ID: 964359347

View in Genome Browser
Species Human (GRCh38)
Location 3:155878136-155878158
Sequence GAGGTGAGGTCTTTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 3, 2: 37, 3: 115, 4: 575}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964359347_964359357 26 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359357 3:155878185-155878207 TTTCAACATATGAATTTTAGGGG 0: 65
1: 522
2: 1734
3: 3253
4: 4775
964359347_964359358 27 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359358 3:155878186-155878208 TTCAACATATGAATTTTAGGGGG 0: 69
1: 416
2: 1411
3: 2610
4: 3343
964359347_964359355 24 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359355 3:155878183-155878205 GGTTTCAACATATGAATTTTAGG 0: 123
1: 846
2: 2215
3: 3638
4: 4509
964359347_964359356 25 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359356 3:155878184-155878206 GTTTCAACATATGAATTTTAGGG 0: 41
1: 347
2: 1456
3: 2970
4: 4450
964359347_964359354 3 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359354 3:155878162-155878184 ATATTATCACATTGGTGATTAGG 0: 3
1: 29
2: 158
3: 597
4: 1641
964359347_964359352 -5 Left 964359347 3:155878136-155878158 CCACCTCCCAAAGACCTCACCTC 0: 1
1: 3
2: 37
3: 115
4: 575
Right 964359352 3:155878154-155878176 ACCTCTTAATATTATCACATTGG 0: 16
1: 159
2: 594
3: 1412
4: 2923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964359347 Original CRISPR GAGGTGAGGTCTTTGGGAGG TGG (reversed) Intronic
900204355 1:1425781-1425803 GAAATGAGGTCTTTGTGTGGGGG + Intergenic
901495371 1:9618178-9618200 GAGGTAAGCTCTTTGGGACAGGG - Intergenic
902162056 1:14538607-14538629 GAGGAGGGGTCTTTAAGAGGTGG - Intergenic
902512775 1:16975237-16975259 CAGGGGAGGTCTTGGGGAGGTGG + Intronic
902514000 1:16980326-16980348 GAGGTGAGGTCGTCGGGGGATGG - Intronic
902571962 1:17352681-17352703 GAGGGGAGGACTGTGGGAGGAGG + Intronic
902776684 1:18679337-18679359 GGGGTGAGGGCGTGGGGAGGGGG + Intronic
903958146 1:27039472-27039494 GAGGAGAGGACTCAGGGAGGGGG - Intergenic
905424258 1:37870508-37870530 GAGGTAGGGCCTTTGGGAGATGG + Intronic
905730579 1:40296561-40296583 GGGCTGAGGTGTTTGGGTGGGGG + Intergenic
905767382 1:40612662-40612684 GTGGGGAGGGCTGTGGGAGGTGG - Intergenic
906524749 1:46487630-46487652 GAGGTGGGGACCTAGGGAGGAGG + Intergenic
906711316 1:47932015-47932037 GAGATGAAGTCCTGGGGAGGAGG + Intronic
906886190 1:49651276-49651298 GTGCTGAGGTCTTGGGGAGAGGG - Intronic
906955072 1:50367315-50367337 GAGGGGAGGTGCTTGGGAGTGGG - Intergenic
907041941 1:51269187-51269209 AAGGTGAGGGCTTGGGGATGGGG + Intronic
907249194 1:53126710-53126732 GAGGTGAGGTCCTTGGCTGATGG - Intronic
907857066 1:58313904-58313926 GAGGTGAGGACTTGGGATGGAGG - Intronic
908038431 1:60081376-60081398 GAGATGGGACCTTTGGGAGGAGG + Intergenic
908691136 1:66781265-66781287 GAGCTGCGGTCCTTTGGAGGAGG - Intergenic
909076091 1:71052399-71052421 GAGGTGACGCCTTTAAGAGGTGG + Intergenic
910114621 1:83718305-83718327 AAGATGAGCTCTTTCGGAGGAGG - Intergenic
913052618 1:115130674-115130696 GGGGTGAGGTATTTAGGATGTGG + Intergenic
913971641 1:143421781-143421803 GCGGTGAGGTCATGGGGAGGGGG - Intergenic
914066018 1:144247394-144247416 GCGGTGAGGTCATGGGGAGGGGG - Intergenic
914113133 1:144718960-144718982 GCGGTGAGGTCATGGGGAGGGGG + Intergenic
914449794 1:147780979-147781001 GAGGTGAGATCTTAGGAAGGAGG + Intergenic
915089771 1:153416318-153416340 CAGGTGAGGTCTCTGGGGTGGGG + Intergenic
915095740 1:153460831-153460853 CAGGTGAGGTCTCTGGGGTGGGG - Intergenic
915916611 1:159944464-159944486 TGGGTGAGGTCCTTGGGTGGTGG - Intronic
916961952 1:169897350-169897372 GAGGTGAGGACACTGGGAAGAGG - Intergenic
917737383 1:177933194-177933216 GAGGTAGGCTCTGTGGGAGGGGG - Exonic
918355578 1:183704411-183704433 GAGTTCAGCTTTTTGGGAGGTGG + Intronic
918732516 1:188015821-188015843 GAGGTGGAGACTTTGGGAGGTGG - Intergenic
918738874 1:188102404-188102426 GAGGTGGAGTCTTTAAGAGGTGG - Intergenic
918744969 1:188187281-188187303 GAGGTGACTTCCTTGGCAGGAGG - Intergenic
918914851 1:190621827-190621849 GAGATGGGGGCTTTAGGAGGTGG - Intergenic
919300642 1:195759254-195759276 GAGGTGATGGATTTGGCAGGTGG - Intergenic
920305677 1:205016707-205016729 GAAGGGGGGTCATTGGGAGGGGG - Exonic
921727334 1:218538363-218538385 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
922025678 1:221746425-221746447 GAGATGAGGCCTTTTGGAGGTGG + Intergenic
922351850 1:224740735-224740757 GAGGTGATGATTTTGGGAGAAGG + Intergenic
922475704 1:225905697-225905719 GATGTGGGGTCTTTGGCAGGAGG + Intronic
922708480 1:227806792-227806814 GAGGTGGGGCCTTTGGGAGATGG + Intergenic
922743469 1:228029793-228029815 AAGGTGGGGCCTTTGGGAGGTGG + Intronic
922972657 1:229755944-229755966 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
923036546 1:230288546-230288568 GAGGTGGGGTCTTAGGGAGGTGG + Intergenic
923144676 1:231189758-231189780 GCAGTGGGGACTTTGGGAGGTGG - Intronic
1063026915 10:2188643-2188665 GTGGTCAAGTCTTTGGGAGCTGG - Intergenic
1063157857 10:3396650-3396672 GAGGAGAGGGGTGTGGGAGGTGG - Intergenic
1063544209 10:6964107-6964129 GAGGTGGGGCCTCTGGGATGTGG + Intergenic
1063681032 10:8188259-8188281 TAGGAAAGGTCTTTAGGAGGGGG + Intergenic
1064713792 10:18154410-18154432 GAGATGAGGCCTCTGGGAGTGGG + Intronic
1064885709 10:20110158-20110180 AAGGTGAGATTTTTGGCAGGTGG + Intronic
1065192333 10:23224475-23224497 GAGCTGAGTTCCTTTGGAGGGGG - Intronic
1066307773 10:34163202-34163224 GAAGTTAAGTCTTGGGGAGGAGG + Intronic
1066566172 10:36724023-36724045 GAGGGGAGAAGTTTGGGAGGTGG + Intergenic
1066694034 10:38062017-38062039 AAGGTTTGGCCTTTGGGAGGTGG + Intronic
1066998787 10:42587133-42587155 AAGGTTTGGCCTTTGGGAGGTGG - Intronic
1067116214 10:43437217-43437239 GAGGTGCGGGCTGTGAGAGGGGG + Exonic
1067537298 10:47122764-47122786 GAGGTTGGGCTTTTGGGAGGTGG + Intergenic
1068124632 10:52824069-52824091 GAGGTGGGATCTTTAAGAGGTGG - Intergenic
1068567443 10:58591555-58591577 TAGGTGGGGTCTTCAGGAGGTGG - Intronic
1068707138 10:60089415-60089437 GAGGTGAGTTGGTTGGGAGGTGG - Intronic
1069030153 10:63587739-63587761 GAGGTGAGGCTTTTGAGAAGTGG - Intronic
1069281438 10:66659613-66659635 GAGATGGGACCTTTGGGAGGTGG + Intronic
1069750819 10:70744034-70744056 GAGGTGAGGTCAGTGGGAGGAGG - Intronic
1070477853 10:76847306-76847328 GAGCTGTGTTCCTTGGGAGGAGG - Intergenic
1070521720 10:77259675-77259697 CAGGTGAGGCTTCTGGGAGGAGG - Intronic
1070654080 10:78259109-78259131 GAGGTGGGGCCTTTAGAAGGTGG + Intergenic
1071177247 10:82940813-82940835 GAGGTGGGGCTTTTGGGAAGTGG - Intronic
