258397-52258419 GGCTGCCGAAGCCTCCGGTGAGG + Intronic
1099128284 12:78794172-78794194 TGCTTCCGGAGCCCTCGGGGCGG - Intergenic
1100444626 12:94649932-94649954 GGCCGCCGGGACGTTCGGCGGGG + Intronic
1100518280 12:95349492-95349514 GGCTGCCCGGACTTTCTGGGAGG - Intergenic
1103576050 12:121878004-121878026 GGCTGCCGGGCTCTGCGGGGAGG + Intergenic
1106041047 13:26093929-26093951 GGGAGCTGGAACCTTTGGGGAGG - Intergenic
1106157423 13:27171543-27171565 GGCTGCCGGGACCTCTCGGGCGG - Intronic
1106588857 13:31080955-31080977 GGCTGCCATAACCATCTGGGTGG - Intergenic
1108696659 13:52907843-52907865 GGCTGCCGGAGCCCTGGGGTTGG + Intergenic
1122779438 14:104137524-104137546 GGCTGCCGGCACATACGGTGAGG - Intergenic
1124653605 15:31489896-31489918 GGCTGCTGGACCCTTCTAGGTGG - Intronic
1125612738 15:40982997-40983019 TGCTTCCTGAACCTTTGGGGCGG + Exonic
1127638289 15:60891891-60891913 GGCTTCCCAAACCTTCAGGGTGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1138351711 16:56349469-56349491 GGCAGCCGGAGGCTTCTGGGAGG - Intronic
1139631924 16:68236292-68236314 GGCTCCGGGAACCTTGGGGGAGG + Exonic
1143056233 17:4164055-4164077 GGCTTCCAGCCCCTTCGGGGTGG - Intronic
1143531898 17:7510103-7510125 AGCTGCAGGAGCCTTGGGGGAGG - Intronic
1147200689 17:38799567-38799589 GGCGGACGGAACCACCGGGGCGG - Exonic
1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG + Exonic
1151829307 17:76540302-76540324 GGCTGCGTGAACCTTCAGCGGGG + Intronic
1152342406 17:79732525-79732547 CTCTGCTGGAACCTTCCGGGTGG - Intronic
1152586775 17:81192832-81192854 TGCTGCTGGAACCTGCGGGACGG + Exonic
1157279094 18:46334165-46334187 GGCTGCGGGAGCCGCCGGGGCGG - Intronic
1161111995 19:2475791-2475813 GGCGGCCCGGACTTTCGGGGGGG - Intergenic
1162463993 19:10830038-10830060 GGCTGCCAGAACCTGAGGTGGGG - Intronic
1164649118 19:29879447-29879469 GGCTGCTGGAAACTTCCGGAAGG + Intergenic
1165621430 19:37251869-37251891 GGCTCCCGGAAACGTGGGGGCGG - Intergenic
933764478 2:85697427-85697449 GGCTGCTGGAACCTGCAGGGTGG + Intronic
934174006 2:89563369-89563391 GGCTGCCAGAGCCTTTGGGCAGG - Intergenic
934284321 2:91637718-91637740 GGCTGCCAGAGCCTTTGGGCAGG - Intergenic
936118852 2:109724730-109724752 GGCTTCCTGAAGCTTCTGGGAGG - Intergenic
948958953 2:241316505-241316527 GTCTGCGGGTACCTTCGGCGAGG + Exonic
1171973480 20:31578951-31578973 GGCTCCCTCAGCCTTCGGGGAGG - Intergenic
1173165372 20:40683712-40683734 GGCTTCCGGAGCCTCCAGGGCGG - Intergenic
1173227470 20:41170276-41170298 TTCTGCTGGAACCTTCTGGGGGG + Intronic
1176241957 20:64079506-64079528 GGCTGCCAGATCCAGCGGGGTGG + Intronic
1179815724 21:43904758-43904780 GGCTGCAGGTCCCTTCTGGGTGG + Intronic
1179881520 21:44295082-44295104 TGCTGCAGGAGCCTCCGGGGGGG + Intronic
1185236485 22:49716534-49716556 GGCTCCCAGGACCTTTGGGGAGG + Intergenic
964356293 3:155854564-155854586 GGCTGCCGGAACCTTCGGGGAGG + Intergenic
966735777 3:183185988-183186010 AGCTGCTGGAAGCTTGGGGGAGG + Intronic
968668280 4:1833567-1833589 GACTGCCTGAGCCTTGGGGGAGG + Intronic
969136044 4:5029623-5029645 GTCTGCAGGAGCCGTCGGGGAGG - Intergenic
983378038 4:166954820-166954842 GGCTGCCTGGACCTGCGGGTGGG - Intronic
986736629 5:10673228-10673250 GGCTGCCGGCGCCTCCTGGGAGG + Intergenic
987050267 5:14143102-14143124 GGCTGCAGGAACGTTCGGTTTGG - Intergenic
992032847 5:72740563-72740585 GGTTGCCGGAGCCTCGGGGGAGG - Intergenic
996878984 5:128272058-128272080 GGCTGCCAGAACATCCTGGGTGG - Exonic
998478648 5:142442871-142442893 AGCTGCCAAAACCTTCTGGGTGG - Intergenic
1002795991 6:471335-471357 GGCTGACGGAAGCATCGGGCAGG - Intergenic
1010278432 6:73995679-73995701 GGCTGCCATGACCTTTGGGGAGG + Intergenic
1011852331 6:91645901-91645923 GGCTGCCAGGACCTGTGGGGAGG + Intergenic
1023382647 7:39623783-39623805 GGCTTCCGGAGCCCTCGGGGCGG + Exonic
1023519483 7:41036048-41036070 GGCTGCAAGATCCTTCAGGGAGG + Intergenic
1024483335 7:49888556-49888578 GGCTGCCTGAGGCTTCAGGGAGG - Intronic
1026542324 7:71290464-71290486 GGCTGTAGGAACCTTGGGGAGGG + Intronic
1034462193 7:151204237-151204259 GGCTTCAGGAACCTTGGCGGTGG - Intronic
1040552057 8:48445227-48445249 GGCTGCTGGGACCCTCAGGGAGG + Intergenic
1040764963 8:50897953-50897975 GGCTGCTGGAACCAGCGGGTGGG + Intergenic
1042805020 8:72761520-72761542 GATTGCTGGAACCTTCAGGGAGG + Intronic
1043748804 8:83909370-83909392 GTCTGTCGGAACCTACTGGGAGG - Intergenic
1045488787 8:102654645-102654667 AGCTGCCGGAAGCCACGGGGAGG - Intronic
1050381960 9:5040904-5040926 GGCTGCCGGCAGCGTCTGGGTGG - Intronic
1057692873 9:97302015-97302037 GTCTTCTGGAACCTTCGGTGTGG + Intergenic
1187040883 X:15594540-15594562 GGCTGCCTGATCCTTCAGGAAGG + Intronic
1199649626 X:149939267-149939289 GGCTGAGGGAACCGCCGGGGAGG + Intergenic