ID: 964358061

View in Genome Browser
Species Human (GRCh38)
Location 3:155868634-155868656
Sequence ACAGACTTGTTGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1028
Summary {0: 1, 1: 2, 2: 14, 3: 127, 4: 884}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964358061_964358067 26 Left 964358061 3:155868634-155868656 CCGCACCTGGCCAACAAGTCTGT 0: 1
1: 2
2: 14
3: 127
4: 884
Right 964358067 3:155868683-155868705 AGTAAGATGAGAAAAGGATTAGG 0: 1
1: 0
2: 4
3: 53
4: 479
964358061_964358064 0 Left 964358061 3:155868634-155868656 CCGCACCTGGCCAACAAGTCTGT 0: 1
1: 2
2: 14
3: 127
4: 884
Right 964358064 3:155868657-155868679 ATTTTTAAACAAGTGCTCCAAGG 0: 1
1: 0
2: 3
3: 43
4: 415
964358061_964358066 20 Left 964358061 3:155868634-155868656 CCGCACCTGGCCAACAAGTCTGT 0: 1
1: 2
2: 14
3: 127
4: 884
Right 964358066 3:155868677-155868699 AGGAAGAGTAAGATGAGAAAAGG 0: 1
1: 0
2: 8
3: 148
4: 1383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964358061 Original CRISPR ACAGACTTGTTGGCCAGGTG CGG (reversed) Intergenic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
900275716 1:1826124-1826146 ACTGACATTTAGGCCAGGTGTGG + Intronic
901544826 1:9948282-9948304 ATGGAGTTGTCGGCCAGGTGAGG + Intronic
902118803 1:14144006-14144028 GAAAACTAGTTGGCCAGGTGCGG - Intergenic
902324989 1:15694061-15694083 ACAGGTTTCTTGGCCAGGTGTGG + Intronic
902455559 1:16531335-16531357 AAAAACTTGTTGGCCGGGTGCGG - Intergenic
902496619 1:16876560-16876582 AAAAACTTGTTGGCCGGGTGCGG + Intronic
902840575 1:19071475-19071497 ACAGACTAGGTGCCCAGCTGAGG + Intergenic
902950145 1:19876071-19876093 ATAATTTTGTTGGCCAGGTGTGG + Intergenic
903019204 1:20381823-20381845 AGAGCCTTCTTGGCCAGGTGTGG - Intergenic
903123277 1:21230674-21230696 AAAGAATTCTTGGCCAGGCGTGG - Intronic
903123409 1:21231630-21231652 ATAGAGTTCTTGGCCAGGTACGG - Intronic
903491667 1:23733464-23733486 AAAGATTTATTGGCCAGGTGTGG + Intergenic
903547008 1:24130993-24131015 AAATCATTGTTGGCCAGGTGAGG - Intronic
903812127 1:26040537-26040559 ATATATTTATTGGCCAGGTGCGG - Intronic
903952200 1:27002446-27002468 ACATACATCTTGGCCAGGTGTGG + Intergenic
903982143 1:27196845-27196867 ACAGCTATGTGGGCCAGGTGTGG - Intergenic
904075021 1:27834722-27834744 CCATACATTTTGGCCAGGTGCGG + Intronic
904075231 1:27836706-27836728 AAAAACTTGCTGGCCGGGTGCGG - Intronic
904085065 1:27900400-27900422 AAAGAGCTGTTGGCCAGGTGCGG - Intronic
904098377 1:28000600-28000622 ACATATTTTCTGGCCAGGTGCGG - Intronic
904156540 1:28488026-28488048 AACAATTTGTTGGCCAGGTGTGG - Intronic
904635555 1:31878159-31878181 ACAGACTTTCTTGCCAGCTGAGG - Intergenic
905063156 1:35156892-35156914 ACAAACTAATTTGCCAGGTGTGG + Intergenic
905392451 1:37645991-37646013 AGTGAATTCTTGGCCAGGTGTGG - Intergenic
905593653 1:39186898-39186920 ACAGAAATGTGGCCCAGGTGTGG - Intronic
905612230 1:39363900-39363922 TGAGTCTTGTTGGCCAGGTGTGG - Intronic
905722697 1:40219954-40219976 ACAGAAGTACTGGCCAGGTGCGG + Intronic
905918048 1:41699518-41699540 ACAGAATTGCTGCCCAGGAGGGG + Intronic
906424214 1:45696488-45696510 ACAATCTTGTTAGCCTGGTGAGG + Intronic
907106619 1:51888588-51888610 ACAGTCTTAGAGGCCAGGTGTGG - Intergenic
907123900 1:52032725-52032747 AGAAACATGTTGGCCAGTTGCGG + Exonic
907466010 1:54637490-54637512 AAAGAGTTTTAGGCCAGGTGTGG + Exonic
907540132 1:55208335-55208357 ACAATAATGTTGGCCAGGTGCGG + Intronic
908197129 1:61756081-61756103 AAAAACTTGGTGGCCAGGTGCGG - Intronic
909442225 1:75710263-75710285 AGAGAGCTGTTGGCCAGGTACGG + Intergenic
909998493 1:82311586-82311608 ACAGACAGATGGGCCAGGTGCGG - Intergenic
910679620 1:89848986-89849008 ACAGGGTTATTGGCCAGGTACGG - Intronic
910691048 1:89966119-89966141 ACAAATCTGTTGGCCAGGCGCGG + Intergenic
910811332 1:91239822-91239844 ATAGCTTTATTGGCCAGGTGCGG - Intergenic
910943068 1:92558026-92558048 ACAGATTTTTTGGCCAGGCACGG - Intronic
911037301 1:93564566-93564588 AAAGACTTCTTGGCCAGGCACGG - Intronic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
911233586 1:95385705-95385727 AGTGACTTATGGGCCAGGTGTGG + Intergenic
912343992 1:108946871-108946893 ATAGAAATTTTGGCCAGGTGCGG + Intronic
912364949 1:109125672-109125694 ACAGACTGCTTGGCCGGGCGTGG - Intronic
912462006 1:109841019-109841041 ACAGAGTATTTGGCCAGGCGCGG + Intergenic
912782124 1:112560669-112560691 AAATACTTATTGGCCAGGCGCGG + Intronic
913454939 1:119020972-119020994 ACTGACTGGTGGGCCACGTGTGG - Intergenic
914797324 1:150931293-150931315 ACAGACATCCTGGCCAGGCGTGG + Intronic
914809895 1:151019789-151019811 ATAGAGTTGCAGGCCAGGTGTGG - Intronic
914896459 1:151679013-151679035 ACAGTGTTTGTGGCCAGGTGCGG - Intronic
915201584 1:154233611-154233633 TCAGGCTGGGTGGCCAGGTGCGG - Intronic
915258281 1:154653004-154653026 ACAGACTTGTGAGCCACCTGTGG - Intergenic
915451496 1:156008551-156008573 ACTAGCTTTTTGGCCAGGTGCGG - Intergenic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
916701731 1:167302545-167302567 AAGGAGTTGTTGGCCAGGCGCGG - Intronic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
916835534 1:168541090-168541112 ACAGACTTTTAGGCCACGTTTGG + Exonic
916839069 1:168581060-168581082 ACAGACTTTTAGGCCACGTTTGG - Exonic
916867727 1:168878374-168878396 ATAAAAGTGTTGGCCAGGTGTGG - Intergenic
916902467 1:169244340-169244362 ATTAAGTTGTTGGCCAGGTGCGG + Intronic
917456517 1:175190750-175190772 AAAGAATTATTGGCCAGATGGGG - Intronic
918000683 1:180492097-180492119 AAATAATTGCTGGCCAGGTGTGG - Intronic
918503348 1:185223469-185223491 AGAAAAGTGTTGGCCAGGTGCGG - Intronic
918595538 1:186288608-186288630 ACAAACTAGAGGGCCAGGTGCGG + Intergenic
919620545 1:199860387-199860409 ACCAACTCCTTGGCCAGGTGCGG - Intergenic
919645360 1:200089445-200089467 ACAAAGTTGCAGGCCAGGTGTGG - Intronic
919676742 1:200390858-200390880 AAAATTTTGTTGGCCAGGTGTGG - Intergenic
919720484 1:200828865-200828887 AAAAACTTATGGGCCAGGTGCGG + Intronic
919726760 1:200889706-200889728 AGAGCCTTGTGGGCTAGGTGAGG - Intergenic
919859431 1:201729614-201729636 TAACACTTGGTGGCCAGGTGCGG + Intronic
920083398 1:203394786-203394808 AAAGTCCTGTCGGCCAGGTGTGG + Intergenic
920109111 1:203574681-203574703 AAAGACTTGGGGGCCGGGTGTGG - Intergenic
920135089 1:203763168-203763190 ATACACTCCTTGGCCAGGTGCGG + Intergenic
920376538 1:205511761-205511783 AAACACATCTTGGCCAGGTGCGG + Intronic
920428575 1:205899059-205899081 ACACACATTTAGGCCAGGTGTGG - Intergenic
920759856 1:208772769-208772791 ATAGACTTGTTGGCTGGGTGTGG - Intergenic
920797474 1:209154533-209154555 ATAGAACTCTTGGCCAGGTGCGG + Intergenic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
921583757 1:216925146-216925168 AAAAACATGTTGGCCAAGTGTGG + Intronic
922113436 1:222585600-222585622 AACGTGTTGTTGGCCAGGTGTGG - Intronic
922282530 1:224139796-224139818 ACATACATTTTGGCCAGGCGTGG + Intronic
922480034 1:225933753-225933775 ACAAAAGAGTTGGCCAGGTGTGG - Intergenic
922617446 1:226970241-226970263 ACACACATGAGGGCCAGGTGCGG - Intronic
922651237 1:227340883-227340905 GAGGCCTTGTTGGCCAGGTGGGG + Intergenic
922994147 1:229942813-229942835 ACAGATTTCTGGGACAGGTGGGG - Intergenic
923441652 1:234026590-234026612 GAAGGCTTGTTAGCCAGGTGTGG + Intronic
923586402 1:235276705-235276727 AAAGAGATGTTGGCCAGGCGCGG + Intronic
924055021 1:240116598-240116620 ACAGAAATGTTGGCTGGGTGTGG + Intronic
924200636 1:241655092-241655114 ATAGTCTTCTTGGCCAGGCGCGG + Intronic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
1062819238 10:521884-521906 ACAGACATGCTGGTCCGGTGGGG - Intronic
1063302326 10:4861657-4861679 AAAGACATATTGGCCAGGCGCGG - Intergenic
1063441197 10:6074757-6074779 AAGGACTTGTAGGCCAGGTGAGG + Intergenic
1064062371 10:12148812-12148834 ATAGATTTATTGGCCAGGCGTGG - Intronic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1065016385 10:21466561-21466583 TAAGAATTGTTGGCCAGGCGCGG + Intergenic
1065586450 10:27222860-27222882 ATGGATATGTTGGCCAGGTGTGG - Intronic
1065626072 10:27629990-27630012 AAAGATTTCTAGGCCAGGTGTGG + Intergenic
1066396639 10:35030671-35030693 AAAGTAGTGTTGGCCAGGTGTGG - Intronic
1066589929 10:36983829-36983851 AAATATTTGTGGGCCAGGTGCGG + Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067279223 10:44858685-44858707 AGAGACCTGAGGGCCAGGTGTGG + Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068585045 10:58788793-58788815 AAACACTTGTAGGCCAGTTGTGG + Intronic
1069216894 10:65832211-65832233 AGAAATTTGTTGGCCGGGTGCGG + Intergenic
1069504507 10:68985943-68985965 AAAGAAATATTGGCCAGGTGTGG - Intergenic
1070124792 10:73612549-73612571 ATATACTTGATGGCCGGGTGAGG + Intronic
1070238453 10:74654941-74654963 TCCGACATGTTGCCCAGGTGCGG - Intronic
1070699104 10:78586048-78586070 ACAGTCTTGTTTCGCAGGTGAGG + Intergenic
1070903381 10:80050291-80050313 ACAAAGTTGTGGGCCAGGCGCGG + Intergenic
1070984647 10:80678222-80678244 AAATACTTTATGGCCAGGTGCGG - Intergenic
1071303614 10:84276948-84276970 TTAAATTTGTTGGCCAGGTGTGG - Intergenic
1072066485 10:91876523-91876545 AAAAAATTGTTGGCCAGGAGTGG + Intergenic