1071788298 10:88927718-88927740 GAGGTGGGGTCGTTGGGCGTTGG - Intronic
1072120048 10:92398157-92398179 GTGGTGAGGTGTGGGGGAGGGGG - Intergenic
1072202396 10:93172395-93172417 GAGGTGAGGCCTTTGGTGGGAGG + Intergenic
1072642351 10:97221507-97221529 GAGGTAGGGTCTTTGGTAGGAGG + Intronic
1072734316 10:97868745-97868767 GAGATGAGGTCCTGGGGAGGGGG + Exonic
1072764428 10:98084090-98084112 GAGGTGGAACCTTTGGGAGGTGG - Intergenic
1072764629 10:98085339-98085361 GAGGTGGGACCTTTGGGAGATGG + Intergenic
1073064744 10:100751329-100751351 GAGGTGAGCTTTGTGGGAGTTGG - Intronic
1073607865 10:104914373-104914395 GAGGAGCGGTGATTGGGAGGAGG + Intronic
1074065241 10:110007800-110007822 GAGGCGAGGTCTTGAGGAGGCGG + Intronic
1074890188 10:117729403-117729425 GAGGAGAGGTCTTACTGAGGAGG + Intergenic
1075184807 10:120246062-120246084 GAGGTGAGGAATCTGTGAGGGGG - Intergenic
1075343411 10:121664897-121664919 GGGGTGATGTCAGTGGGAGGAGG - Intergenic
1075691814 10:124401303-124401325 GAGGACAGATCTTTGTGAGGGGG - Intronic
1076240433 10:128900916-128900938 GAGGTGAGATCCATGGTAGGAGG + Intergenic
1076267063 10:129117119-129117141 GAAGTCAGGACTTGGGGAGGAGG + Intergenic
1076570681 10:131430909-131430931 GAGGTGGGGTCTTGAGCAGGTGG - Intergenic
1077002452 11:331012-331034 GTGGTGGGGTGTTTGGAAGGCGG + Intergenic
1077146379 11:1048078-1048100 GAGGTGGGGACTTGGGGAGGTGG + Intergenic
1077187652 11:1242680-1242702 GTGGTCAGCACTTTGGGAGGGGG - Exonic
1077308233 11:1877246-1877268 GGGGTGAGGTCATGGGGAGGGGG + Intronic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1077805465 11:5587643-5587665 GAGGTGGAGCCTTTGGGAAGTGG - Intronic
1078003725 11:7517256-7517278 GAGTTCAGCTTTTTGGGAGGTGG + Intronic
1078084344 11:8224808-8224830 GAGGTGAGCTATGTGGGAGGTGG + Intronic
1078471922 11:11595206-11595228 AAGGTGATGTCTTTAGAAGGTGG + Intronic
1078640744 11:13093500-13093522 CAGGTGAGTCCTTTGAGAGGTGG + Intergenic
1078802663 11:14662405-14662427 GAGCTGAGTTCCTTTGGAGGAGG - Intronic
1078817938 11:14845436-14845458 GAGCTGAGTTCCTTTGGAGGAGG - Intronic
1079752673 11:24218195-24218217 GAGGTGTGTTCCTTTGGAGGGGG - Intergenic
1080231092 11:30017740-30017762 GGGCTGAGGGCTTTGGAAGGCGG + Intergenic
1080659188 11:34282186-34282208 GAAGTGAGACCTTTGGGAAGAGG - Intronic
1081596106 11:44460737-44460759 GAGCTGAGGCCTTTGGTAGAGGG + Intergenic
1081601737 11:44500210-44500232 GCGGGGAGGGCTTTGGGTGGAGG + Intergenic
1082135698 11:48546947-48546969 GAGCTGCGGTCCTTTGGAGGAGG + Intergenic
1083843481 11:65317390-65317412 GGGGTGAGGGGGTTGGGAGGCGG - Intronic
1083923869 11:65794406-65794428 GAGCTGTGGTCTCTGGGAGGTGG + Intronic
1084118073 11:67053450-67053472 GAGGTCAAGGCTTTGGGTGGAGG + Intergenic
1085662688 11:78383806-78383828 AGGGTAAGGTCTCTGGGAGGTGG + Intronic
1085765694 11:79279868-79279890 GAGGTGTGACCTTTGGGAGGTGG + Intronic
1086103809 11:83128755-83128777 GAGCTTGGGTCTTTGGGATGTGG - Intergenic
1086235745 11:84627931-84627953 GAGGTGGGGCCTGTGGGAGGTGG - Intronic
1086908003 11:92439660-92439682 GATCTCAGCTCTTTGGGAGGTGG + Intronic
1087048664 11:93865530-93865552 GAGTTCAGCTTTTTGGGAGGTGG + Intergenic
1089421350 11:118333163-118333185 AAGGTGGGGACTTTGGGAGAAGG - Intergenic
1089496801 11:118912127-118912149 GAGGAGGGGTCTTCGGGAGCTGG - Intronic
1089533608 11:119148045-119148067 GTGGAGAGGTGGTTGGGAGGGGG + Intergenic
1089555608 11:119314659-119314681 GAGGTGAGATGTGTGGCAGGTGG - Exonic
1090053376 11:123400697-123400719 GAGGTGAGTCCTTTGGGAGGAGG - Intergenic
1090777212 11:129975948-129975970 GAGGTGGGGTCATGGGGAAGAGG + Intronic
1091246711 11:134102461-134102483 GAGCTGCGGTCCTTTGGAGGGGG - Intronic
1091809461 12:3383489-3383511 GAGGTGGGGCCTCTGGGAGGCGG + Intronic
1092726088 12:11486964-11486986 CAGGTGAGGTCCTGGTGAGGTGG + Intronic
1092847822 12:12600458-12600480 GCTGTGAGGTCTTTGAGATGAGG - Intergenic
1093673056 12:21900407-21900429 GAGCTGCGTTCTTTTGGAGGGGG - Intronic
1094552903 12:31469685-31469707 GAGGTGAGGTGTTTGGGTCCTGG + Intronic
1095169432 12:39016743-39016765 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
1095200613 12:39379729-39379751 GAGCTGTGGCCTTTGGGAGAGGG - Intronic
1095408502 12:41894808-41894830 GAGGTGGGGCATTTGGGGGGTGG - Intergenic
1095600772 12:44010483-44010505 TGGGTAAGGTCTCTGGGAGGTGG - Intronic
1095847117 12:46758360-46758382 GAGGTGAGGAATTTGGGAACTGG + Intergenic
1096233262 12:49909385-49909407 GAGCTGAGGTGCTTGGGCGGGGG + Intergenic
1096243356 12:49971278-49971300 GCGGGGAGGCCTTTGGGGGGCGG - Intronic
1096536658 12:52279304-52279326 GGGGTCAGCTCTATGGGAGGGGG - Intronic
1096779629 12:53984610-53984632 GGGGTGAGGTTTGTGGGGGGGGG - Intergenic
1097073835 12:56377303-56377325 CAGGAAAGGTCTTTGGGAGCAGG + Intergenic
1097883220 12:64704865-64704887 GAGCTGAGATCTTGAGGAGGAGG + Intergenic
1098157829 12:67618473-67618495 GAGGTGAAGTATGTGGGAAGGGG + Intergenic
1098950844 12:76639168-76639190 GAGGTGGGATCTTTGGGAGGTGG - Intergenic
1099169358 12:79345150-79345172 GAGCTGGTGTCTGTGGGAGGAGG - Intronic
1099389505 12:82062064-82062086 GAGGTGTGGCCTTTGGAAGGTGG + Intergenic
1099861873 12:88232062-88232084 GAGTTCAGTTTTTTGGGAGGTGG - Intergenic
1101049142 12:100842836-100842858 GAGGTGGGGCCTTTAGGAGGTGG - Intronic
1101228429 12:102713547-102713569 GAGGTAGGGTCTTTAGGAGAAGG - Intergenic
1102299311 12:111759396-111759418 GAGGGGTGGTGGTTGGGAGGGGG + Intronic
1102559532 12:113752431-113752453 GAGGTGGGGCCTTTAGGGGGTGG + Intergenic
1102779688 12:115553389-115553411 GGGGTGAGGGCTTTGGGAGGTGG - Intergenic
1103441062 12:120963511-120963533 GAGGTGGGGACTTTGGGGGCAGG - Intergenic
1103559638 12:121786639-121786661 CAGGAAAGGTCTCTGGGAGGAGG - Intronic
1103613607 12:122138684-122138706 GAAGAGAGGTCTGTGGAAGGAGG - Intronic
1104353951 12:128068720-128068742 GAAGTGGGGCCTTTGGAAGGTGG - Intergenic
1104964812 12:132504089-132504111 GAGGTGAGGTCTTGGGTAGGTGG + Intronic
1105382540 13:19901153-19901175 GAAGTGGGAACTTTGGGAGGTGG - Intergenic
1105662717 13:22516371-22516393 GAGGTGAGCTCATGGGGAAGGGG + Intergenic
1105885450 13:24637805-24637827 GAGGTGAGGGCTGAGGGACGAGG + Intergenic
1105929339 13:25037534-25037556 GAGATGAGGGCTTTGGCAGGTGG - Intergenic
1105944742 13:25179675-25179697 GAGGTGAGGTTTTTGGGGAAAGG - Intergenic
1106140118 13:27005073-27005095 GAGGTGGGGTGATGGGGAGGAGG - Intergenic
1106757448 13:32837136-32837158 GAGGTGGGGCCTTTGGGAGATGG - Intergenic
1106842259 13:33696416-33696438 GAGCTGAGGTCTTTGGGACATGG - Intergenic
1107076467 13:36326157-36326179 GAGGTGATGGTTTTAGGAGGTGG - Intronic
