ID: 964358482

View in Genome Browser
Species Human (GRCh38)
Location 3:155871017-155871039
Sequence CTACGACGCGTGGCTGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964358482_964358488 -9 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358488 3:155871031-155871053 GCGTCGTAGAGTCCCTGGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
964358482_964358490 -1 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358490 3:155871039-155871061 GAGTCCCTGGTCGGGGCCTGTGG 0: 1
1: 0
2: 2
3: 18
4: 207
964358482_964358495 15 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358495 3:155871055-155871077 CCTGTGGCATGTTTTATCTCGGG 0: 1
1: 0
2: 0
3: 13
4: 134
964358482_964358496 20 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358496 3:155871060-155871082 GGCATGTTTTATCTCGGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
964358482_964358489 -8 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358489 3:155871032-155871054 CGTCGTAGAGTCCCTGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 19
964358482_964358487 -10 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358487 3:155871030-155871052 CGCGTCGTAGAGTCCCTGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 12
964358482_964358493 14 Left 964358482 3:155871017-155871039 CCCCGGGCAGCCACGCGTCGTAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 964358493 3:155871054-155871076 GCCTGTGGCATGTTTTATCTCGG 0: 1
1: 0
2: 1
3: 6
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964358482 Original CRISPR CTACGACGCGTGGCTGCCCG GGG (reversed) Intronic