1072112136 10:92332872-92332894 TCACATTTGTTGGCCGGGTGCGG + Intronic
1072153430 10:92701905-92701927 AAAAACAAGTTGGCCAGGTGTGG + Intergenic
1072246346 10:93547414-93547436 CCAGACTTGCTGGCCTGGTTGGG - Intergenic
1072590021 10:96820488-96820510 AGAGGCTTGATGGCCGGGTGTGG - Intergenic
1072920199 10:99570344-99570366 AATGACTTTTTGGCCAGGGGAGG - Intergenic
1073034547 10:100554344-100554366 ATATAAGTGTTGGCCAGGTGTGG + Exonic
1073050852 10:100666342-100666364 ACATACTTATTGGCCAGGTGCGG + Intergenic
1073059908 10:100727420-100727442 ATAGAATTGTTGGCCGGGCGTGG - Intergenic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073218543 10:101850766-101850788 ACAGACTTGGTGGCCAGGCTGGG - Intronic
1073298860 10:102458447-102458469 ACAAGATTGCTGGCCAGGTGCGG - Intergenic
1073348886 10:102804990-102805012 ACAACCATGTTGGCCAGGTGTGG + Intronic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1073769897 10:106724847-106724869 AAAAACATGATGGCCAGGTGTGG + Intronic
1074548084 10:114417348-114417370 ATAGACTTTCTGGCCAAGTGTGG - Intergenic
1075803804 10:125170727-125170749 ACAGAAATATTGGCCAGGTGTGG + Intergenic
1075956378 10:126526532-126526554 AAAAATTAGTTGGCCAGGTGCGG - Intronic
1076020566 10:127069311-127069333 ACAGGATTGTTGGCCAAGTTAGG + Intronic
1076338004 10:129722713-129722735 AAAGTCTTGTTGGCCAGGCATGG + Intronic
1076898119 10:133324401-133324423 CCAGGCTTGCTGGCTAGGTGCGG - Intronic
1077463597 11:2723004-2723026 ACACCCTTGTGGGCCAGCTGCGG + Intronic
1077533728 11:3109056-3109078 ACACACTTATTGACCCGGTGTGG - Intronic
1078629572 11:12989991-12990013 ACAGACTAGTGAGCTAGGTGAGG + Intergenic
1079603973 11:22342904-22342926 AGAGATTTGTTAGCCAGATGTGG - Intronic
1080353500 11:31413484-31413506 ACAAAAATATTGGCCAGGTGTGG - Intronic
1080812696 11:35721192-35721214 AAAGAATTATAGGCCAGGTGTGG - Intronic
1080962697 11:37178962-37178984 ATAAACAGGTTGGCCAGGTGTGG - Intergenic
1081309708 11:41554766-41554788 ATTGGCTTGTTGGCCAGGCGTGG + Intergenic
1081389608 11:42514409-42514431 ACACTCTGGGTGGCCAGGTGTGG + Intergenic
1081472086 11:43383874-43383896 ATAGACATGCAGGCCAGGTGTGG + Intronic
1081631935 11:44695312-44695334 ACAGGCTGATTGGCCAGGTCTGG + Intergenic
1082008212 11:47432740-47432762 CCAGTATCGTTGGCCAGGTGCGG + Intergenic
1082075904 11:47975975-47975997 ACAGATTCCCTGGCCAGGTGTGG + Intergenic
1083300776 11:61738721-61738743 GCAGACGGGGTGGCCAGGTGGGG + Intronic
1083339227 11:61947953-61947975 ACATACTTATTGGCCGAGTGTGG + Intergenic
1083398544 11:62408062-62408084 ACAGAATTGGAGTCCAGGTGCGG - Intronic
1083564978 11:63706491-63706513 AACAAATTGTTGGCCAGGTGTGG - Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1083939221 11:65886316-65886338 TCTGACCGGTTGGCCAGGTGAGG - Exonic
1084069343 11:66724128-66724150 ACTGATTTTTTGGCCGGGTGCGG + Intronic
1084293724 11:68195864-68195886 AATGAATTTTTGGCCAGGTGTGG + Intronic
1084637694 11:70403475-70403497 AAAGAACTCTTGGCCAGGTGAGG - Intronic
1084756093 11:71239763-71239785 AATGACTTCTTGGCCAGGTATGG - Intronic
1085050596 11:73378086-73378108 AGAGACTTGTTCCCCAGGAGTGG + Intronic
1085101526 11:73804558-73804580 ACTGACTTAATGGCCAGGTGCGG - Intronic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1086343099 11:85867320-85867342 AAATCCTTCTTGGCCAGGTGAGG - Intronic
1087128060 11:94645481-94645503 ACAGTCATGTGGGTCAGGTGTGG - Intergenic
1087167093 11:95015587-95015609 AAAGAATGTTTGGCCAGGTGCGG - Intergenic
1087388035 11:97497946-97497968 ACAGATTTTTAGGCCAGTTGGGG - Intergenic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087406967 11:97742700-97742722 AAAGATATGTTGGCCGGGTGCGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087761065 11:102104890-102104912 AGTGAATTCTTGGCCAGGTGTGG - Intergenic
1088248103 11:107838917-107838939 AGAAACTTATCGGCCAGGTGTGG - Intronic
1088271406 11:108038395-108038417 AAAGATCTTTTGGCCAGGTGTGG + Intronic
1088311055 11:108461013-108461035 GCAGACTTTTTGGCCGGGCGTGG - Intronic
1089289796 11:117430718-117430740 TCACTCTTGTTGGCCCGGTGAGG + Exonic
1089384250 11:118057619-118057641 GCAGTGTTGCTGGCCAGGTGTGG + Intergenic
1089504977 11:118956823-118956845 CCAGATCTGTTGGCCAGGAGGGG + Intronic
1089992573 11:122875481-122875503 ACAGTAATATTGGCCAGGTGCGG + Intergenic
1090399166 11:126437310-126437332 ATAAACGTGTTGGCCATGTGTGG - Intronic
1091478309 12:799419-799441 ACAGACATGCAGGCCGGGTGCGG - Intronic
1092133637 12:6130561-6130583 ACATGCTTGTCGGCCGGGTGCGG - Intergenic
1092190439 12:6515899-6515921 AAAGACTTTGAGGCCAGGTGTGG + Intronic
1092274047 12:7045872-7045894 ATAGATTTGCTGGCCAGGTTTGG + Intronic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1092338032 12:7651323-7651345 AAAGAGTTGTTGGCTGGGTGCGG + Intronic
1093302170 12:17471348-17471370 ACGAAATTGTTGGGCAGGTGGGG - Intergenic
1093946206 12:25112694-25112716 ACAGATGTGTAGGCTAGGTGTGG - Intronic
1094008227 12:25778955-25778977 ATGTATTTGTTGGCCAGGTGTGG + Intergenic
1094024582 12:25949192-25949214 AAATACTTATAGGCCAGGTGTGG - Intergenic
1094224592 12:28030848-28030870 AGAGAAGTGTTGGCCAGGCGCGG + Intergenic
1094607558 12:31961930-31961952 ACGTATTTGTAGGCCAGGTGTGG + Intronic
1094626539 12:32129658-32129680 AAAGAGTTTTAGGCCAGGTGCGG - Intronic
1094663004 12:32489525-32489547 ACAGACTTATTTGGCAGGTCAGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1096041419 12:48520547-48520569 ACAGGGTGGCTGGCCAGGTGGGG + Intronic
1096297265 12:50394211-50394233 ACAGAGTGCTTGGCCAGGTGTGG - Intronic
1096566152 12:52481244-52481266 ACTTACTTTTTGGCCAGGTGTGG + Intergenic
1096705212 12:53416821-53416843 ACTGACATCGTGGCCAGGTGTGG + Intergenic
1097061061 12:56284349-56284371 ACAAACTTTGTGGCCAGGTACGG + Intronic
1097277627 12:57824052-57824074 ACAGACCTGCTGGACCGGTGTGG - Exonic
1098334880 12:69393310-69393332 ACAGAAAAATTGGCCAGGTGTGG + Intergenic
1098579305 12:72080092-72080114 AAAGAATTATTGGCCAGGCGCGG + Intronic
1098847670 12:75558317-75558339 ACAGACCTGTGTGCAAGGTGGGG - Intergenic
1098870428 12:75811534-75811556 ATATATTTGTAGGCCAGGTGCGG + Intergenic
1099080854 12:78178449-78178471 ACAGTATTTTGGGCCAGGTGGGG - Intronic
1099291853 12:80784917-80784939 ACAGTCATGTGGGTCAGGTGTGG + Intergenic
1100555874 12:95693438-95693460 ATTAACTTATTGGCCAGGTGCGG + Intronic
1100989765 12:100239364-100239386 AAAAAATTATTGGCCAGGTGTGG - Intronic
1101141880 12:101803884-101803906 AAAGATTTGTTTGCCAGTTGGGG + Intronic
1101507194 12:105358364-105358386 ACATATATGTTAGCCAGGTGCGG + Intronic
1102365044 12:112326077-112326099 ACACTTATGTTGGCCAGGTGCGG - Intronic
1102639120 12:114350930-114350952 ACACATTTGTGGGCCAGGTGTGG - Intergenic
1102698596 12:114819180-114819202 AAGTATTTGTTGGCCAGGTGTGG + Intergenic
1102874252 12:116437379-116437401 AGACCGTTGTTGGCCAGGTGCGG + Intergenic
1103136533 12:118512678-118512700 AAACTCTTGATGGCCAGGTGTGG - Intergenic
1103277114 12:119721643-119721665 TCGGACTTGTTGGCCAGCAGAGG - Intronic
1103697213 12:122825644-122825666 AAAGACTTCTTGGCTAGGCGTGG - Intronic
1103744970 12:123116357-123116379 ACAGACATTCTGGCCAGGAGTGG + Intronic
1103754944 12:123197460-123197482 ACTTACCTTTTGGCCAGGTGTGG - Intronic
1103796361 12:123505913-123505935 AAACACTTGATGGCCAGGTGTGG - Intronic
1104991700 12:132628051-132628073 AACTACTTTTTGGCCAGGTGCGG + Intronic
1105350582 13:19611530-19611552 ATAAAATTCTTGGCCAGGTGCGG - Intergenic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1105773319 13:23633376-23633398 AAAGACTTCATGGTCAGGTGTGG - Intronic
1106196891 13:27501768-27501790 AGAAAATTCTTGGCCAGGTGCGG + Intergenic
1106274386 13:28190233-28190255 ACAAACAAATTGGCCAGGTGAGG - Intronic
1106490505 13:30217160-30217182 ACTGAGTTGATGGCCAGGCGCGG + Intronic
1107854269 13:44599305-44599327 ACAGAATTGGAGCCCAGGTGTGG - Intergenic
1108406700 13:50110760-50110782 AAAATATTGTTGGCCAGGTGCGG + Intronic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1108638757 13:52362075-52362097 TAAGAATTGTTGGCCAGGCGCGG - Intergenic
1108874774 13:55032417-55032439 ACAGACATTTAGGCCAGGCGCGG + Intergenic
1109386972 13:61643256-61643278 AAAAAATTCTTGGCCAGGTGTGG + Intergenic
1109656433 13:65396919-65396941 AGAAAAATGTTGGCCAGGTGCGG - Intergenic
1109994186 13:70101717-70101739 ATAGGGCTGTTGGCCAGGTGTGG - Intronic
1110301113 13:73928144-73928166 AGATAGATGTTGGCCAGGTGTGG - Intronic
1110823254 13:79941332-79941354 ACAGGCTTGTAGCCCAGGAGCGG - Intergenic
1110846993 13:80201348-80201370 TCAGATCTGGTGGCCAGGTGTGG - Intergenic
1111251266 13:85604973-85604995 ACAGACAAGTTGGCCAGATGTGG + Intergenic
1111465806 13:88607706-88607728 AAATACATGTTGGCCAGGTGTGG - Intergenic
1111936914 13:94567120-94567142 ACAAAATTATGGGCCAGGTGCGG - Intergenic
1113740371 13:112708759-112708781 ACAGGCTTGTCGGGCAGGGGTGG - Intronic
1113810252 13:113137073-113137095 ATAGAGTTGCTGGCCAGGCGTGG - Intronic
1113846621 13:113395341-113395363 AGAGATTAGTTGGCCAGGCGCGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1113988154 13:114335889-114335911 ACAAACATGTGGGCCGGGTGTGG + Intergenic