1107360577 13:39613351-39613373 GAGGCAGGGCCTTTGGGAGGTGG - Intergenic
1107681388 13:42855444-42855466 GTGGTAGGGTCTTTGGGACGGGG + Intergenic
1107999518 13:45893568-45893590 GAGATGGGGCTTTTGGGAGGTGG - Intergenic
1108091844 13:46857519-46857541 GAGGTGAGTCCTTTGAGAGGTGG - Intronic
1108379467 13:49842315-49842337 GAGGTGAGGCCTACAGGAGGTGG + Intergenic
1108691021 13:52859345-52859367 GCGGTGAGCTCCTTGGGAGAAGG + Intergenic
1110161839 13:72387805-72387827 GAAATGAGGTCATTGGGGGGGGG + Intergenic
1111723233 13:91973511-91973533 GAGCTGTGTTCTTTTGGAGGAGG + Intronic
1112033380 13:95476513-95476535 AAGGTGATGGCGTTGGGAGGTGG - Intronic
1112684878 13:101813308-101813330 AAGGTGGGGGCTTTAGGAGGAGG + Intronic
1113023058 13:105910113-105910135 GAGACGAGGCCTTTGGGAGGTGG - Intergenic
1113218277 13:108068961-108068983 GAGGTGAGGGGGTTGGGGGGAGG - Intergenic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113501078 13:110774726-110774748 GAGGTAGGGCCTTTGGAAGGTGG - Intergenic
1113583176 13:111443346-111443368 GAGGTCAGTTCTGTTGGAGGTGG + Intergenic
1113672758 13:112186089-112186111 GAGGTGGGGCCTTTAGGAGGTGG + Intergenic
1113737211 13:112687617-112687639 GAGGTGGGGGCCTTGGGAGGTGG - Intergenic
1113776239 13:112947184-112947206 CAGGCGGGGTCTTTGGTAGGTGG - Intronic
1114079208 14:19188226-19188248 GAGCTGAGTTCTTTTGGAGGAGG + Intergenic
1114614984 14:24063491-24063513 GAGGTGTGGTCCTGGGGGGGCGG - Exonic
1114749259 14:25184504-25184526 GAGCTGCGTTCTTTTGGAGGAGG - Intergenic
1114771124 14:25429686-25429708 GAGGGGAGGTGTGTGTGAGGAGG + Intergenic
1116386762 14:44340407-44340429 GAGGCGGAGTCTTTGGGAGGTGG - Intergenic
1116417269 14:44693991-44694013 GAGTTGTGATCTTTTGGAGGAGG - Intergenic
1116721269 14:48498689-48498711 AATGGGAGGTCTTTGGGAGCTGG + Intergenic
1116776528 14:49188221-49188243 TGGGTGAGTCCTTTGGGAGGTGG + Intergenic
1117811591 14:59552565-59552587 GAGCTGTGTTCTTTTGGAGGGGG - Intronic
1117891438 14:60426523-60426545 GAGGTGCGTTCCTTTGGAGGAGG + Intronic
1117999010 14:61505733-61505755 GAAGTGGGTCCTTTGGGAGGTGG - Intronic
1118314488 14:64717283-64717305 GAGGCGAGGCCTGAGGGAGGGGG + Intronic
1118813652 14:69293554-69293576 TAGGTGATGTCATTGTGAGGTGG + Intronic
1119119365 14:72059675-72059697 GAGATGAGGCATTTGGGAGGTGG + Intronic
1119786720 14:77320261-77320283 GAGGTGCATTCTCTGGGAGGGGG - Intronic
1119809563 14:77505413-77505435 GAGGTGAGGTAGTGGGGAGGTGG - Intergenic
1120006010 14:79358745-79358767 AGGGGGAGGGCTTTGGGAGGAGG - Intronic
1120014504 14:79455291-79455313 AGGGTAAGGTCTTTGGGAGATGG - Intronic
1120324256 14:83005401-83005423 AAGGTCAGGTCTTTGAGAGATGG - Intergenic
1121109593 14:91303420-91303442 GAGGCGGGGTCTGGGGGAGGTGG - Intronic
1121298985 14:92853887-92853909 GAGCTGTGGTCCTTTGGAGGAGG - Intergenic
1121418776 14:93797844-93797866 AAGGTGAGGTCTTGGGGAGCTGG - Intergenic
1121498806 14:94417196-94417218 GTGGTGAGGTTTTTGGCAAGAGG + Intergenic
1121698049 14:95928765-95928787 TAGGTGAGCTCTTTTGGAAGAGG - Intergenic
1122165277 14:99818524-99818546 GAGGTGAGGGGTGTGGGAAGAGG + Intronic
1122240314 14:100360586-100360608 GTGGTGTGGTCTTTGGCCGGTGG + Exonic
1124137935 15:27051483-27051505 GAGGTGTGTCCTTTGGGAAGGGG + Intronic
1124197452 15:27644820-27644842 GAGCTGGGGTTTTAGGGAGGAGG - Intergenic
1125154297 15:36568764-36568786 GAGGTGGGACCTTTGGGAGGTGG + Intergenic
1125891527 15:43270461-43270483 CATGTGAGGTCTTTTGGGGGAGG - Intergenic
1126337481 15:47602928-47602950 GAGGTGAAATCTTTGAGAAGTGG - Intronic
1126450673 15:48805041-48805063 GAGGGAGGGTCTGTGGGAGGAGG - Intronic
1126506818 15:49414384-49414406 GAGGTGAAGTGTGTGGGGGGAGG + Intronic
1126624910 15:50677305-50677327 GAGATGAGAACTTTGGGAGATGG - Intronic
1127503436 15:59575913-59575935 GAGGTTGGGCCTTTGTGAGGTGG - Intergenic
1127706945 15:61556744-61556766 GAAGTGGAGCCTTTGGGAGGTGG + Intergenic
1128405481 15:67333141-67333163 GAGATGGGGCCTTTGGAAGGTGG - Intronic
1128920246 15:71603681-71603703 CAGGTAGGGTCTTTGGAAGGGGG + Intronic
1129064991 15:72894946-72894968 GAGGTGGGGGCAGTGGGAGGGGG - Intergenic
1129254163 15:74324831-74324853 GAGCTGGGGTCTTTGGGTGGAGG - Intronic
1129256996 15:74339306-74339328 GGGGTGAAGTCTGCGGGAGGAGG + Exonic
1129321875 15:74779884-74779906 GAGGACAGGTCTGTGGGAGTGGG + Intergenic
1129557933 15:76532826-76532848 GTGATGATGCCTTTGGGAGGTGG + Intronic
1129692436 15:77721411-77721433 CAGGGAAGGGCTTTGGGAGGAGG - Intronic
1130415999 15:83695263-83695285 GTGGTGGGGTCTTTGAGAAGGGG + Intronic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1131445880 15:92497528-92497550 GGGGTGAGGTGTGTGGGAGTGGG + Intronic
1133146591 16:3791592-3791614 GCAGTGACGTCTTAGGGAGGGGG - Intronic
1134045005 16:11094407-11094429 GATGTGAGGTTTGTGGGAGGAGG + Intronic
1134236239 16:12468553-12468575 GAGATGAGGGCTGCGGGAGGGGG - Intronic
1134384278 16:13757426-13757448 GAGGTGGGATCTTTAAGAGGTGG + Intergenic
1135494924 16:22942963-22942985 GAGGATAGGTTTGTGGGAGGAGG - Intergenic
1135927974 16:26711875-26711897 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1136237949 16:28925789-28925811 GATTTGAGGGCGTTGGGAGGAGG - Intronic
1137601186 16:49757545-49757567 CAGGTGAGTTCTATGGGAGAGGG - Intronic
1137618814 16:49862565-49862587 GAGTTGTGGTCATGGGGAGGGGG - Intergenic
1138104489 16:54280417-54280439 GAGGGGAGGGCTTAGGGAGGAGG + Intergenic
1138596003 16:58029191-58029213 GGGGTGGGGGCGTTGGGAGGGGG + Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139674153 16:68511403-68511425 GAGGTGAGGTTAGTGGGAGGTGG + Intergenic
1140374944 16:74437683-74437705 AAGGTGAAGTATTTGGGAGATGG - Intergenic
1140409789 16:74734684-74734706 GAGGAGGGGTCCTGGGGAGGGGG - Intronic
1140645959 16:77030015-77030037 GAGGTGGGGACTTTAAGAGGTGG - Intergenic
1141212126 16:81991215-81991237 GAGCTGAGGTGTGTGGGCGGGGG - Exonic
1141614350 16:85202210-85202232 GAGGAGAGGTTCCTGGGAGGGGG - Intergenic
1141782401 16:86172139-86172161 ATGGTGGGGTCTTTGGAAGGTGG + Intergenic
1142156908 16:88536737-88536759 GAGCTCAGGTCCCTGGGAGGGGG - Exonic
1142246551 16:88972821-88972843 GAGGTGAGGTCTGAGGGTGCTGG + Intronic
1142608737 17:1096576-1096598 GAGGCCAGGTCTGTGGTAGGAGG - Intronic
1143045421 17:4074998-4075020 GAGGTAAGGTCTTTGAAGGGAGG - Intronic
1143183579 17:4998154-4998176 GAGGTGAGGGCTGGGGAAGGGGG + Exonic
1143474090 17:7193134-7193156 GTGGTTAGATCTTTGGGGGGTGG - Intronic
1143653279 17:8277586-8277608 CAGGTGAGATGTTTGGGAGTGGG - Intergenic
1143731571 17:8885418-8885440 GAGGCGAGGCCATGGGGAGGCGG - Intronic
1144007087 17:11110566-11110588 GAGGTGGGGTCTTTGGAAGGTGG + Intergenic
1144271720 17:13624066-13624088 AAGGTGAGGCCTTTAAGAGGTGG - Intergenic
1144382726 17:14718726-14718748 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
1146408934 17:32565413-32565435 GAGGTGAGGTTTTAGGGGGATGG - Intronic
1146457214 17:33017410-33017432 GATGGGAGGTTTTTGGGGGGCGG - Intronic
1146562017 17:33878205-33878227 GAGGTGTGTTCCTTTGGAGGAGG - Intronic
1146840266 17:36147666-36147688 GGGATGAGGTTTTGGGGAGGGGG - Intergenic
1146927369 17:36754274-36754296 GAGGTAAGGTCACGGGGAGGAGG + Intergenic
1147178637 17:38671962-38671984 GAGCTTAGGTCTTAGGGAGATGG - Exonic
1147656204 17:42092644-42092666 GGGGTGTGGTCTTTGGAATGTGG - Intergenic
1149062070 17:52434349-52434371 GAGGTAAAGTCTTTAGGAAGTGG + Intergenic
1149628761 17:58101912-58101934 GAGGTGGGACTTTTGGGAGGAGG - Intergenic
1149651904 17:58280892-58280914 GAGGTGGGGTCCTTGGAAGCTGG - Exonic
1149808789 17:59646165-59646187 GTGGGGTGGTCTTGGGGAGGGGG - Intronic
1149981963 17:61317919-61317941 CTGGTGAGGTCTGTGGGTGGGGG + Intronic
1150604325 17:66677998-66678020 GATCTGATGTCTTTGGGTGGTGG - Intronic
1151454980 17:74220727-74220749 ACTGTGAGGTCTTTGGGAGAGGG + Intronic
1151998918 17:77632496-77632518 GAGATGGGGCCTTTGAGAGGCGG + Intergenic
1152403287 17:80082482-80082504 GAGGCGGGGTGTTGGGGAGGCGG - Intronic
1153849185 18:9077415-9077437 GAGCTGATTGCTTTGGGAGGTGG + Intergenic
1154403561 18:14066068-14066090 GAGCTGTGTTCTTTTGGAGGAGG - Intronic
1155926572 18:31662258-31662280 GAGTTGAGCTCCTTAGGAGGTGG - Intronic
1156228473 18:35131597-35131619 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1157051887 18:44175806-44175828 GATTTGAGGTCTTTGGGGGCTGG + Intergenic
1157098383 18:44708041-44708063 GAGGAGGGGTCTATGAGAGGAGG + Intronic
1157445147 18:47738854-47738876 GAGGTGGGGACTTTGGGAGGTGG - Intergenic
1157920327 18:51707522-51707544 GAGTTCAGCTTTTTGGGAGGTGG - Intergenic
1159627349 18:70710069-70710091 GAGGTGGGGTCTAAGAGAGGAGG - Intergenic
1159867958 18:73728459-73728481 GAGATGGAGCCTTTGGGAGGTGG - Intergenic
1159939893 18:74398769-74398791 GAGGTGGGGCCTTCGGGAGGTGG - Intergenic
1159952143 18:74492533-74492555 CAGGTGAGCTCTTTGGAAGAGGG - Intergenic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1160803166 19:979808-979830 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803190 19:979861-979883 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803215 19:979916-979938 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803240 19:979971-979993 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803265 19:980026-980048 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160993882 19:1873026-1873048 GAGGTGGGGCCTCTGGGAGCAGG - Intergenic
1161358354 19:3832139-3832161 GAGGTGAGCTCTGTGGGTGATGG - Intronic
1162009808 19:7805720-7805742 GAGGTCAGGTCTTTCAGAGCAGG + Intergenic
1163323333 19:16587326-16587348 GAGCTGGGGTCTTGGGGTGGAGG - Intronic
1163717251 19:18879620-18879642 GAGGTGGGGCCTTGGCGAGGTGG - Intronic
1163717298 19:18879745-18879767 GAGGTGGGGCCTTGGTGAGGTGG - Intronic
1163717321 19:18879808-18879830 GAGGTGGGGGCTTGGTGAGGTGG - Intronic
1164237153 19:23347157-23347179 GAGTTCAGCTTTTTGGGAGGTGG - Intronic
1164621431 19:29697955-29697977 GTGGTGGGGTCTGTGGGTGGAGG - Intergenic
1164909557 19:31994771-31994793 GAGGTGGAGACTTTGGGAGGGGG - Intergenic
1165245427 19:34495811-34495833 GAGGAGAGCCCTGTGGGAGGAGG - Intronic
1165856429 19:38881347-38881369 CGGGTGTGGCCTTTGGGAGGGGG + Intronic
1166544592 19:43626452-43626474 GAGGGAAGAGCTTTGGGAGGAGG - Intronic
1166570846 19:43796147-43796169 GAGGTGGGGCCTTTGGGAGGTGG - Exonic
1166679700 19:44759053-44759075 GGGCTGAGGTCTGAGGGAGGAGG - Intronic
1166679731 19:44759157-44759179 GGGCTGAGGTCTGAGGGAGGAGG - Intronic
1166889504 19:45981861-45981883 GAAGTGGGGTCTGAGGGAGGAGG - Intergenic
1166956411 19:46468399-46468421 TAGGTGAGGTCTTGGGTGGGAGG - Exonic
1166975819 19:46604454-46604476 GGGGAGAGGGCTTAGGGAGGGGG - Intronic
1167242305 19:48351582-48351604 GAGGTGAGGGCAGAGGGAGGGGG - Intronic
1167249157 19:48391489-48391511 GGGGAGGGGACTTTGGGAGGGGG + Exonic
1167627242 19:50599792-50599814 GGAGTGAGGTATTTGGGAGCAGG + Intergenic
1167649199 19:50720082-50720104 GCGGGGAGCTCTCTGGGAGGGGG - Intergenic
1167679187 19:50909139-50909161 GCGGTGAAGGCTCTGGGAGGAGG - Intronic
1168065167 19:53915151-53915173 GAGGTGTGGCCTGTGTGAGGGGG + Intronic
1168346145 19:55651092-55651114 CAGTTGGGGTCTGTGGGAGGTGG - Intronic
925104153 2:1275215-1275237 GAGGTAAGGATGTTGGGAGGTGG - Intronic
925738584 2:6985542-6985564 CAGGTGAGTTCTTAGGAAGGTGG + Intronic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
925896209 2:8474210-8474232 CAGGTGAGGGGTTAGGGAGGAGG - Intergenic
926115571 2:10210796-10210818 GAGGTGGAGCCTTTGGGAGGTGG + Exonic
926188453 2:10709455-10709477 CAGGTGAGGGCTATGGCAGGGGG + Intergenic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
926457087 2:13080297-13080319 GAGGTGCGGCCTATGGGAGATGG + Intergenic
926860265 2:17301557-17301579 GAGGGGAGGTGAATGGGAGGAGG - Intergenic
927095608 2:19745729-19745751 CAGGTGTGGTGTTTGGGAAGTGG + Intergenic
927286074 2:21358396-21358418 CAGGGGAGGTCTCTGGGAGCAGG - Intergenic
927289782 2:21394058-21394080 GAGGTGAGGCCTTTGGGCCGTGG - Intergenic
927701307 2:25270589-25270611 GAGGTGCCTTTTTTGGGAGGAGG + Intronic
928096903 2:28410376-28410398 GGTGTGAGGCCTCTGGGAGGAGG - Intronic
928111836 2:28516867-28516889 GAGGTAAGGGCTTTGGCTGGTGG + Exonic
928188241 2:29135463-29135485 GAAGACAGGGCTTTGGGAGGAGG - Intronic
928306079 2:30171452-30171474 GAGGTGAGGCCTTTGAGAGGTGG - Intergenic
928983780 2:37160843-37160865 GAGGTGTGGCCTTTGGGTGGTGG + Intergenic
929815993 2:45232072-45232094 GAGGTGGGGTCTTTGGAAGGTGG - Intergenic
929856516 2:45642703-45642725 GAGGTGAGGGTTGTGGGAAGTGG - Intergenic
930737833 2:54797660-54797682 CAGCTAAGGTCTTTGGGAAGTGG + Intronic
930898486 2:56474282-56474304 GAGAAGAGGTCTTAGGGATGAGG + Intergenic
930991840 2:57665622-57665644 GAGGTGGAGTCTTTAAGAGGTGG + Intergenic
931043726 2:58326423-58326445 GAGCTGCGTTCTTTTGGAGGAGG - Intergenic
931377068 2:61717416-61717438 GGGGTATGGTCTTTGGGAGGTGG - Intergenic
932219225 2:69987153-69987175 GAGGGGAAGGCATTGGGAGGAGG + Intergenic
932428743 2:71660397-71660419 GTGGTGTGGTGTGTGGGAGGGGG + Intronic
933170072 2:79115214-79115236 GAAGGGAGGACTCTGGGAGGAGG - Intergenic
933739713 2:85523932-85523954 GAGGCGAGGTTTGGGGGAGGTGG + Intergenic
934061189 2:88295793-88295815 GAGGAGAGGTCTCTAGGTGGAGG + Intergenic