1114005602 14:18310013-18310035 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114287292 14:21256942-21256964 AAAATCATGTTGGCCAGGTGTGG - Intronic
1114304764 14:21412432-21412454 ACAGATCTGCTGGCCAGGCGCGG - Intronic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1115014111 14:28588891-28588913 AAAGTTTTGTTGGCCAGGTGTGG - Intergenic
1115201890 14:30862524-30862546 TCAAACTTTTTGGCCAGGCGTGG + Intergenic
1115295337 14:31819848-31819870 AGAGAATTCTTGGCCAGGCGTGG + Intronic
1115343874 14:32321593-32321615 AAACACTGGTCGGCCAGGTGTGG + Intergenic
1115566110 14:34627154-34627176 AAAAAATTGTTGGCCAGGCGCGG + Intronic
1115618100 14:35115450-35115472 AAAAAAATGTTGGCCAGGTGTGG - Intronic
1115996625 14:39202018-39202040 ACATGTTTTTTGGCCAGGTGTGG - Intergenic
1116199559 14:41773641-41773663 ACAGACTTGTTGGTGAGGTAAGG + Intronic
1116729294 14:48602213-48602235 ACTGTCTTGTGGGCCAGGCGTGG + Intergenic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1117132292 14:52697951-52697973 AAAGAGCTTTTGGCCAGGTGCGG - Intergenic
1117371848 14:55085940-55085962 ACTCACTGGTTGGCCAGGCGTGG - Intergenic
1117681226 14:58204936-58204958 AAACACATGTTGGCCAGATGCGG + Intronic
1118017391 14:61674112-61674134 AAACATTTATTGGCCAGGTGCGG + Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118411495 14:65483737-65483759 ACAGAGTTATTGGCCAAGTGTGG + Intronic
1118847586 14:69559360-69559382 AAAGATCTTTTGGCCAGGTGCGG - Intergenic
1118977881 14:70693077-70693099 AATGTCTTGTTGGCCAGGTGTGG - Intergenic
1119779935 14:77270843-77270865 ACCGTCCTGTTTGCCAGGTGAGG - Exonic
1119798347 14:77419736-77419758 AAAAACCTGTTGGTCAGGTGTGG - Intronic
1119831031 14:77702862-77702884 ACATTTTTTTTGGCCAGGTGAGG + Intronic
1120005110 14:79347709-79347731 AGGGAAATGTTGGCCAGGTGCGG - Intronic
1120291272 14:82574255-82574277 ATACACAAGTTGGCCAGGTGGGG - Intergenic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1120798550 14:88663823-88663845 ATAGAAATGTTGGCCAGGTATGG - Intronic
1120908507 14:89643152-89643174 AAAATCTTCTTGGCCAGGTGCGG + Intergenic
1121388717 14:93555692-93555714 AAAGAAATCTTGGCCAGGTGTGG - Intronic
1121408413 14:93733228-93733250 CCAGACCTGGTAGCCAGGTGGGG - Intronic
1121651215 14:95560322-95560344 ACAGAAATTTTGGCCGGGTGTGG + Intergenic
1121716771 14:96081888-96081910 AAACATTTGTTGGCCGGGTGCGG - Intronic
1121815402 14:96924809-96924831 ACTCACTTGTTGCCGAGGTGAGG + Intronic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1122474718 14:101999170-101999192 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1122664646 14:103320135-103320157 AAAAATTTATTGGCCAGGTGCGG - Intergenic
1122676669 14:103420519-103420541 AAAAAAGTGTTGGCCAGGTGTGG - Intronic
1122700477 14:103585186-103585208 AAAGAGTTCTTGGCCAGGCGCGG + Intronic
1123688118 15:22814489-22814511 ACATACATATTGGCCAGGCGTGG - Intronic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1124205729 15:27718427-27718449 ACACAAGTGTTGGCCAGATGAGG - Intergenic
1124472377 15:29999966-29999988 ATAGTCCTTTTGGCCAGGTGTGG + Intergenic
1124474908 15:30024871-30024893 ATAGACTTATTGGCCAGGTGCGG + Intergenic
1124613774 15:31226697-31226719 ACAAAACTGTTGGCCAGTTGCGG + Intergenic
1125211215 15:37217418-37217440 AGAGATTTATTGGCCAAGTGTGG - Intergenic
1125547366 15:40516121-40516143 AAAGACTTATTGGCCGGGTGGGG - Intergenic
1125637259 15:41199240-41199262 AAAAAATTTTTGGCCAGGTGTGG - Intronic
1125660541 15:41391327-41391349 ACAGAATTTAGGGCCAGGTGTGG + Intronic
1125934468 15:43622964-43622986 AGACACTTACTGGCCAGGTGTGG - Intergenic
1125994742 15:44147685-44147707 ACAGATTTGTTGTCTAGGTGGGG - Intronic
1126637561 15:50793987-50794009 ATTGACTTTTTGGCCAGGCGTGG - Intergenic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1127063140 15:55207944-55207966 TCAGGTTTTTTGGCCAGGTGTGG - Intronic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127516089 15:59694641-59694663 AAAGATTTACTGGCCAGGTGTGG - Intergenic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1128088377 15:64901694-64901716 ACAACCATTTTGGCCAGGTGTGG - Intronic
1128090972 15:64918661-64918683 CCCTCCTTGTTGGCCAGGTGCGG + Intronic
1128131788 15:65233121-65233143 AAAAACCTGTTGACCAGGTGCGG + Intergenic
1128277714 15:66367681-66367703 AAAGACTTGCTAGCCAAGTGTGG - Intronic
1129254682 15:74327342-74327364 ACAGAGCTCTGGGCCAGGTGCGG + Intronic
1129806074 15:78459080-78459102 ATATACTTATTGGCCAGGTATGG - Intronic
1130183481 15:81654179-81654201 CCAGACTTCTGGGCCGGGTGGGG - Intergenic
1130249367 15:82287185-82287207 AAAGAAGTCTTGGCCAGGTGTGG - Intergenic
1130341871 15:83006467-83006489 AAGGATTTGTTGGCCAGGTGTGG + Intronic
1130929381 15:88411886-88411908 ACAGAATTCCTGGTCAGGTGCGG - Intergenic
1131094529 15:89647184-89647206 ACAGAGTTGTTGGGGAGGAGAGG - Intronic
1131107126 15:89742821-89742843 TAAGAGTTGTTGGCCAGGCGCGG - Intronic
1131138865 15:89960987-89961009 ATAAAGTTTTTGGCCAGGTGCGG + Intergenic
1131512492 15:93056952-93056974 ACAGACTTGGGGGACAGGAGGGG + Intronic
1132762132 16:1514076-1514098 AGATTTTTGTTGGCCAGGTGCGG + Intronic
1132818054 16:1844412-1844434 ACAGAATGCTTGGCCAGGTGTGG - Intronic
1132910197 16:2306168-2306190 ACAGACAAATTAGCCAGGTGTGG + Intronic
1133546902 16:6816449-6816471 AGGGTCTTGTTGGCCGGGTGTGG + Intronic
1133664226 16:7950079-7950101 ATAGAATTGTTGGCCGGGAGTGG + Intergenic
1134532990 16:14999355-14999377 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1134757062 16:16676822-16676844 AAAGAATTCATGGCCAGGTGCGG - Intergenic
1134874744 16:17687968-17687990 ACAGATTTGTGGGCCAGCTGGGG + Intergenic
1134989006 16:18682341-18682363 AAAGAATTCATGGCCAGGTGCGG + Intergenic
1135005447 16:18818090-18818112 AAAAATTTATTGGCCAGGTGTGG + Intronic
1135082592 16:19449274-19449296 AAATAATTGTTGGCAAGGTGAGG - Intronic
1135105030 16:19641917-19641939 AAAGAATTCTGGGCCAGGTGCGG + Intronic
1135126732 16:19816572-19816594 AAAGAAGTGTTGGCCAGGCGCGG - Intronic
1135346725 16:21695107-21695129 CCAACCTTGCTGGCCAGGTGTGG + Intronic
1135776453 16:25260904-25260926 ACATTCTTGTGGGCCAGGAGCGG - Intergenic
1136169368 16:28479024-28479046 AGAGGCTTCCTGGCCAGGTGCGG - Intronic
1136233529 16:28901664-28901686 ACTGAGTTTTTGGCCAAGTGTGG + Intronic
1136481932 16:30547522-30547544 ACAGACCTCTGGGCCGGGTGTGG + Intronic
1136996042 16:35188640-35188662 ACATACATGCTGGACAGGTGGGG + Intergenic
1137283136 16:46994967-46994989 AAAGACATATAGGCCAGGTGCGG - Intergenic
1137642989 16:50049439-50049461 AAAAATTTTTTGGCCAGGTGTGG - Intergenic
1137650030 16:50111715-50111737 AAAGACCTTTAGGCCAGGTGTGG - Intergenic
1137741966 16:50786467-50786489 AGAAATGTGTTGGCCAGGTGTGG + Intronic
1137760831 16:50939069-50939091 ACAGCCCTGTTTGTCAGGTGAGG + Intergenic
1138009931 16:53369016-53369038 ACAAATATCTTGGCCAGGTGTGG - Intergenic
1138254964 16:55548056-55548078 ACATTTTTTTTGGCCAGGTGCGG - Intronic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1138656507 16:58494674-58494696 ACAGACTGGTGGGCTGGGTGCGG + Intronic
1139703128 16:68721797-68721819 TCATCCTTGTTGGCCAGGCGTGG + Intronic
1139798075 16:69499042-69499064 AAAAAAATGTTGGCCAGGTGTGG + Intergenic
1139838133 16:69856484-69856506 ACCCATTTGGTGGCCAGGTGCGG + Intronic
1139863043 16:70041375-70041397 AAAAAATTTTTGGCCAGGTGCGG + Intergenic
1140056507 16:71530473-71530495 AAAGATATTTTGGCCAGGTGCGG + Intronic
1140175137 16:72651095-72651117 AAAGACATCTTGGCCAGGTGTGG - Intergenic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140346468 16:74218209-74218231 TCTGAGATGTTGGCCAGGTGCGG - Intergenic
1140428505 16:74881582-74881604 AAATACTTCTTGGCCGGGTGTGG + Intronic
1140436142 16:74948709-74948731 AGAGACCTGCTGGCCAGGTACGG + Intronic
1140536671 16:75715986-75716008 ACAGAAATGTGGGCCAGATGTGG - Intronic
1140642616 16:76994166-76994188 ACAAAATAGTTAGCCAGGTGTGG - Intergenic
1141416793 16:83881656-83881678 ACATCATTCTTGGCCAGGTGTGG - Intergenic
1141736610 16:85858268-85858290 AGACACCTGTTGGCCAGGCGCGG - Intergenic
1142171679 16:88625707-88625729 AAAGCTTTGTGGGCCAGGTGCGG + Intronic
1142276255 16:89120407-89120429 ACACACTTGCTGGCCAGGGAGGG - Intronic
1142739037 17:1919818-1919840 ATATAATTGTTGGCCAGGCGTGG + Intergenic
1143379223 17:6485446-6485468 AGAGACTTATTGGCCAGGCATGG - Intronic
1143414066 17:6733258-6733280 ACAGTCATGGGGGCCAGGTGTGG + Intergenic
1144159533 17:12544033-12544055 AATTATTTGTTGGCCAGGTGCGG + Intergenic
1144547363 17:16210091-16210113 ACCTATTTGTAGGCCAGGTGTGG + Intronic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1145851439 17:28102358-28102380 AAAAAGTTTTTGGCCAGGTGCGG + Intronic
1146223079 17:31043089-31043111 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1146341918 17:32026898-32026920 ACTGAATATTTGGCCAGGTGAGG + Intronic
1146350891 17:32092741-32092763 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1146377166 17:32302672-32302694 AAAGACTTTTGGGCCAGGTGGGG - Intronic