934076814 2:88435503-88435525 GTGGTAAGGTGTTGGGGAGGAGG + Intergenic
934176337 2:89582714-89582736 GCGGTGAGGTCATGGGGAGGGGG - Intergenic
934286647 2:91657075-91657097 GCGGTGAGGTCATGGGGAGGGGG - Intergenic
934759382 2:96845017-96845039 GAGGCCAGTTCTTTGGGAGCTGG - Intronic
934937454 2:98475753-98475775 GGGGTGGGGGCTTTGGGAGGAGG + Intronic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935716468 2:105943606-105943628 GCGGTGGGGTTTTTGGGAGGTGG - Intergenic
935855433 2:107268062-107268084 GAGGTGGGGCTTTTGGGAGGTGG - Intergenic
936082836 2:109446623-109446645 GAGGTGAGGTCTATGGGCAGGGG + Intronic
936294006 2:111251374-111251396 GAGGTGAGTTCTTTCAGAGTAGG + Intergenic
936448205 2:112614032-112614054 GAGTTGCGATCTTTTGGAGGAGG + Intergenic
936529206 2:113263674-113263696 GATGGGAGATCTCTGGGAGGAGG + Intronic
937145751 2:119642902-119642924 GAGATGGAGCCTTTGGGAGGTGG - Intronic
937237889 2:120441809-120441831 GAGGCCAGGTCTTTGGTATGGGG - Intergenic
937316833 2:120937045-120937067 GAGGTGCAGTCCTTGGAAGGAGG - Intronic
937741359 2:125358443-125358465 GAGCTGCGTTCTTTTGGAGGAGG - Intergenic
938792944 2:134692771-134692793 GAGGGGGAGGCTTTGGGAGGTGG - Intronic
939665293 2:144944398-144944420 GTGGTTAGGTCTTTGGGGGATGG + Intergenic
939837915 2:147151891-147151913 GAGGTGCGTTCCTTTGGAGGAGG - Intergenic
940084645 2:149845246-149845268 GAGATGGGGCCTTTGGGAGGTGG - Intergenic
940876707 2:158904870-158904892 GAGGTGAGGACTGGGGGAAGAGG + Intergenic
940890195 2:159027990-159028012 GAGATGAGGTCATCGGGATGGGG - Intronic
941187164 2:162331475-162331497 GAGGTGGGGCCTTTAGGAGGAGG + Intronic
941531710 2:166678632-166678654 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
941673174 2:168316881-168316903 GAGGTGAGACCTTTGAGAGGTGG - Intergenic
941772265 2:169357968-169357990 GAGGTATGGTCTTTGGGAGTAGG + Intronic
942296797 2:174525322-174525344 GAGGTGGGGTTTTTAAGAGGTGG - Intergenic
942360781 2:175168774-175168796 TAGGTGAGGTTTGGGGGAGGCGG + Intergenic
942757701 2:179361807-179361829 GGGGTGAGGGGTGTGGGAGGTGG + Intergenic
942879185 2:180838709-180838731 GAGCTGAGTTCCTTTGGAGGAGG + Intergenic
944007486 2:194927769-194927791 TAGGTGTGGCCTTTGGGAGGTGG - Intergenic
944021635 2:195112873-195112895 AAGGTGAGGTCTTTGGGAGATGG + Intergenic
944422500 2:199546125-199546147 GAGGTAGAGCCTTTGGGAGGTGG - Intergenic
945258984 2:207826673-207826695 GAGTTGGGGTCTTGGGGAAGCGG + Intergenic
946015485 2:216600820-216600842 GAGGTGAGGACTTTTGGAGATGG + Intergenic
946037805 2:216757681-216757703 AGGTTGAGGTCTTTGGGAGACGG - Intergenic
946392830 2:219426663-219426685 GAGGGGAGGGCGTGGGGAGGTGG - Exonic
946411708 2:219518438-219518460 GAGGAGAGGGCCCTGGGAGGTGG + Intronic
946499417 2:220230320-220230342 GAGATGGAGTCTTTGGGAGATGG + Intergenic
947028499 2:225765495-225765517 GAAGTGGAATCTTTGGGAGGTGG + Intergenic
947050082 2:226031757-226031779 GGGGTGAGGTGTGTGGGTGGGGG + Intergenic
947184045 2:227439066-227439088 TAGGTGAGGACTTGGTGAGGAGG + Intergenic
947242127 2:228006584-228006606 GAGGTGCGTTCCTTTGGAGGAGG + Intronic
947260493 2:228216486-228216508 GAGGTGGAATCTTTGAGAGGTGG + Intergenic
947385939 2:229590560-229590582 GAGGTGGGGCCTTTGAGAGGTGG + Intronic
947801451 2:232930704-232930726 GTGGTGGGGCCTTTGAGAGGTGG - Intronic
947942451 2:234070151-234070173 GAGGAGAAGTCTTGGGAAGGAGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948524503 2:238562548-238562570 GAGGCGGGGCCTTTAGGAGGCGG + Intergenic
948723887 2:239920092-239920114 GAGGTGGGGCCTTTGGGAGGTGG + Intronic
949044633 2:241866798-241866820 CAGCTGAGGTCTGTGGGGGGAGG + Intergenic
1168770183 20:409396-409418 CAGGGGAGGCCTCTGGGAGGGGG - Intronic
1169194235 20:3674753-3674775 GAGGTGAGCTCTGGGAGAGGAGG - Exonic
1169228851 20:3873548-3873570 GATGTGGGGCCTGTGGGAGGTGG + Exonic
1169265164 20:4162991-4163013 GAGCAGAGGGCTTTGGGAGCTGG + Intronic
1169301519 20:4445684-4445706 CAGGTGAGGGCTTTGGGTGGTGG + Intergenic
1169395045 20:5221640-5221662 GAGGTGGGGTCTTTAAGAGGTGG + Intergenic
1169454705 20:5742252-5742274 GAGATGAGGTGGTTGTGAGGAGG - Intergenic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1170971692 20:21122858-21122880 AAGGTGAGGTCTGGGGGAAGGGG - Intergenic
1171032691 20:21691572-21691594 GAGATGAGGTCATGGGGAGGTGG + Intergenic
1171046019 20:21809876-21809898 GAGGTGGGGCCTTTGGACGGAGG - Intergenic
1171048421 20:21833017-21833039 GAGGTGGGGCATTTAGGAGGCGG - Intergenic
1171272243 20:23826169-23826191 GAGGAGAGGACTCAGGGAGGAGG + Intronic
1171422273 20:25025211-25025233 GAGGTGTGCGCCTTGGGAGGTGG - Intronic
1171904268 20:30887927-30887949 GAGGTGCGTTCCTTTGGAGGAGG + Intergenic
1172308134 20:33896377-33896399 GAGGAGAAGCCTTTGAGAGGTGG + Intergenic
1172595733 20:36149803-36149825 AAGGTGAGGTCATGGGGAGGAGG - Intronic
1173180597 20:40803742-40803764 AAGGTGATGGCATTGGGAGGTGG - Intergenic
1173661866 20:44740135-44740157 GAGGGGTGGTCCTTGGCAGGAGG + Intergenic
1174288830 20:49492334-49492356 GTAGTGAGGGCTTGGGGAGGGGG + Intergenic
1174408840 20:50320933-50320955 GGGATGAGGCCTTGGGGAGGAGG - Intergenic
1174648109 20:52103480-52103502 GAGGTGACTTCTGTGGGAGCAGG - Intronic
1174834111 20:53839886-53839908 GCAGTGAGGTTTCTGGGAGGTGG - Intergenic
1175100537 20:56575834-56575856 GAGGGGAGGGTTTAGGGAGGAGG - Intergenic
1175465400 20:59187273-59187295 GAGGTGGGTCCTTTGGGAGGTGG + Intergenic
1175880303 20:62254174-62254196 GATGTGGGGCCTTTGAGAGGTGG - Intronic
1175922477 20:62456658-62456680 GACGTGAGGTTGTGGGGAGGAGG - Intergenic
1176142331 20:63550207-63550229 GAGGTGAGGTCATGTGGGGGGGG - Intronic
1176151062 20:63590893-63590915 AAGGTGAGGTCTGTGGGAGACGG + Intronic
1176187914 20:63791604-63791626 GAGCTGAAGTCTTCTGGAGGAGG + Intronic
1176385555 21:6137251-6137273 GAGGTGAGGGCCTTGGCAGGCGG + Intergenic
1176942247 21:14938885-14938907 GAGGTGTGTTCGTTTGGAGGGGG + Intergenic
1177029697 21:15967247-15967269 AAGGTGAGGCATTTGGGAAGGGG - Intergenic
1177403596 21:20637878-20637900 GAGGTGAGGCCTTTAGGAGGTGG - Intergenic
1177669349 21:24206284-24206306 AAGGTGGAGCCTTTGGGAGGTGG + Intergenic
1178440060 21:32591423-32591445 GAGGTGACATCTAGGGGAGGTGG - Intronic
1178524918 21:33319461-33319483 GAGGGGAGGTCGATGGGGGGCGG + Intergenic
1178694499 21:34781248-34781270 GAAGTGGGGCCTTTAGGAGGTGG - Intergenic
1179167189 21:38944327-38944349 GAGGGGAGACCTTGGGGAGGAGG - Intergenic
1179482433 21:41686684-41686706 GAGGCAGGGCCTTTGGGAGGTGG + Intergenic
1179644959 21:42770199-42770221 GAGGTGGGGGCCTTGGCAGGGGG - Intronic