1146709439 17:35028042-35028064 AAAGAAGCGTTGGCCAGGTGTGG + Intronic
1146951801 17:36911958-36911980 AAATACTTGCTGGCTAGGTGTGG - Intergenic
1147036028 17:37681684-37681706 TTAGTGTTGTTGGCCAGGTGTGG - Intergenic
1147047262 17:37762503-37762525 GAAGAGTTATTGGCCAGGTGAGG + Intergenic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1147298226 17:39502131-39502153 ACAAACTAGTATGCCAGGTGCGG - Intronic
1147451503 17:40507705-40507727 ACAGATATATAGGCCAGGTGTGG + Intergenic
1147750676 17:42730784-42730806 ACATACTTCTTGGCCGGGCGCGG - Intronic
1147968265 17:44205916-44205938 GCAGACTTCTTGCCCAGCTGTGG + Exonic
1148362519 17:47024064-47024086 ACTGAATATTTGGCCAGGTGAGG + Intronic
1149176778 17:53881609-53881631 ACAGAACTACTGGCCAGGTGAGG + Intergenic
1149230828 17:54531892-54531914 ACTGCCTTCTTGGCCAGGTGTGG - Intergenic
1149672444 17:58426959-58426981 AAAAAAATGTTGGCCAGGTGCGG + Intronic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1150138388 17:62708532-62708554 ACCTACTTTTTGGCCAGGTGCGG - Intronic
1150172451 17:63012943-63012965 AGAGTCTTCTTGGCCAGGTATGG - Intronic
1150224575 17:63516976-63516998 ACAGATATCTTGGCCAGGCGTGG - Intronic
1150681343 17:67286998-67287020 AGAGATTTGCAGGCCAGGTGTGG + Intergenic
1150910975 17:69387169-69387191 ACAGGATTTCTGGCCAGGTGCGG + Intergenic
1151040213 17:70850674-70850696 AAATATTTATTGGCCAGGTGCGG - Intergenic
1151453238 17:74212037-74212059 ACAGCCTAGTAGGCGAGGTGAGG - Intergenic
1151722712 17:75866839-75866861 ATTGTCTTGTTGGCCATGTGCGG + Intergenic
1151839082 17:76604640-76604662 AGAGACTAGATGGCCAGGCGTGG + Intergenic
1151979316 17:77499305-77499327 GCAGACTGCTTGGCCAGATGCGG + Exonic
1152872384 17:82763447-82763469 ACAGGGTTTTGGGCCAGGTGCGG + Intronic
1153311828 18:3684488-3684510 AAAAACATCTTGGCCAGGTGTGG - Intronic
1153315696 18:3719274-3719296 ATGGACTATTTGGCCAGGTGCGG + Intronic
1153576303 18:6525085-6525107 AAATGATTGTTGGCCAGGTGTGG + Intronic
1153867084 18:9280496-9280518 ATGGACTTGTAGGCCGGGTGTGG + Intronic
1154038569 18:10832005-10832027 ACAGAGTTGGAGGCCAGGTGCGG + Intronic
1154197356 18:12276446-12276468 AAAGACTTTGTGGCCAGGTGTGG - Intronic
1154204038 18:12322008-12322030 ATTGAGTTGTTGGCCAGGTGCGG + Intronic
1154244995 18:12688822-12688844 AAAAAGTTCTTGGCCAGGTGTGG + Intronic
1154382575 18:13865901-13865923 TCAGATTTGTTGGCCAGGCACGG - Intergenic
1154531825 18:15353861-15353883 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1155435398 18:25807353-25807375 ACGGATTTATTGGCCAGGTGTGG - Intergenic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1156155231 18:34293833-34293855 ACAAAGATGTTGGCCAGATGTGG - Intergenic
1156875321 18:42003565-42003587 ACACACTTCTTGGCCAGGTGTGG - Intronic
1157093299 18:44661662-44661684 AAAGCATTTTTGGCCAGGTGTGG - Intergenic
1157309207 18:46539168-46539190 ACAGATTTGCAGGCCAGGTGTGG + Intronic
1157660238 18:49434915-49434937 AAAAACTTTTGGGCCAGGTGTGG + Intronic
1157839455 18:50943079-50943101 ACAAAGATGTTAGCCAGGTGTGG - Intronic
1158364614 18:56719271-56719293 ACAGAATTGCTGGCCGGGCGCGG + Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1158723757 18:59949453-59949475 AGAAACTTCTTGGCCAGGCGTGG - Intergenic
1158779289 18:60627207-60627229 AGAGACCTGTTAGCAAGGTGGGG - Intergenic
1159093550 18:63875707-63875729 AATGTCTTCTTGGCCAGGTGTGG - Intronic
1159342828 18:67159012-67159034 AAAGAAATCTTGGCCAGGTGCGG - Intergenic
1160202307 18:76806121-76806143 AAACACCTGTTGGCCAGGCGCGG - Intronic
1160209484 18:76864488-76864510 AAATATTTGTTGGCCAGGTGCGG - Intronic
1160311720 18:77798403-77798425 ACAGAATTCTAGGTCAGGTGTGG - Intergenic
1161292963 19:3505708-3505730 ACAGGTTTTTAGGCCAGGTGCGG - Intergenic
1161419247 19:4167050-4167072 AGACACTTATTGGCCGGGTGTGG + Intronic
1161530938 19:4788961-4788983 AAACAATTGGTGGCCAGGTGAGG + Intergenic
1161546445 19:4883593-4883615 AGAGACTGCTGGGCCAGGTGCGG - Intergenic
1161630209 19:5350717-5350739 AGAGACATTTAGGCCAGGTGTGG + Intergenic
1161676617 19:5654029-5654051 ACAGACATGTTGGCTGGGCGTGG - Intronic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1161947013 19:7443746-7443768 ACAGACTTGATAGCCAGGCGTGG + Intronic
1161967801 19:7558264-7558286 ACAATCTTGTAGGCCAGGGGTGG + Intronic
1162126724 19:8503458-8503480 AGAAACTAGTTGGCCAGGCGTGG - Intergenic
1162207075 19:9064140-9064162 AAAAAATTCTTGGCCAGGTGTGG + Intergenic
1162286552 19:9743261-9743283 AGAAAATTGTTGGGCAGGTGGGG - Intergenic
1162610511 19:11746550-11746572 AGTTACATGTTGGCCAGGTGCGG - Intergenic
1162629936 19:11919466-11919488 ATATACTTGGAGGCCAGGTGTGG + Intergenic
1162636978 19:11976574-11976596 AAAAAATTGCTGGCCAGGTGTGG + Intronic
1162651827 19:12094330-12094352 TAAGACTGGTGGGCCAGGTGTGG - Intronic
1162773214 19:12962832-12962854 ACTGACACGTTGGCCGGGTGCGG - Intergenic
1163058106 19:14737483-14737505 AAAGACTTCTTGGCCAGGCATGG - Intronic
1163249840 19:16120101-16120123 ACAGTCATTTTTGCCAGGTGCGG - Intronic
1163353381 19:16793865-16793887 ACATAAAAGTTGGCCAGGTGTGG - Intronic
1163450067 19:17371771-17371793 ACAGCTTTGCTGGCCAGGCGTGG - Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163658898 19:18564796-18564818 ACAGTCTTCTGGGCCAGGTTGGG + Intronic
1163944209 19:20520954-20520976 ACAGTCATGTGGGCCAGTTGTGG + Intergenic
1164076253 19:21821357-21821379 ACAGCCTGGTTGGCCAGGCGCGG - Intronic
1164109534 19:22142522-22142544 AAAGAAAAGTTGGCCAGGTGTGG - Intergenic
1164218171 19:23169454-23169476 ACAGATTCTTAGGCCAGGTGTGG - Intergenic
1165249177 19:34515767-34515789 ACGAAATTGTTGGGCAGGTGGGG - Intergenic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1165765852 19:38350696-38350718 ACAGTCCTGTTGGCTGGGTGTGG + Intronic
1165842410 19:38796989-38797011 CCATATTTTTTGGCCAGGTGTGG - Intergenic
1166372966 19:42312714-42312736 AAAGACTTGTTGGCCAGGCGCGG + Intergenic
1166845504 19:45725447-45725469 AAACACTTGTGGGCCAGGTGCGG + Intronic
1166861098 19:45811724-45811746 ATACAAATGTTGGCCAGGTGCGG - Intronic
1166973673 19:46589936-46589958 AAATAGTTATTGGCCAGGTGTGG + Intronic
1167149617 19:47701450-47701472 ACAAGCTTGGTGGGCAGGTGTGG - Exonic
1167842928 19:52136770-52136792 AGAGACATCTAGGCCAGGTGTGG + Intronic
1168143125 19:54402924-54402946 AAAGACTTGTTGGCCGGGCGCGG - Intergenic
1168180134 19:54656594-54656616 GTAGACTGGTTGGCCAGGTGTGG - Intronic
1168223219 19:54976037-54976059 AAAGTCTTCATGGCCAGGTGTGG - Intronic
1168715874 19:58526981-58527003 ACACATTTTGTGGCCAGGTGTGG - Intronic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
925066103 2:929858-929880 ACTGATTTGTAAGCCAGGTGAGG - Intergenic
925648900 2:6067802-6067824 ACATACCTGCTGTCCAGGTGTGG + Intergenic
926057375 2:9781986-9782008 ACTGAGTTGTTGGCCGGGTGAGG - Intergenic
926264293 2:11300552-11300574 CCATAGTTGTTGGCCGGGTGTGG - Intronic
926978177 2:18535640-18535662 TAAGACTGATTGGCCAGGTGTGG - Intergenic
927158103 2:20233623-20233645 TCTGACTTTTCGGCCAGGTGTGG + Intergenic
927974980 2:27331613-27331635 ACAGTGTTATTGGCCAAGTGTGG - Intronic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
928385312 2:30862627-30862649 ACTGATTTGCTGGCCAGATGTGG - Intergenic
928440876 2:31290873-31290895 ACAGAGCTGTTGGCTGGGTGTGG + Intergenic
928686778 2:33758393-33758415 AGAGACTTCTTGGCCAGGCACGG + Intergenic
929807613 2:45160829-45160851 ACATATCTGTTGGCCAGGTGCGG + Intergenic
929898774 2:45983883-45983905 AGAGACTTTTTGCCTAGGTGGGG + Intronic
930195104 2:48501652-48501674 ACTCATTTGTTAGCCAGGTGTGG + Intronic
930206633 2:48593403-48593425 AAATACTTTTAGGCCAGGTGTGG - Intronic
930634669 2:53790761-53790783 ACAAATTTTTTGGCCAGGTGAGG - Intronic
930636247 2:53808917-53808939 AGGGAGATGTTGGCCAGGTGCGG - Intronic
930756746 2:54982244-54982266 TCATACTTGTGGGCCGGGTGTGG - Intronic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
930815238 2:55590035-55590057 ATAAATTTGTGGGCCAGGTGTGG + Intronic
931598187 2:63973834-63973856 ACAGGATTGGTGGTCAGGTGTGG - Intronic
931604524 2:64039573-64039595 AAAGACATTTTGGCCGGGTGTGG + Intergenic
931606977 2:64062290-64062312 ATAGATTTTTTGGCCGGGTGCGG - Intergenic
931758474 2:65395312-65395334 ACAGACTTGAAGGTCAGGTTGGG - Intronic
933819634 2:86099043-86099065 AGAGACTTCTCAGCCAGGTGCGG + Intronic
935080532 2:99789144-99789166 AATAAGTTGTTGGCCAGGTGCGG + Intronic
935715116 2:105932592-105932614 ACACACTTCCTGGCCAGGCGTGG - Intergenic
935953933 2:108355674-108355696 AAAACATTGTTGGCCAGGTGCGG - Intergenic
936102138 2:109591604-109591626 ACTGAATTACTGGCCAGGTGTGG + Intronic
936367454 2:111871458-111871480 ATTGAATTTTTGGCCAGGTGCGG + Intronic
936488109 2:112944431-112944453 AGATAAGTGTTGGCCAGGTGTGG - Intergenic
936883573 2:117282612-117282634 ACAGTCATGGTGGTCAGGTGTGG - Intergenic
937627300 2:124057578-124057600 ATGGACTTGTTGGCCAGGAGCGG - Intronic
937702414 2:124878971-124878993 AAAGTATTATTGGCCAGGTGTGG - Intronic
938315707 2:130326430-130326452 AAAGACTGGTGGGCCAGGCGTGG - Intergenic
938578181 2:132622822-132622844 TAAGACCTGTTGGCCAGGTGCGG + Intronic
938582132 2:132655802-132655824 AAATGCTTCTTGGCCAGGTGCGG - Intronic
938783347 2:134604887-134604909 ACACAATCCTTGGCCAGGTGCGG + Intronic
938907728 2:135854580-135854602 AAAGGCTTTTTGGCCAGGTATGG + Intronic
939049923 2:137295762-137295784 AAAGATTTTTTGGCCGGGTGTGG - Intronic
939410517 2:141818824-141818846 ACAGAAATGTTATCCAGGTGCGG - Intronic
939410529 2:141818948-141818970 AAAAACTTTCTGGCCAGGTGCGG + Intronic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940022276 2:149167924-149167946 AAAGACCTTTGGGCCAGGTGTGG + Intronic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940179498 2:150916220-150916242 AAAAACTTCCTGGCCAGGTGTGG - Intergenic
940239893 2:151551257-151551279 AAATAATTTTTGGCCAGGTGCGG - Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941732367 2:168932817-168932839 AGAAAATTGTTGGCCAGGCGCGG + Intronic
942029983 2:171949791-171949813 AAAGACTCCTTAGCCAGGTGCGG - Intronic
942363324 2:175196112-175196134 ACAGTCTCTTTGGCCATGTGAGG - Intergenic
943648601 2:190432705-190432727 ACAGAGATTTTGGCCAGGTGCGG - Intronic
944091780 2:195919633-195919655 GTAGACTTTTTGGCCTGGTGTGG - Intronic
944303687 2:198155666-198155688 ACAGCCTTAGAGGCCAGGTGTGG + Intronic
945066332 2:205950377-205950399 AAAGAGTTGTTGGCTGGGTGCGG + Intergenic
945512847 2:210724112-210724134 ACTTACTTGTTGGCCAGGCGCGG - Intergenic
945590191 2:211719563-211719585 AAAGTGTTTTTGGCCAGGTGCGG + Intronic
945914327 2:215686844-215686866 ACAAAACTGTTGGCCGGGTGCGG - Intergenic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946263893 2:218521708-218521730 CCAGACTTTTTAGTCAGGTGGGG - Intronic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
948201900 2:236135565-236135587 AAAAATTTTTTGGCCAGGTGCGG - Intergenic
948640745 2:239374691-239374713 AAAGCCTTGTTGGCCGGGCGCGG - Intronic
948812748 2:240492976-240492998 ACTGATTTTTAGGCCAGGTGAGG - Intronic
949012333 2:241687812-241687834 ACGGACTTTTCGGCCAGGCGCGG - Intergenic
949060166 2:241952322-241952344 TCACTCTTGTTGTCCAGGTGGGG + Intergenic
1169089502 20:2850029-2850051 AAAGAATTATTGGCCTGGTGTGG + Intronic
1169118134 20:3080441-3080463 AAGAACTTCTTGGCCAGGTGTGG - Intergenic
1169265957 20:4167579-4167601 TCAGAGGTGTTGGCCAAGTGGGG + Intronic
1169280603 20:4263775-4263797 AAAGCAATGTTGGCCAGGTGTGG - Intergenic
1169441500 20:5637504-5637526 CCAGACATGTTGGCCAGGCACGG - Intergenic
1169666070 20:8037643-8037665 AAAGAATTGTTGGCCAGGCCTGG + Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170319945 20:15084356-15084378 AAAAACTAGTTGGCCGGGTGTGG - Intronic
1170353048 20:15463457-15463479 ATATACTTTTAGGCCAGGTGTGG + Intronic
1170680160 20:18519222-18519244 ACAGTCATGTGGGTCAGGTGTGG + Intronic
1170964933 20:21059711-21059733 AAAAATTTATTGGCCAGGTGTGG - Intergenic
1171478380 20:25432160-25432182 ACAGATTTCATGGCCAGGCGCGG - Intronic
1171992606 20:31708316-31708338 ACAGGCTTCTTGCCCAGGGGAGG - Intronic
1172414910 20:34757465-34757487 GGAGACTTGTTGGTGAGGTGGGG + Exonic
1172684173 20:36740630-36740652 AAAAATTTGTTGCCCAGGTGTGG - Intronic
1172905792 20:38368307-38368329 AAAGCATTGCTGGCCAGGTGCGG + Intronic
1173641097 20:44602540-44602562 GAAGACTTGGAGGCCAGGTGCGG + Intronic
1174199937 20:48799988-48800010 CCTGACTTGTGGGCCAGCTGTGG + Intronic
1174350093 20:49960956-49960978 ACACATTTTTTGGCCAGGTGTGG - Intergenic
1174406386 20:50305867-50305889 ACAGACTTTGGGGCCAGATGAGG + Intergenic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175417808 20:58813081-58813103 AGAGACTCGCTGGCCAGCTGGGG - Intergenic
1175432343 20:58914509-58914531 ACATAATTAATGGCCAGGTGCGG + Intergenic
1176114171 20:63423886-63423908 CCAGACTTGTGGGCGGGGTGGGG + Intronic
1176257087 20:64158365-64158387 ACAGACAGGTTGGGCAGGTGGGG - Intronic
1176257137 20:64158508-64158530 ACAGACAAGTGGGGCAGGTGGGG - Intronic
1176257185 20:64158635-64158657 ACAGACAGGTTGGGCAGGTGAGG - Intronic
1176287664 21:5027168-5027190 ACAAACTAATTGGCCAGGCGCGG - Intronic
1176765536 21:13014312-13014334 AAAGAGTTTTGGGCCAGGTGCGG + Intergenic
1177186484 21:17803228-17803250 AAATATTTTTTGGCCAGGTGTGG + Intronic
1177643586 21:23874233-23874255 TGAGAGTTCTTGGCCAGGTGCGG - Intergenic
1177786302 21:25675203-25675225 ACACACTTTTTGGCCAGGCGCGG + Intronic
1178016040 21:28347126-28347148 AAAGAGTTATTGGCCGGGTGTGG + Intergenic
1178595002 21:33945413-33945435 AAGAAATTGTTGGCCAGGTGTGG + Intergenic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179593721 21:42428324-42428346 GCAGCCTTGGTGGCTAGGTGAGG + Intronic
1179720291 21:43312765-43312787 ACAGGCGCGCTGGCCAGGTGAGG + Intergenic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179869517 21:44236307-44236329 ACAAACTAATTGGCCAGGCGCGG + Intronic
1180430111 22:15240799-15240821 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180512728 22:16109116-16109138 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180666202 22:17514741-17514763 ACAGACTTGTGGGCCAGGCGCGG + Intronic
1180895563 22:19329513-19329535 AGAGACTTGCTGTGCAGGTGAGG - Intergenic
1180939589 22:19649694-19649716 ATAGAAGAGTTGGCCAGGTGTGG + Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181591137 22:23885405-23885427 AAATACAGGTTGGCCAGGTGAGG + Exonic
1181676597 22:24457978-24458000 AAAAAAGTGTTGGCCAGGTGTGG - Intergenic
1181805442 22:25372045-25372067 ACAGACAGCTTGGCCAGGCGCGG - Intronic
1182374941 22:29839733-29839755 ATATGTTTGTTGGCCAGGTGTGG - Intergenic
1182433309 22:30313689-30313711 ACACATTTGTTGGCCAGGCACGG - Intronic
1182539873 22:31033392-31033414 ACAGAATTTCTGTCCAGGTGCGG + Intergenic
1182674861 22:32031093-32031115 AAATATGTGTTGGCCAGGTGTGG + Intergenic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1183207445 22:36429230-36429252 ATAAATTTGTAGGCCAGGTGCGG + Intergenic
1183568496 22:38633926-38633948 ATTGAATTATTGGCCAGGTGTGG + Intronic
1183607863 22:38877076-38877098 AGAAAGTTGTTGGCCGGGTGCGG - Intergenic
1183825613 22:40384488-40384510 AAATACATATTGGCCAGGTGCGG + Intronic
1183998255 22:41652654-41652676 AGTGAATTATTGGCCAGGTGAGG - Intronic
1184025931 22:41856417-41856439 AGAAAATTATTGGCCAGGTGTGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184485432 22:44775738-44775760 AAAGAGTTATGGGCCAGGTGCGG - Intronic
1184488900 22:44797961-44797983 AAAATCTTATTGGCCAGGTGCGG - Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
949184726 3:1176377-1176399 TCACTCTTGTTGCCCAGGTGCGG - Intronic
949519907 3:4841485-4841507 AAACACCTGTTTGCCAGGTGCGG + Intronic
950057888 3:10042184-10042206 ACAGACCTGTGGGCCAGGCACGG - Intronic
950784346 3:15421623-15421645 AAAATCTTTTTGGCCAGGTGCGG + Intronic
951531053 3:23698399-23698421 ACAAATTTCTGGGCCAGGTGCGG + Intergenic
951969302 3:28425817-28425839 ATATACATGTAGGCCAGGTGCGG + Intronic
952368760 3:32699074-32699096 AACCAGTTGTTGGCCAGGTGTGG - Intronic
953504908 3:43475890-43475912 ACAAATTTGTAGGCCAGGTGTGG - Intronic
953549521 3:43890596-43890618 ACAGACTTTGTGGCCAGGCCAGG + Intergenic
954124082 3:48518487-48518509 ACAGACTGGCTGGCAAGTTGTGG - Exonic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
954190054 3:48953218-48953240 TCAGAATTGCTGGCCAGGCGCGG - Intronic
954470872 3:50693976-50693998 ACAAAATTGTTGGCCAAGTGTGG + Intronic
954569529 3:51629004-51629026 ATAGTGTTGTTGGCCAGGTGTGG - Intronic
954768235 3:52941301-52941323 AAAGAGTTATTGGCCAGGCGCGG + Intronic
954973144 3:54668517-54668539 ACAGGCTTATTGCTCAGGTGTGG + Intronic
955079985 3:55649548-55649570 AAAAAATTATTGGCCAGGTGCGG - Intronic
955206286 3:56898764-56898786 ACACACTTCATGGCCAGGCGTGG + Intronic
955323642 3:57992969-57992991 ACAGACTTGTAGGCTGGGCGCGG + Intergenic
955371361 3:58354819-58354841 TAAGACCTGCTGGCCAGGTGTGG + Intronic
955666454 3:61354345-61354367 AAAAATTTGCTGGCCAGGTGTGG - Intergenic
955904629 3:63793863-63793885 AAATAATTGTTGGTCAGGTGTGG + Intergenic
955969312 3:64421373-64421395 ATAGTTATGTTGGCCAGGTGTGG + Intronic
956284456 3:67594036-67594058 TCGGACTTGTGGGCTAGGTGTGG - Intronic
956435958 3:69234856-69234878 ACAGAGATTTTGGCTAGGTGTGG + Intronic
956863114 3:73343896-73343918 AAAGTCTTTATGGCCAGGTGTGG - Intergenic
957459290 3:80496704-80496726 ACACCCTTGTAGGCCAGCTGTGG + Intergenic
957832301 3:85538315-85538337 ACAGAGCTGTTGGCAAGCTGTGG - Intronic
958649304 3:96917128-96917150 ACACATTTTTTGGCCGGGTGTGG + Intronic
958980946 3:100718846-100718868 AAAAACTTTTTGGCCAAGTGCGG - Intronic
959049553 3:101512108-101512130 ACAGATTTATTGGCCGGGCGCGG - Intronic
959205803 3:103304675-103304697 AAAGTGTTATTGGCCAGGTGCGG - Intergenic
959475525 3:106807508-106807530 AAAGTCTTCTTGGCCGGGTGTGG + Intergenic
959616940 3:108359328-108359350 AAATAAATGTTGGCCAGGTGGGG + Intronic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
959680553 3:109091151-109091173 ACATGTATGTTGGCCAGGTGCGG + Intronic