1179737918 21:43401001-43401023 GAGGTGAGGGCCTTGGCAGGCGG - Intergenic
1181048535 22:20227913-20227935 GTTGTGGGGTCTTGGGGAGGAGG + Intergenic
1181643283 22:24216038-24216060 CAGGTGGGGCCTTTGGGATGTGG + Intergenic
1181732709 22:24859259-24859281 TAGGGGGGGTTTTTGGGAGGAGG + Intronic
1181975212 22:26724064-26724086 GAGATGGGACCTTTGGGAGGTGG - Intergenic
1182711605 22:32326736-32326758 GAGTTGAGGGTTTTGGGAGAGGG + Intergenic
1182794462 22:32980759-32980781 GGGGTAAGGCCTTTGGGAGAAGG - Intronic
1182990861 22:34766218-34766240 GAGGTGTGGCCTTTGGGAATAGG + Intergenic
1183005204 22:34895474-34895496 AAGGTGAGCTCTATGGGAGCAGG + Intergenic
1183388680 22:37530503-37530525 GAGGTGGGGCTTTGGGGAGGTGG - Intergenic
1183654711 22:39177816-39177838 GAGATGGGGTCCTTGGGAGCAGG - Intergenic
1184747035 22:46462067-46462089 CAGGTGTGGGCTGTGGGAGGCGG + Intronic
1185127192 22:49017779-49017801 GACGTGATGTCGCTGGGAGGAGG - Intergenic
1185287004 22:50006085-50006107 GAGCTGAGGGCTTTGTGGGGAGG + Intronic
949256536 3:2053952-2053974 GAGGTGGGGCCTGTGGGAAGTGG + Intergenic
949342625 3:3045726-3045748 GAGGTGCGTTCCTTTGGAGGAGG - Intronic
949406072 3:3716238-3716260 GAGGTGGGGCATTTTGGAGGTGG - Intronic
950040056 3:9914597-9914619 ATGGTGAGTTCTTGGGGAGGGGG + Exonic
950478732 3:13231545-13231567 AAGGTGGGGCCGTTGGGAGGTGG - Intergenic
950484869 3:13267081-13267103 GAGGTGGGGCCTCTGGGAGGTGG + Intergenic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
950694856 3:14690957-14690979 GAGGTGAGGGCTGAGGAAGGCGG - Intronic
951291759 3:20879267-20879289 GAGTTGAGGACTTGGGGAAGTGG + Intergenic
951470963 3:23055561-23055583 GAGGTGGGACCCTTGGGAGGTGG - Intergenic
951710538 3:25581667-25581689 GAGGTGGGGTCTTTGGGCGGGGG + Intronic
951902601 3:27671644-27671666 GAGGTGTGTGTTTTGGGAGGAGG + Intergenic
951967651 3:28405274-28405296 GAGGTAAAGCCTTTGGGAGGTGG + Intronic
952236818 3:31488487-31488509 GAGGTGAGGCCTTTTGGAGGTGG + Intergenic
952494647 3:33905067-33905089 TAGGTGAGGAGTTTGGGAAGGGG + Intergenic
952965924 3:38621257-38621279 GGGGTGAGGAGATTGGGAGGAGG - Intronic
954558021 3:51533614-51533636 GAGTTCAGCTTTTTGGGAGGTGG + Intergenic
954980006 3:54737344-54737366 GAGGAGGGGTCTTTTGGAGGTGG + Intronic
955223434 3:57041879-57041901 GAGGTGAGGTCATCTGGAGCGGG - Intronic
955504237 3:59614923-59614945 GAGCTGCGTTCTTTAGGAGGAGG - Intergenic
955748330 3:62162520-62162542 AAAGTGAGGGCTTTGGGAGGTGG + Intronic
955772062 3:62395109-62395131 GAGATGAGGTTGTTCGGAGGTGG + Intergenic
956447674 3:69341686-69341708 GAGGCAAGGCCTTTAGGAGGTGG + Intronic
956887933 3:73579087-73579109 GAGGTGGGGTCTTGGGGAGGTGG + Intronic
957350509 3:79018203-79018225 GAGGGGAGGTTTTGGGGAGTGGG + Intronic
957432562 3:80130685-80130707 AAGGTGAGGTTTTGGGGAGGTGG - Intergenic
957561845 3:81832409-81832431 GAGGTGGGGCCTTTGAGAGGTGG + Intergenic
957867201 3:86040180-86040202 GAGGTGTGTTCCTTTGGAGGAGG - Intronic
958180104 3:90049088-90049110 AAGGTGGAGCCTTTGGGAGGTGG - Intergenic
958863233 3:99469525-99469547 GATGTGAGCACTTTGAGAGGAGG - Intergenic
959733605 3:109632081-109632103 GAGATGAGGCCTAAGGGAGGAGG - Intergenic
959752941 3:109859599-109859621 GAGGTGAAGCCTTTGGATGGTGG + Intergenic
959877035 3:111395277-111395299 GAGGTGGGGTCTTTGGGAGGTGG + Intronic
961314530 3:126025595-126025617 GAGGTGAGGTCATGAGGATGGGG + Intronic
962294200 3:134166160-134166182 GAGTTGGGGCCTTTGGAAGGTGG + Intronic
962714908 3:138117546-138117568 GAGGTGGGGCCTTTGGGGGGTGG - Intergenic
962918648 3:139932079-139932101 GAGGTGAGACATTTGGCAGGGGG - Intergenic
963077955 3:141365547-141365569 GAGGTGGGGTCTTTCAGAGGTGG - Intronic
963271423 3:143289638-143289660 TAGGGGAGGTCTTTGGCAGGTGG - Intronic
963303262 3:143621712-143621734 GAGCTGAGTTCCTTTGGAGGAGG - Intronic
964003514 3:151805780-151805802 GGGCTTAGGTCTATGGGAGGGGG - Intergenic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
964627388 3:158772443-158772465 GAGGTAAGGGCTGTGGGTGGGGG + Intronic
965080636 3:164026086-164026108 GGGCTTAGGTCTATGGGAGGGGG + Intergenic
966374260 3:179279548-179279570 GAGGTGAGGGCCTAGGTAGGGGG + Intergenic
966625427 3:182010952-182010974 GCTGGGAGGTATTTGGGAGGTGG - Intergenic
967226297 3:187294497-187294519 GAAATGATGTCGTTGGGAGGGGG + Intergenic
968460433 4:721951-721973 GGGGAGAGGCCTGTGGGAGGTGG + Intronic
968520446 4:1032582-1032604 CAGGTGAGGGCTGTGGGAGGAGG + Intergenic
968630844 4:1650373-1650395 CAGGTGTGGTGTTTGTGAGGTGG + Intronic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
969294785 4:6263420-6263442 AAGGTGAGGGCTGGGGGAGGTGG + Intergenic
969324305 4:6432037-6432059 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
969458236 4:7313357-7313379 ACGGTGAGGGCTTTAGGAGGAGG - Intronic
969959175 4:10925867-10925889 GAGCTGGAGGCTTTGGGAGGTGG + Intergenic
970559074 4:17265272-17265294 GAGGAGAAGCCTTTGGGAGTTGG - Intergenic
970794137 4:19891701-19891723 GAGTTCAGCTTTTTGGGAGGTGG - Intergenic
971844618 4:31903498-31903520 GAAGTGATGTCTTTGGAAAGTGG + Intergenic
972335066 4:38100504-38100526 TAAGTAAGGACTTTGGGAGGAGG - Intronic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
972996075 4:44880539-44880561 GAGCTGAGTTCCTTTGGAGGAGG - Intergenic
973052392 4:45611439-45611461 GAGTTCAGCTTTTTGGGAGGTGG - Intergenic
973851462 4:54965444-54965466 AAGGTGGGGCCTTTAGGAGGTGG + Intergenic
973972683 4:56229239-56229261 AAGGTGGGGCCTTTCGGAGGTGG + Intronic
975200531 4:71582959-71582981 GAGGTAGGGCCTTTGGGAGGTGG + Intergenic
975486602 4:74940551-74940573 GAGGTGGGGTCTTTAGGAAGTGG - Intronic
976336024 4:83887888-83887910 GATGGGGGGACTTTGGGAGGTGG - Intergenic
977954675 4:103012932-103012954 GAGGTGAGGCCTTTAGGAAATGG - Intronic
979870977 4:125821841-125821863 GAGATGAGGCCTTTGGGAGCTGG + Intergenic
980196830 4:129600275-129600297 GTGGTGAGGCCTCTGGGAGATGG + Intergenic
980513373 4:133822784-133822806 GAGTTGTGGTCCTTTGGAGGAGG + Intergenic
980770380 4:137364453-137364475 CAGGTGAGGCCTTTAAGAGGTGG + Intergenic
983029718 4:162784726-162784748 GAGATGAAGTCTGAGGGAGGGGG + Intergenic
983494550 4:168428203-168428225 GAGGTTAGGTCTGTGGGCTGAGG + Intronic
983922913 4:173366402-173366424 GAGGTGGGGCTTTTAGGAGGTGG - Intergenic
984978709 4:185256596-185256618 TAGGTGAGCTCTCTGGGGGGAGG - Intronic
986339715 5:6778637-6778659 GAAGTGGAGCCTTTGGGAGGTGG + Intergenic
986947335 5:13038712-13038734 GATGTGAGGGCATTAGGAGGTGG + Intergenic
986984686 5:13487159-13487181 GAGGAAGGGCCTTTGGGAGGAGG + Intergenic
987345503 5:16975338-16975360 GAGGTGAGGACTTAGGAGGGAGG + Intergenic