960244957 3:115390075-115390097 TCAGACTAATTGGCCAGGTCTGG + Intergenic
960319911 3:116221932-116221954 AAAGACTTTTTGGCCACATGGGG + Intronic
961210663 3:125123014-125123036 ACAGATTTAAGGGCCAGGTGTGG + Intronic
961589968 3:127971589-127971611 ACACACTTGTTTGCCACTTGTGG + Intronic
961752295 3:129103853-129103875 AAAGGCCTCTTGGCCAGGTGCGG - Intronic
961766309 3:129213876-129213898 ACCAAAGTGTTGGCCAGGTGTGG - Intergenic
962103127 3:132363646-132363668 ACAGAGTGGTTGGCCAGGCACGG + Intronic
962574945 3:136748063-136748085 ACATAATTCTTGGCCAGGCGCGG - Intronic
962601171 3:136991898-136991920 ACACAGTTATTGGCCAAGTGCGG - Intronic
962776587 3:138666909-138666931 AAAGACTTCCTGGCCGGGTGCGG + Intronic
962932686 3:140052444-140052466 ACAGAAATATTGGCCAGGTGCGG - Intronic
964251834 3:154727188-154727210 AAAGAATTTGTGGCCAGGTGTGG + Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964362779 3:155915687-155915709 ACAAAATTAGTGGCCAGGTGTGG - Intronic
965072875 3:163938142-163938164 ATTTATTTGTTGGCCAGGTGCGG + Intergenic
965638362 3:170807702-170807724 AAAAACCTTTTGGCCAGGTGCGG + Intronic
965725548 3:171711457-171711479 ACAGTTTTCCTGGCCAGGTGCGG - Intronic
965970947 3:174555588-174555610 ACTGAATTTTTGGCCAGGCGCGG - Intronic
966080322 3:175992372-175992394 ACAGATTTTCTGGCCAGGTGTGG + Intergenic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966380447 3:179339327-179339349 AGAGGGTTGTTAGCCAGGTGTGG + Intergenic
966713862 3:182996292-182996314 AAAGAATTGAGGGCCAGGTGCGG - Intergenic
966943821 3:184763625-184763647 ACAGACCTTAAGGCCAGGTGTGG + Intergenic
966999129 3:185314960-185314982 TGATACATGTTGGCCAGGTGCGG + Intronic
967009091 3:185414879-185414901 AAAGATTTTTTGGCCAGGCGTGG + Intronic
967126668 3:186430284-186430306 AGGGCCTTTTTGGCCAGGTGTGG + Intergenic
967791028 3:193549537-193549559 AAATACATATTGGCCAGGTGTGG + Intronic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
969476766 4:7426434-7426456 AAAGTGTTGTAGGCCAGGTGTGG + Intronic
969879497 4:10161401-10161423 TCAGACTTGCTGTCCAGCTGCGG - Intergenic
970581039 4:17474323-17474345 ACAGACAAGTTGGTCAGGCGTGG + Intronic
970634296 4:17990387-17990409 AGAGAGTTTTTGGCCAGGCGTGG - Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971284557 4:25275092-25275114 ACAGAAACGTTGACCAGGTGTGG - Intronic
971398690 4:26254990-26255012 TTAAACATGTTGGCCAGGTGCGG - Intronic
971475412 4:27067551-27067573 ACAGACTTGATGACTGGGTGTGG - Intergenic
971479721 4:27103758-27103780 AAATCCTTCTTGGCCAGGTGTGG + Intergenic
971553157 4:27979235-27979257 ACAGTCATGGTGGTCAGGTGTGG - Intergenic
972336950 4:38115390-38115412 AGAAAACTGTTGGCCAGGTGTGG - Intronic
972461453 4:39307424-39307446 ACAGTCTTCTTGGCTGGGTGCGG + Intronic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
974079997 4:57202360-57202382 AAACACTTGTAGACCAGGTGTGG + Intergenic
974938181 4:68432858-68432880 AGAAAATTATTGGCCAGGTGCGG + Intergenic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975378702 4:73673777-73673799 AAAGATATTTTGGCCAGGTGCGG + Intergenic
975651534 4:76598314-76598336 ATAGATTTTTTGGCCAGGTGTGG - Intronic
976236612 4:82903510-82903532 AGAAACTTGTCGGCCAGGCGTGG - Intronic
976392182 4:84517026-84517048 AATGATTTGTGGGCCAGGTGCGG - Intergenic
976708838 4:88047264-88047286 AAAAACTTGTCGGCCAGGTGTGG + Intronic
977422560 4:96821367-96821389 AAAAACTTGTGGGCCAGGCGCGG + Intergenic
978448467 4:108803459-108803481 ACAGACTAGACGGCCGGGTGCGG + Intergenic
978501809 4:109417870-109417892 AAAGAATTCTTGGCCAGGCGCGG + Intergenic
978629962 4:110732745-110732767 AGTGAATTGTTGGCCAGGCGCGG - Intergenic
979371527 4:119894149-119894171 AAAAACATTTTGGCCAGGTGTGG + Intergenic
980145290 4:128975327-128975349 AAAAAGTTGTTGGCCGGGTGTGG - Intronic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
981599398 4:146468750-146468772 AAAGCCTTGCTGGCCAGGCGCGG - Intronic
982135872 4:152273517-152273539 ACAGACTTCTTGGACTGCTGAGG - Intergenic
982252896 4:153425147-153425169 ACATATTTATTGGCCAGGCGCGG + Intergenic
982506735 4:156228035-156228057 CCAGACTTGGTGGCCAGGTGAGG + Intergenic
982896819 4:160941068-160941090 AAAGAATTGTTGGCCAGTTGCGG + Intergenic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983577938 4:169278345-169278367 AAAGTTATGTTGGCCAGGTGCGG - Intergenic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984200968 4:176720810-176720832 TCACTCTTGTTGCCCAGGTGGGG - Intronic
984629903 4:182050281-182050303 ACATATTTTTAGGCCAGGTGTGG - Intergenic
985150954 4:186946411-186946433 ACAGCCTTGATGGCCAGGAAAGG + Intergenic
985209420 4:187576361-187576383 ACATAAGTTTTGGCCAGGTGTGG - Intergenic
986097484 5:4573960-4573982 ACAGCCTGGTGGGCCAGGCGCGG - Intergenic
986167339 5:5286566-5286588 AAAGAGTTTTTAGCCAGGTGAGG + Intronic
986392165 5:7297285-7297307 ACCACCTTATTGGCCAGGTGCGG - Intergenic
987039849 5:14052133-14052155 ATACAGTGGTTGGCCAGGTGTGG - Intergenic
987142977 5:14963950-14963972 AAATTCTTCTTGGCCAGGTGTGG - Intergenic
987177920 5:15335464-15335486 AAAAACTTCTTGGCCAGGTGTGG - Intergenic
987605634 5:20132177-20132199 ACTTTATTGTTGGCCAGGTGTGG - Intronic
988670167 5:33372621-33372643 ACAGATTTTTAGGCCAGGCGTGG - Intergenic
989154061 5:38327086-38327108 ATACCCTTATTGGCCAGGTGCGG - Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
989402265 5:41021585-41021607 ACAGACATATAGGCCAGGTATGG + Intronic
989604290 5:43229089-43229111 AAAGACTTTTGGGCCAGGTGTGG + Intronic
989688626 5:44116189-44116211 ACAGTCATGGGGGCCAGGTGTGG + Intergenic
990211319 5:53483256-53483278 CCAGACTTCTTAGCCAAGTGTGG + Intronic
990425545 5:55684942-55684964 ACAGAGCTTTTGGCCAGGCGTGG - Intronic
990733808 5:58838087-58838109 AACAACTTTTTGGCCAGGTGCGG + Intronic
990975028 5:61552417-61552439 ACAAACTTTTTAGACAGGTGTGG + Intergenic
990997728 5:61749548-61749570 AGAGAGTGGTTGGCCAGGCGTGG - Intronic
991350065 5:65711955-65711977 AGAAACATGTGGGCCAGGTGTGG + Intronic
991444525 5:66684969-66684991 AAAGAATAGCTGGCCAGGTGGGG + Intronic
991665932 5:69000045-69000067 AAAGAAGTATTGGCCAGGTGTGG - Intergenic
992053524 5:72963839-72963861 ACAGCCTATCTGGCCAGGTGTGG - Intronic
992136932 5:73755429-73755451 AGAGACTTGCTGGCCTGGGGAGG - Intronic
992257667 5:74937496-74937518 ACAGACTTTAGGGCCAGGTGTGG - Intergenic
992470870 5:77052060-77052082 TAAGAATTTTTGGCCAGGTGTGG + Intronic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
992664269 5:78990782-78990804 AAAGACTTTGGGGCCAGGTGTGG - Intergenic
993187421 5:84637358-84637380 TAAAACTTTTTGGCCAGGTGTGG + Intergenic
993988648 5:94628119-94628141 AAAGTATTGTTGGCCAGGAGCGG - Intronic
994753575 5:103767659-103767681 ATAGATTAGTAGGCCAGGTGTGG - Intergenic
995129643 5:108616408-108616430 AAAAGCTTCTTGGCCAGGTGCGG - Intergenic
995514488 5:112940294-112940316 ACATAAAAGTTGGCCAGGTGTGG - Intergenic
995761682 5:115568415-115568437 ATATAGCTGTTGGCCAGGTGTGG - Intergenic
995903008 5:117092045-117092067 AAAGACTTCTTGGCTAGGTGTGG - Intergenic
996077813 5:119218084-119218106 ACAAAATTATTGGCCAGGTGTGG + Intronic
996087404 5:119319116-119319138 AAAGTATTCTTGGCCAGGTGTGG + Intronic
996209327 5:120785857-120785879 AGAGACTTCTAGGCCAGGCGCGG - Intergenic
996435054 5:123424846-123424868 GAAGACTTTTTGGCCAGGTGTGG + Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997172679 5:131739521-131739543 ACACACTGTTTGGCCAGGCGTGG + Intronic
997811327 5:136973289-136973311 AAAGAGGTATTGGCCAGGTGTGG + Intergenic
997931094 5:138071922-138071944 ACATATTTTTTGGCCGGGTGTGG + Intergenic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
998223575 5:140307771-140307793 ACATATTTTTTGGCCAGGCGTGG - Intergenic
998435569 5:142105278-142105300 AGGGCTTTGTTGGCCAGGTGTGG - Intergenic
998928551 5:147155403-147155425 TCAGACTTGGGGGCCACGTGCGG + Intergenic
999050295 5:148516606-148516628 AGGGAATTTTTGGCCAGGTGCGG - Intronic
999751732 5:154632432-154632454 AAAGATTGGTTAGCCAGGTGTGG - Intergenic
1000256094 5:159540130-159540152 ACAGATTTCAGGGCCAGGTGCGG + Intergenic
1001587389 5:172842659-172842681 AAAGACATGTTGGCAAGATGTGG - Intronic
1001614467 5:173031526-173031548 ACAGGCTTCCTGGCCAGGCGAGG + Intronic
1001993839 5:176138127-176138149 ACTTAGTTGTTGGCCGGGTGCGG - Intergenic
1002295403 5:178227986-178228008 ATAGCCTTCTTGGGCAGGTGAGG + Intronic
1002345643 5:178546133-178546155 AGAGTCTTACTGGCCAGGTGGGG - Intronic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1002474017 5:179453751-179453773 ACAGCCTTGGTGGAGAGGTGGGG - Intergenic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1003108740 6:3235641-3235663 GCAGACTAGTGGGCCAGTTGGGG - Intronic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003479873 6:6521035-6521057 AAAATCTAGTTGGCCAGGTGCGG - Intergenic
1003610596 6:7611333-7611355 ACATACTTTTTAGACAGGTGTGG - Exonic
1003659570 6:8047434-8047456 AAAAAATTGTTGGCCAGGCGTGG - Intronic
1003907106 6:10711797-10711819 AAAGAACTCTTGGCCAGGTGCGG - Intergenic
1003913527 6:10764465-10764487 ACAGACTGGGTGGCCAAGTATGG - Exonic