987438698 5:17929968-17929990 GAGGTGGCAACTTTGGGAGGTGG - Intergenic
987653142 5:20770828-20770850 GAGGTGGGGTCTTTGGTAGGTGG - Intergenic
989076440 5:37568258-37568280 CAGGTGTGGTGTTTGGGAAGTGG + Intronic
989579174 5:43016257-43016279 GAATTGAGCTCCTTGGGAGGAGG - Intergenic
990084078 5:51952826-51952848 GAGGTGTGTTCCTTTGGAGGAGG - Intergenic
990700751 5:58472629-58472651 TAGGTGGGGCCTTTAGGAGGTGG - Intergenic
991258664 5:64643144-64643166 GAGATGAGGCCTTTGGTAGGTGG - Intergenic
991311680 5:65249988-65250010 GAGATGAAGCCCTTGGGAGGTGG - Intronic
991609564 5:68436310-68436332 CAGGTGAAGGCTTTGGGGGGTGG + Intergenic
991943281 5:71875797-71875819 GAAGTAGGGCCTTTGGGAGGAGG + Intergenic
995058371 5:107787486-107787508 AAGGTGGGGTCTTTGGGAGGTGG + Intergenic
995459358 5:112386919-112386941 GTGGTGAGGTCGGTGGGAGTGGG - Intronic
996015975 5:118534478-118534500 GAGGTCAGGTATGTGGGAGAAGG - Intergenic
997384117 5:133459049-133459071 CAGGTGGGGTCTGTTGGAGGTGG - Intronic
997660174 5:135583276-135583298 GAGATGAAGTCTCTGGGAAGAGG + Intergenic
997778138 5:136629756-136629778 GAGGTGAGGGCTGGGGGTGGGGG - Intergenic
997850147 5:137325110-137325132 GAGGAAAGGTTTTTGGGATGGGG + Intronic
998205678 5:140155429-140155451 GAGGAAAAGTCTTAGGGAGGTGG - Intergenic
998501901 5:142640459-142640481 GAGCTGAGGCCTTTGCCAGGTGG + Intronic
998573906 5:143292295-143292317 GTGGTAAGGTGTTGGGGAGGGGG + Intronic
998744183 5:145238044-145238066 GAGGGTAGGTCTTTGTGAGAAGG - Intergenic
1000395662 5:160772403-160772425 GAGGTGGTGTCTGTGGGATGTGG + Intronic
1000959680 5:167585065-167585087 GATTTGTGGTCTTTTGGAGGTGG - Intronic
1000980978 5:167816352-167816374 AAGGTAAGGTCTTTAGAAGGAGG - Intronic
1001364292 5:171121651-171121673 GAAGTGAGGACAGTGGGAGGTGG + Intronic
1001464963 5:171955929-171955951 GAGGTGGGGTGAGTGGGAGGAGG - Intronic
1001560129 5:172663622-172663644 GAGGTGCGGTTTCTGTGAGGTGG - Intronic
1001566238 5:172701244-172701266 GGGGTGAGGTCTGTCGGGGGAGG - Intergenic
1001758407 5:174188083-174188105 GAGGGGAGGTCAGAGGGAGGAGG - Intronic
1002343796 5:178534336-178534358 GAGGCGGGGCCTTTGGAAGGTGG - Intronic
1002972817 6:2041652-2041674 GAGGTGGGGTCATGGGGAGGTGG + Intronic
1003435455 6:6083938-6083960 GAGGTGGGGTCTTTGGGAGGTGG + Intergenic
1003687627 6:8320267-8320289 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1003981971 6:11398297-11398319 GAAATGAGGTCTTTGGGAAAGGG + Intergenic
1004171775 6:13300749-13300771 GAGGTGGGGCCTTTGGAAGGTGG + Intronic
1004361229 6:14973003-14973025 GAGGTGAGCCCTTTGGGAGGTGG - Intergenic
1004905761 6:20235654-20235676 AAGGTGAGCACTTTGGGTGGTGG + Intergenic
1004997727 6:21210320-21210342 GAGCTGGAGCCTTTGGGAGGTGG + Intronic
1005194640 6:23268847-23268869 GAGGTGAGGACTTTAGGAGGTGG + Intergenic
1005207925 6:23426365-23426387 GAGGTGAGGGCTGGGGAAGGAGG - Intergenic
1005348248 6:24910744-24910766 GCGGTGAGGTCTGTGTGGGGAGG - Intronic
1005373594 6:25159264-25159286 GAGCTGTGTTCTTTTGGAGGGGG - Intergenic
1005380468 6:25229178-25229200 GAGGTGGGGCTTTTGGGAGATGG + Intergenic
1006132710 6:31878674-31878696 GGGCTGAGGTCCTTGGGAGGAGG - Intronic
1006804114 6:36777430-36777452 GAGGAGAGGGATTTGGGAGCAGG - Intronic
1006804357 6:36778657-36778679 TAGGTGTGGTCGGTGGGAGGTGG - Intronic
1007252847 6:40508121-40508143 GAGGTGAGGGCTTGGAGGGGAGG - Intronic
1007396101 6:41578693-41578715 GAGGGGAGATCTGTGGGGGGTGG + Intronic
1007952548 6:45885165-45885187 GAAGTGGGGCCTTTGAGAGGAGG + Intergenic
1008026039 6:46636970-46636992 AAGGTGATGTCATTAGGAGGTGG + Intronic
1008099392 6:47375062-47375084 GAGGTGGGGCATTTGGAAGGTGG - Intergenic
1008236635 6:49058730-49058752 GAGCTGAGTTCCTTTGGAGGAGG - Intergenic
1008545030 6:52576776-52576798 GAGGTGAGAGCCTGGGGAGGAGG - Exonic
1010185723 6:73141273-73141295 GAGGTGGGGGCTCTGGGAGATGG - Intronic
1010362721 6:75013398-75013420 GAGCTGAGTTCCTTTGGAGGAGG - Intergenic
1010671253 6:78689406-78689428 GAGGTGGAGCTTTTGGGAGGTGG + Intergenic
1011519594 6:88191267-88191289 AAGGTGTGGTCTTTGGGAGTGGG - Intergenic
1011706217 6:90003885-90003907 GGGGTGAAGTCTTTGGGAAGTGG - Intronic
1012443216 6:99281574-99281596 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1013232584 6:108170543-108170565 GAGGTGGGGTCCATGGGGGGTGG + Intronic
1013781852 6:113737618-113737640 CAGGTGAAGACTTTGGGAGATGG + Intergenic
1014787727 6:125637616-125637638 GAGGTTAGGTCTTTATGAGAAGG - Intergenic
1015369804 6:132437858-132437880 AAGGTGTGGTCTTTAGGAGGTGG - Intergenic
1017607693 6:156150973-156150995 GAGGTGAGGCCTTTTGGAGGTGG - Intergenic
1018170026 6:161137267-161137289 GTGGTGAGGTCCTTGGGTGCAGG + Intronic
1018442222 6:163823774-163823796 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
1018605710 6:165595876-165595898 AATGTGGGGCCTTTGGGAGGTGG - Intronic
1018797076 6:167194433-167194455 GAGATGAGGCCTTTGGGCTGTGG - Intronic
1018819263 6:167360655-167360677 GAGATGAGGCCTTTGGGCTGTGG + Intronic
1018828954 6:167427533-167427555 AAGGTGAGGCCTTTAGGAGGTGG - Intergenic
1019218230 6:170457209-170457231 GAGGTGAGCTCTGTGTGAGCAGG - Intergenic
1019332493 7:467318-467340 GAGGTGATGGTTGTGGGAGGAGG - Intergenic
1019332504 7:467372-467394 GAGGTGATATTTGTGGGAGGTGG - Intergenic
1019332528 7:467480-467502 GAGGTGATGGTTGTGGGAGGTGG - Intergenic
1019332543 7:467553-467575 GAGGTGATGGTTTTGGGAGGAGG - Intergenic
1019332561 7:467623-467645 GAGGTGATGGTTGTGGGAGGAGG - Intergenic
1019332578 7:467697-467719 GAGGTGATATCTGTGGGAGGTGG - Intergenic
1019374064 7:679780-679802 GGAGAGAGGCCTTTGGGAGGTGG + Intronic
1019884454 7:3891885-3891907 GCAGTGAGTTTTTTGGGAGGAGG + Intronic
1022003599 7:26247567-26247589 GAGTTCAGCTTTTTGGGAGGTGG - Intergenic
1022309046 7:29177950-29177972 ATGGTGAGGGCTTGGGGAGGGGG - Intronic
1022968578 7:35496748-35496770 GAGGTGAGCCTTTTGGGAGGTGG + Intergenic
1024151491 7:46576318-46576340 AAGGTGAGGTCTTTCTGAGAGGG + Intergenic
1024770912 7:52722453-52722475 GAGGTAGGGCCTTTAGGAGGTGG - Intergenic
1026429505 7:70330044-70330066 AAGGTGAGGCCTTCAGGAGGAGG - Intronic
1028103427 7:86848967-86848989 GAGGAGAGGCTTTTAGGAGGAGG - Intronic
1028533236 7:91862259-91862281 GATGTGAGGAATTTGGGAGAGGG - Intronic
1028939554 7:96505797-96505819 GAGGTGAGGGTTTTGCGAGGTGG - Intronic
1028984446 7:96998587-96998609 GTGGTGAGGTTTGGGGGAGGGGG + Intergenic
1031562648 7:123256521-123256543 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1031992538 7:128207615-128207637 GAGGTTGTGACTTTGGGAGGTGG + Intergenic