1003990448 6:11481577-11481599 ACAGAACAGTTAGCCAGGTGTGG + Intergenic
1004024134 6:11802831-11802853 ACAGGATTCTTAGCCAGGTGCGG + Intronic
1004120836 6:12820468-12820490 AAACACTAGTTGGCTAGGTGAGG - Intronic
1004220856 6:13745087-13745109 AAAGTCTTGTTGGCTGGGTGCGG + Intergenic
1004386521 6:15177808-15177830 ATAAACTTGTTGGCCGGGTGCGG + Intergenic
1004488263 6:16088932-16088954 AAAGACGTTTAGGCCAGGTGCGG + Intergenic
1004598986 6:17129552-17129574 AAAAAATTGTTGGCCAGGCGCGG + Intronic
1004695870 6:18032592-18032614 AAAAACTTCTTAGCCAGGTGTGG + Intergenic
1004696661 6:18040508-18040530 AAAAACTTGTTAGCCAGGTGCGG + Intergenic
1005078626 6:21934042-21934064 AATGAACTGTTGGCCAGGTGCGG - Intergenic
1005126294 6:22450316-22450338 ACAGAAAAGTTAGCCAGGTGTGG - Intergenic
1005606288 6:27481230-27481252 AAATACTTATTGGCCAGGCGAGG + Intergenic
1005860162 6:29894240-29894262 AAAGATTTGTGGGCCAGGAGTGG - Intergenic
1006118314 6:31787684-31787706 ACAAACTTGGAGGCCAGGTATGG + Intronic
1006268258 6:32943617-32943639 AAAGACTTGTTGGCCGGGCATGG + Intronic
1007069630 6:39026928-39026950 AAAGGCTTTTTGGCCAAGTGCGG + Intronic
1007142698 6:39591820-39591842 CCTGACTTTTTGGCCAGGAGCGG + Intronic
1007935244 6:45726962-45726984 AAAGAGTTGTAGGCCAGGCGTGG + Intergenic
1008068132 6:47072348-47072370 AGAGAGTTGTTGGCCGGGTGTGG - Intergenic
1008110469 6:47487398-47487420 AAAAACTTCTTGGCCAGGCGCGG + Intronic
1008136626 6:47784586-47784608 ACACACATCTTGGCCAGGCGCGG - Intronic
1009270044 6:61603826-61603848 ACAGTCATGGTGGTCAGGTGTGG - Intergenic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010546938 6:77170525-77170547 AGACACATGCTGGCCAGGTGAGG - Intergenic
1010827276 6:80488411-80488433 TCAGTCTTGTTGGCTAGGTGCGG + Intergenic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011620646 6:89239338-89239360 GTGGACTTGGTGGCCAGGTGTGG - Intergenic
1011773424 6:90701074-90701096 AGTGAGTAGTTGGCCAGGTGGGG + Intergenic
1013591543 6:111623104-111623126 AAAGATTTGTTAGCCAGGTGTGG - Intergenic
1015226355 6:130861579-130861601 TCAAAAATGTTGGCCAGGTGTGG + Intronic
1015410870 6:132892525-132892547 AAAATCTTGTTGGCCAGGTGCGG + Intergenic
1016016545 6:139192223-139192245 ACATACTTGTCTGCCAGCTGAGG + Intergenic
1016064375 6:139663888-139663910 ACTGAATTGTTGGTCGGGTGCGG - Intergenic
1016129737 6:140452676-140452698 ATATAATTGTTGGTCAGGTGTGG + Intergenic
1016682656 6:146848855-146848877 ACGTAATTGTGGGCCAGGTGCGG - Intergenic
1017070331 6:150570371-150570393 AGAGACGTGAGGGCCAGGTGCGG - Intergenic
1017130564 6:151105017-151105039 ATGCACTTGTTGGCCAGGTGTGG - Intergenic
1017164788 6:151397742-151397764 ATAGACTTAGTGGCCAAGTGCGG + Intergenic
1017437911 6:154435283-154435305 AGAGATTTGTGGGCCGGGTGTGG - Intronic
1017689712 6:156951731-156951753 AATGAAGTGTTGGCCAGGTGCGG - Intronic
1017837009 6:158187854-158187876 ACAGAGATCTTGGCCGGGTGCGG - Intronic
1017897826 6:158696491-158696513 AAATAAGTGTTGGCCAGGTGCGG - Intronic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1017937703 6:159021115-159021137 AGAAACATGTTGGCCAGGCGCGG - Intergenic
1018176962 6:161185444-161185466 CAAGACATCTTGGCCAGGTGTGG - Intronic
1018289665 6:162279038-162279060 TCAGAAATGTTGGCGAGGTGAGG + Intronic
1018362054 6:163080457-163080479 TCAGTCTTGTTGCCCAGGTTGGG - Intronic
1018428618 6:163705396-163705418 AAAAAATTGCTGGCCAGGTGCGG - Intergenic
1018571180 6:165211703-165211725 ATACACTTTTTGGCCGGGTGTGG + Intergenic
1018984210 6:168623624-168623646 AAATAATTATTGGCCAGGTGTGG - Intronic
1020216213 7:6192821-6192843 ATTGACTTGTGGGCCAGGTGTGG - Intronic
1020233630 7:6339175-6339197 TCACACCTGATGGCCAGGTGTGG + Intronic
1020876677 7:13704231-13704253 AAAGACTGTTGGGCCAGGTGTGG + Intergenic
1021126135 7:16852749-16852771 AGAGACTTGGGGGCCAGGAGGGG - Intergenic
1021157944 7:17235270-17235292 AAATGCTTTTTGGCCAGGTGCGG + Intergenic
1021637627 7:22707494-22707516 ACAGTCATGGTGGTCAGGTGTGG - Intergenic
1021879223 7:25077514-25077536 AGAGACATTTTGGCCAGGCGTGG + Intergenic
1022162849 7:27728853-27728875 ACATACTTCTGGGCCGGGTGCGG - Intergenic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023249586 7:38243228-38243250 AAAGAATTCTTGGTCAGGTGTGG - Intergenic
1023627201 7:42127854-42127876 ACAAAATTATTAGCCAGGTGTGG + Intronic
1024030461 7:45455980-45456002 ACAGACTCACTGGCCAGGAGAGG + Intergenic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1024285653 7:47755345-47755367 ACAGAATCATGGGCCAGGTGAGG - Intronic
1024329896 7:48145174-48145196 GCAGAGTTTATGGCCAGGTGTGG - Intergenic
1024495078 7:50036438-50036460 ACATATTTATTGGCCAGGCGTGG - Intronic
1025103917 7:56155379-56155401 AAAGACATGGGGGCCAGGTGAGG + Intergenic
1025984828 7:66440632-66440654 ACATACTTTCTGGCCAGATGCGG - Intergenic
1025999564 7:66550464-66550486 AAACACTGATTGGCCAGGTGTGG + Intergenic
1026466897 7:70662064-70662086 CCAGAGATGTGGGCCAGGTGGGG + Intronic
1026887062 7:73956848-73956870 ACAAAGTTTTTGGCCAGGTGGGG + Intergenic
1026928618 7:74210535-74210557 ACAGAGTTGAGGGCCAGGTAGGG - Intronic
1026992743 7:74596661-74596683 AAACACTGATTGGCCAGGTGTGG + Intronic
1027193351 7:76010922-76010944 ATACACTAGTTGGCCAGGTGTGG + Intronic
1027344033 7:77238776-77238798 ACTGAGTTGTGGGCCAGGGGAGG - Intronic
1027464582 7:78499414-78499436 TCAAACTTGTTGGCAAGATGGGG - Intronic
1028575044 7:92339330-92339352 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1028803551 7:94997092-94997114 ACAGAGTATCTGGCCAGGTGTGG - Intronic
1029077324 7:97945410-97945432 AAAGACACCTTGGCCAGGTGTGG - Intergenic
1029085792 7:98010708-98010730 ACTCTCATGTTGGCCAGGTGCGG + Intergenic
1029670534 7:102027568-102027590 ACATCGTTGTAGGCCAGGTGCGG + Intronic
1030010148 7:105157783-105157805 ACACACGCATTGGCCAGGTGTGG + Intronic
1030445838 7:109646029-109646051 AGAAAATTGTTGGGCAGGTGGGG + Intergenic
1030701830 7:112648550-112648572 CCATCCTTGTTGGCCAGTTGGGG - Intergenic
1030842355 7:114371374-114371396 ATTAAGTTGTTGGCCAGGTGCGG - Intronic
1031903468 7:127435631-127435653 ACACATTTTTTGGCCAGGCGTGG + Intergenic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032254686 7:130287599-130287621 ACTAACTTCTGGGCCAGGTGTGG - Intronic
1032821301 7:135526747-135526769 GAAAACTTGCTGGCCAGGTGTGG + Intergenic
1033190650 7:139275673-139275695 AAAGATCTGTTGGCCAGGTGTGG + Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033397835 7:140992767-140992789 TCAGACTTGTTGCCCTGGTCTGG + Intergenic
1034301320 7:150017688-150017710 ACAGACTGGTGGGCCAGGGTTGG - Intergenic
1034344152 7:150375722-150375744 ACAGAGTTGTTGCCCAGGCTGGG - Intronic
1034427108 7:151019729-151019751 ACAGACTGGCTGGCCAGGGGCGG + Intronic
1034540006 7:151751801-151751823 AGAGAGTAGTTGGCCAGGTGAGG - Intronic
1034679478 7:152917691-152917713 AGTGACTTGTTGGCTGGGTGAGG - Intergenic
1034804731 7:154079610-154079632 ACAGACTGGTGGGCCAGGGTTGG + Intronic
1035931506 8:3785375-3785397 AGACCCTTGATGGCCAGGTGTGG - Intronic
1035982956 8:4393264-4393286 ACTGCTTTGTAGGCCAGGTGGGG - Intronic
1036167287 8:6447837-6447859 ACAAAATTGTTGGCCGGGCGCGG - Intronic
1036190406 8:6664740-6664762 AGGGATTTGTTGGCCTGGTGTGG - Intergenic
1036451967 8:8876665-8876687 AAAAACTTATAGGCCAGGTGTGG - Intronic
1037035692 8:14163751-14163773 ACAGTCCTGTGGGTCAGGTGAGG - Intronic
1037088160 8:14879032-14879054 ACCTAATTGTAGGCCAGGTGTGG + Intronic
1037534313 8:19810642-19810664 ACAGACTTGTCTGACAGGTCAGG + Intergenic
1037691992 8:21189434-21189456 TCAGACTTCGTGGCCAGGTGTGG - Intergenic
1037801036 8:22036091-22036113 AGACATTTGTGGGCCAGGTGTGG + Intronic
1038282705 8:26180409-26180431 ATAATCTTCTTGGCCAGGTGCGG - Intergenic
1038364081 8:26913336-26913358 ACAGACTTATTAGGCAGATGAGG + Intergenic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038874939 8:31538266-31538288 ACAAATTTGTCAGCCAGGTGTGG - Intergenic
1039087464 8:33794167-33794189 ACAGGCTTGTTGGCCAGGCGCGG + Intergenic
1039265354 8:35817554-35817576 AAAGAATTTTTGGCCAGGCGCGG + Intergenic
1039530489 8:38257221-38257243 AAAAACTTGTTGGCCAGATATGG - Intronic
1039963654 8:42268855-42268877 AAATATTTATTGGCCAGGTGAGG - Intergenic
1039968393 8:42300191-42300213 ACAGACTTGAAGGCCAGCTGTGG - Intronic
1040041993 8:42925386-42925408 ACAGTCAAGTTGGCCAGGTATGG - Intronic
1040391126 8:46951440-46951462 ACAGACCATTTGCCCAGGTGTGG - Intergenic
1040459814 8:47636528-47636550 ACAGCCAAGTTGGCCAGGCGCGG + Intronic
1041267422 8:56078514-56078536 AAAGACATGTTGGCCTGGCGTGG - Intergenic
1042313578 8:67401893-67401915 AAAGACTTGATGTCCAGCTGTGG + Intergenic
1042403303 8:68374203-68374225 AAAGAATTATAGGCCAGGTGTGG - Intronic
1042546690 8:69957420-69957442 ACAGACATCTAGGCCAGGCGCGG + Intergenic
1042548401 8:69971533-69971555 ACAAAATTTTTGGCCAGGAGTGG - Intergenic
1043461223 8:80462122-80462144 AGAGACTAGTTGGCTGGGTGTGG + Intergenic
1044680048 8:94768701-94768723 TAAGATGTGTTGGCCAGGTGCGG + Intronic
1044982330 8:97729215-97729237 AGCCACATGTTGGCCAGGTGTGG - Intergenic
1045292628 8:100846947-100846969 AAAAACTTTTTGACCAGGTGCGG - Intergenic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1045355067 8:101379051-101379073 AAAGACATCTTGGCCAGGCGCGG - Intergenic
1045601423 8:103722077-103722099 GAACACTTATTGGCCAGGTGTGG + Intronic
1046978086 8:120305268-120305290 AAAGAGTTTTTGGCCAGGTGCGG - Intronic
1047225069 8:122949554-122949576 ACAGTCTTCTTGGCCAGGCATGG + Intronic
1047237243 8:123052558-123052580 TCATATTTATTGGCCAGGTGCGG + Intronic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047281707 8:123451627-123451649 ACAGACTTTTAGACCAGGTGTGG - Intronic
1047448584 8:124942163-124942185 AAAGACATGGAGGCCAGGTGCGG + Intergenic
1047614076 8:126548588-126548610 AAATATTTCTTGGCCAGGTGAGG - Intergenic
1049068181 8:140335996-140336018 AAAATATTGTTGGCCAGGTGCGG - Intronic
1049288713 8:141790579-141790601 ACAGACCTGGTGGACAGGCGGGG + Intergenic
1050076858 9:1874814-1874836 ACTGCTTTCTTGGCCAGGTGTGG + Intergenic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1050507888 9:6366401-6366423 ACAAACTCCTGGGCCAGGTGTGG + Intergenic
1050667999 9:7963297-7963319 AGAGACTTGTTGCCCAGCTGTGG + Intergenic
1051228053 9:14923344-14923366 AGAGATTTGTTGGCCAAGTAGGG + Intergenic
1052096137 9:24386744-24386766 ACAGTCTTTTAGGCCAGGTATGG + Intergenic
1052301124 9:26953798-26953820 ATAAATTTTTTGGCCAGGTGTGG - Intronic
1052813222 9:33079973-33079995 ACATATTGATTGGCCAGGTGTGG + Intergenic
1052925169 9:34009387-34009409 AAAACCTTTTTGGCCAGGTGTGG - Intronic
1052943106 9:34145999-34146021 TAAAACCTGTTGGCCAGGTGCGG + Intergenic
1053586395 9:39463565-39463587 TCAGAATTTTTGGCCAGGCGCGG - Intergenic
1053709530 9:40791622-40791644 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1053760806 9:41349042-41349064 ACGGACTTGGTGTCCAGTTGAGG - Intergenic
1054148553 9:61582408-61582430 ACACACAAATTGGCCAGGTGTGG - Intergenic
1054419434 9:64912410-64912432 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1054758755 9:68985540-68985562 AGAGATCTGTTGGCCAGGTGTGG - Intronic
1055057968 9:72040968-72040990 ACAAACTTATTGGCCGGGTGTGG + Intergenic
1055309906 9:74967787-74967809 AGAGACTTTTTGGCCATGTGTGG - Intergenic
1055320025 9:75074211-75074233 AAAGACTTAATGGCCAGGTGCGG - Intronic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1055412073 9:76041549-76041571 AAAGAATTTATGGCCAGGTGCGG + Intronic
1055496069 9:76857042-76857064 AGAGACATGTTGGCCAGGCGCGG - Intronic
1055509368 9:76980181-76980203 AAACATTTATTGGCCAGGTGCGG - Intergenic
1055590313 9:77805692-77805714 GCAAACTTTTTGGCCGGGTGCGG - Intronic
1055712522 9:79079080-79079102 AGAGACTGGTTAGCCAGGAGGGG + Intergenic
1056406251 9:86278372-86278394 ATATATTTGTAGGCCAGGTGTGG + Intronic
1057100085 9:92351198-92351220 ACAGAAACTTTGGCCAGGTGTGG + Intronic
1057794724 9:98146974-98146996 AGAAACATATTGGCCAGGTGTGG + Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1057990992 9:99769454-99769476 AAACACTAGCTGGCCAGGTGTGG + Intergenic
1058470091 9:105268786-105268808 AGAAAATTGTTGGCCAGGTACGG - Intronic
1058542518 9:106026715-106026737 ACAGCTTTTCTGGCCAGGTGCGG + Intergenic
1058846488 9:108965149-108965171 ACAGTGTAGTAGGCCAGGTGTGG - Intronic
1058960863 9:109991540-109991562 AAAGACGTGGTGGCCAAGTGTGG - Intronic
1059113212 9:111576798-111576820 AAAGAACTCTTGGCCAGGTGTGG + Intronic
1059122230 9:111651594-111651616 ACAGAATTGCAGGCTAGGTGCGG + Intronic
1059264831 9:113017269-113017291 AAAAAATTGTTGGCCAGGCGCGG - Intergenic
1059971577 9:119674116-119674138 AGAAAATTTTTGGCCAGGTGCGG - Intergenic
1060002412 9:119970373-119970395 ACAGAATCATTGGCCAGGTGTGG - Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060577151 9:124706804-124706826 ACAAAATTGTTGGCCGGGCGAGG - Intronic
1060660736 9:125403834-125403856 AGAAAATTGTTGGCCAGGCGCGG - Intergenic
1060855325 9:126910454-126910476 ATAGCTTTATTGGCCAGGTGTGG + Intergenic
1061099419 9:128481178-128481200 ACAGTTTTTTGGGCCAGGTGTGG + Intronic
1061271030 9:129542757-129542779 ACAGGATTGTTGGCTGGGTGTGG - Intergenic
1061342849 9:129997032-129997054 ACTGAGATTTTGGCCAGGTGAGG + Intronic
1062663433 9:137652879-137652901 ACAGAAAAGTTAGCCAGGTGTGG - Intronic
1202792723 9_KI270719v1_random:97954-97976 ACGGACTTGTTGTCCAATTGAGG + Intergenic
1186162338 X:6791063-6791085 ATATATTTGTTGGCCAGATGTGG + Intergenic
1186493574 X:9993990-9994012 ACAGTGTTGTTGGCCAGGCGTGG - Intergenic
1186511452 X:10132876-10132898 AAAGACATCTTGGTCAGGTGCGG - Intronic
1186580963 X:10817907-10817929 AAAATCATGTTGGCCAGGTGCGG - Intronic
1186834747 X:13426630-13426652 ACTAGCTTCTTGGCCAGGTGTGG + Intergenic
1187502264 X:19849396-19849418 ACAGACTCAGAGGCCAGGTGCGG + Intronic
1187842251 X:23500732-23500754 AAAGAAAAGTTGGCCAGGTGCGG - Intergenic
1187890985 X:23934812-23934834 ACTGATTAGTTGGCCAGGTGCGG - Intronic
1187892171 X:23946572-23946594 ACAGCATGGTTGGCCAGGCGCGG + Intergenic
1188172486 X:26944324-26944346 ACATGCTTATTGGCCGGGTGCGG - Intergenic
1188314150 X:28653182-28653204 AAAGCTTTCTTGGCCAGGTGTGG + Intronic
1188363550 X:29286389-29286411 AAAAATTTGGTGGCCAGGTGTGG + Intronic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1189214610 X:39312200-39312222 AAATGCTTATTGGCCAGGTGCGG - Intergenic
1189379578 X:40492481-40492503 ATAGCTTTGTTGGCCAGGCGTGG - Intergenic
1189405015 X:40713731-40713753 TAAGAGTTGATGGCCAGGTGCGG - Intronic
1189521049 X:41768675-41768697 AAAGAATTCTTCGCCAGGTGTGG + Intronic
1189616844 X:42793145-42793167 AAAGTCCTTTTGGCCAGGTGCGG + Intergenic
1189779791 X:44503249-44503271 AAAGACATTTTGACCAGGTGCGG + Intergenic
1189797852 X:44662848-44662870 CAAAACTTGTTGGCCGGGTGCGG - Intergenic
1190201173 X:48362566-48362588 ACAAACAAGTTAGCCAGGTGTGG - Intergenic
1190378908 X:49818811-49818833 AAAGAAAAGTTGGCCAGGTGTGG + Intergenic
1190565748 X:51729008-51729030 AGACACTTGTGGGCCAGGTGTGG - Intergenic
1190754746 X:53391773-53391795 AAATAAATGTTGGCCAGGTGTGG - Intronic
1191086367 X:56571708-56571730 AGAGTCTTCTTGGCCAGGAGCGG - Intergenic
1191791427 X:64976187-64976209 ACAGACTTGCCGGAGAGGTGAGG - Intronic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1192178257 X:68899232-68899254 ACAGACTGGTAGGCCTGGTATGG + Intergenic
1192401204 X:70838126-70838148 ACACATTTGTTGGCCAGGCACGG + Intronic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192746455 X:73943613-73943635 AAAGAGTTGGTAGCCAGGTGTGG - Intergenic
1193133908 X:77948414-77948436 AAAGACTTTTTAGCCAGGCGCGG - Intronic
1193828518 X:86257696-86257718 CAAGAGTTGTAGGCCAGGTGTGG - Intronic
1194314908 X:92365530-92365552 ACAAACCTACTGGCCAGGTGTGG - Intronic
1194367345 X:93026803-93026825 ACAGTCATGTGGGTCAGGTGTGG - Intergenic
1194706273 X:97179365-97179387 ACGGGCTTGTTGGGGAGGTGAGG - Intronic
1194711655 X:97243074-97243096 AATAACTTTTTGGCCAGGTGCGG - Intronic
1194817520 X:98462523-98462545 AAACACTTTTTGGCCAGGTCTGG - Intergenic
1195382736 X:104286206-104286228 AAAGATTTGCTGGTCAGGTGTGG + Intergenic
1195467881 X:105200619-105200641 AAAGAATGATTGGCCAGGTGCGG + Intronic
1195682736 X:107560977-107560999 ACATACGGCTTGGCCAGGTGTGG + Intronic
1195931696 X:110084211-110084233 CAAGAATAGTTGGCCAGGTGTGG + Intronic
1196180417 X:112683906-112683928 ACAGATTTAGTGGCCAGGCGCGG + Intergenic
1196405000 X:115352007-115352029 AAAAAGTTGTTGGCCGGGTGCGG + Intergenic
1196476951 X:116098267-116098289 AAACAATTATTGGCCAGGTGTGG - Intergenic
1196674687 X:118407208-118407230 AGTGACTTATCGGCCAGGTGCGG + Intronic
1196722043 X:118863646-118863668 ATAGAAGTGTTAGCCAGGTGCGG + Intergenic
1196830059 X:119768664-119768686 AAATACTTGTAGGCCAGGCGCGG - Intergenic
1197169310 X:123413441-123413463 ACAGACATGTTGGCAAAGAGAGG + Intronic
1197205940 X:123790599-123790621 ACAAAAATCTTGGCCAGGTGCGG - Intergenic
1197434400 X:126408068-126408090 AAAGAGTTTTTGGCCGGGTGCGG + Intergenic
1197740832 X:129892311-129892333 ATAGAATTCTGGGCCAGGTGTGG - Intergenic
1197969505 X:132100420-132100442 ACAGTCACCTTGGCCAGGTGCGG - Intronic
1198205981 X:134465191-134465213 AAAGACATGTTGGCCAGATGCGG - Intronic
1198751230 X:139938090-139938112 AGAAATTTCTTGGCCAGGTGTGG - Intronic
1199799584 X:151236344-151236366 ACAAAAATGTTAGCCAGGTGTGG - Intergenic
1200087980 X:153619439-153619461 AAATACTTCTGGGCCAGGTGTGG - Intergenic
1200622959 Y:5477060-5477082 ACAAACGTACTGGCCAGGTGTGG - Intronic
1200675557 Y:6143062-6143084 ACAGTCATGTGGGTCAGGTGTGG - Intergenic
1200780427 Y:7210679-7210701 CCAGTCTTCTTAGCCAGGTGTGG + Intergenic
1200947459 Y:8859992-8860014 ACAGACTTTTTGGCCAGGTGTGG + Intergenic
1202255794 Y:22918996-22919018 AATGTGTTGTTGGCCAGGTGTGG + Intergenic
1202376219 Y:24240047-24240069 AAAAACAAGTTGGCCAGGTGTGG + Intergenic
1202408785 Y:24552745-24552767 AATGTGTTGTTGGCCAGGTGTGG + Intergenic
1202461998 Y:25117335-25117357 AATGTGTTGTTGGCCAGGTGTGG - Intergenic
1202494561 Y:25430071-25430093 AAAAACAAGTTGGCCAGGTGTGG - Intergenic