1032366471 7:131304868-131304890 GAGTTGAGGCCTTTAGGAGGTGG + Intronic
1033243650 7:139701426-139701448 TAGGTGAGGGCTTTGGGAACAGG - Intronic
1034737132 7:153439857-153439879 AAGGTGAGGGTTTTAGGAGGTGG + Intergenic
1034848896 7:154475309-154475331 GAAATGATGTCTCTGGGAGGTGG - Intronic
1035096481 7:156360157-156360179 GAGGTGAGGTAAATGAGAGGAGG - Intergenic
1035334266 7:158115522-158115544 GAGGAGGGGCCTATGGGAGGTGG + Intronic
1035962628 8:4154576-4154598 GAGGTGAGGTCTTTGGCAATAGG + Intronic
1036080539 8:5550594-5550616 CATTTGAGCTCTTTGGGAGGTGG - Intergenic
1036139355 8:6192164-6192186 GAGGTGTGTTCCTTTGGAGGAGG - Intergenic
1036978156 8:13438559-13438581 GAGATGAGGTCTTAGGGACACGG - Intronic
1037297612 8:17417607-17417629 GAGATGAGACCTTTGGGGGGTGG + Intergenic
1037944068 8:22975445-22975467 GAGGTGAGGCCCTTGGGAGTTGG + Intronic
1038405675 8:27320654-27320676 AGGGTGAGGTCTGTGGGAAGGGG + Intronic
1038421217 8:27435318-27435340 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1038680495 8:29662875-29662897 GAGGTGGGGCCTTTGAGAGGTGG - Intergenic
1038846607 8:31236309-31236331 GAGCTGAGTTCCTTTGGAGGAGG + Intergenic
1040987614 8:53313714-53313736 GAGGGGCAGGCTTTGGGAGGTGG + Intergenic
1041053794 8:53961981-53962003 GAGGTCAGGTTTCTTGGAGGAGG - Intergenic
1041499500 8:58524727-58524749 GAGGTGGGATCTTTAAGAGGTGG + Intergenic
1042158381 8:65867801-65867823 GAGTTCAGCTTTTTGGGAGGTGG - Intergenic
1042731354 8:71938890-71938912 GAGCTGCGTTCTTTTGGAGGGGG + Intronic
1044115014 8:88325435-88325457 GAGGTGGAGTGTGTGGGAGGTGG - Intronic
1044601347 8:94008667-94008689 GAGGTGCGTTCCTTTGGAGGAGG + Intergenic
1045867216 8:106881830-106881852 GGGGTGAGGTCTGTGGAAGGAGG - Intergenic
1047976998 8:130140512-130140534 GAGGTGAGGAGGATGGGAGGAGG - Intronic
1048191413 8:132293120-132293142 AAGGTGAGGTCTAGGGGAAGGGG - Intronic
1048230303 8:132633564-132633586 GAGGTGAGGTATTTAGGAAGGGG + Intronic
1048465569 8:134662245-134662267 CAGGTGGGACCTTTGGGAGGTGG - Intronic
1048582357 8:135740310-135740332 GTGGTGGGGCCTTTGGGAAGTGG - Intergenic
1049537203 8:143187974-143187996 GAGGTGTGGTCTCTGGTAGAGGG + Intergenic
1049943270 9:569332-569354 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1050627995 9:7526360-7526382 GAGGAGAGGCCTTTGGGAGGTGG - Intergenic
1051292650 9:15560780-15560802 GAGCTGCGTTCTTTTGGAGGGGG + Intronic
1051550986 9:18329064-18329086 GAGGTGGGGCCTTTGGGGAGTGG + Intergenic
1051894119 9:21970633-21970655 GAGGGTAGGTGTTTGGGTGGTGG + Intronic
1052172753 9:25421900-25421922 GAAGTGGGATCTTTGAGAGGTGG - Intergenic
1053351963 9:37419041-37419063 CAGGTGAGGTATTGGGGAGAAGG + Intergenic
1055336022 9:75234433-75234455 GAGGTGGGGCCTTTCAGAGGTGG + Intergenic
1055986655 9:82060987-82061009 GCAGTGAAGTCTTTTGGAGGAGG + Intergenic
1056821597 9:89845937-89845959 GAGGGAAGGTGTTTGGGTGGAGG + Intergenic
1056859378 9:90165735-90165757 GAGGTTAGGGATTTGGCAGGAGG - Intergenic
1057495178 9:95554857-95554879 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1058756071 9:108084312-108084334 GAGATGAGGACTTCAGGAGGGGG + Intergenic
1059236077 9:112761668-112761690 GTGGTGCCGTCTTTGAGAGGGGG + Intronic
1059400911 9:114070443-114070465 GCGGAGAGGTCATGGGGAGGAGG + Intronic
1059652691 9:116330239-116330261 TCGGTGAGGTCTTTGGTAGAAGG - Intronic
1060526488 9:124324010-124324032 GAGGTGGGGACTGTGGGAGGGGG - Intronic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1061921375 9:133784284-133784306 GAGGTGAGGGCTGTAGCAGGGGG + Intronic
1062086850 9:134653573-134653595 GAGGGGAGGTCTGGGTGAGGGGG - Intronic
1062412212 9:136431263-136431285 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062412258 9:136431387-136431409 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062412274 9:136431429-136431451 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062412337 9:136431596-136431618 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062412353 9:136431638-136431660 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062412399 9:136431762-136431784 GAGGTGAGGGCCTGGGGGGGCGG - Intronic
1062531311 9:137001856-137001878 GAAGCGGGGTCTTTTGGAGGTGG + Intergenic
1062612641 9:137381949-137381971 GAGGTGAGGGCGCAGGGAGGAGG + Intronic
1062612651 9:137381987-137382009 GAGGTGAGGACGCGGGGAGGAGG + Intronic
1062612657 9:137382006-137382028 GAGGTGAGGACGCGGGGAGGAGG + Intronic
1062612664 9:137382025-137382047 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1062612693 9:137382118-137382140 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1062612700 9:137382137-137382159 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1185758119 X:2668241-2668263 GAGGTGGGGTCTTTAGAAGGTGG + Intergenic
1185938498 X:4285919-4285941 GAGGTGGGGCTTTTTGGAGGTGG + Intergenic
1186689013 X:11955201-11955223 GAGGTGAGGATTTTGGGAGGTGG - Intergenic
1186903910 X:14090496-14090518 TAGGGAAGGTCTTTGTGAGGAGG + Intergenic
1187185033 X:16976345-16976367 GGGGTGGGGTATTTTGGAGGGGG + Intronic
1187447324 X:19371267-19371289 GAGATGGGGGCTATGGGAGGAGG + Intronic
1187938261 X:24356864-24356886 GAGGTGGGGTCTTTGGGGGGCGG - Intergenic
1189326911 X:40118145-40118167 GAGGGGATCTTTTTGGGAGGCGG + Intronic
1189486450 X:41436410-41436432 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1189489417 X:41458156-41458178 GAGGTGGGCTCTTTAAGAGGTGG - Intronic
1189771360 X:44430937-44430959 GAGGTCAAGTGTTTGGGATGTGG - Intergenic
1190213512 X:48466210-48466232 GGGGTGAGGACTCTGGGAGGTGG - Exonic
1190369789 X:49729804-49729826 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1190602268 X:52105622-52105644 GAGCTGAGTTCCTTTGGAGGAGG + Intergenic
1190606612 X:52150178-52150200 GAGCTGAGTTCCTTTGGAGGAGG + Intergenic
1190607640 X:52161003-52161025 GAGCTGAGTTCCTTTGGAGGAGG - Intergenic
1192169462 X:68845218-68845240 AATGTGAGGTCTCTGGGAGCAGG - Intergenic
1192662917 X:73060753-73060775 GAGGTGCGTTCCTTTGGAGGAGG - Intergenic
1193977508 X:88140642-88140664 GAGATGGGGCCTTTAGGAGGTGG + Intergenic
1194271748 X:91824719-91824741 GAGCTGTGTTCTTTTGGAGGAGG + Intronic
1194633218 X:96312167-96312189 GAGATTTGGACTTTGGGAGGGGG + Intergenic
1195081458 X:101375447-101375469 GAGCTGGGGGCTGTGGGAGGAGG - Intronic
1195462162 X:105139720-105139742 GAAGTCAGGTCTTTGGAAGATGG - Intronic
1196580730 X:117376043-117376065 GAGGTGGAGCCTTTGGGAGGTGG + Intergenic
1197635288 X:128907897-128907919 GAGGTGGGGTTTTTAAGAGGTGG - Intergenic
1198296899 X:135295985-135296007 GGGGTCAGGTCTTCGGGAGGTGG - Exonic
1198534761 X:137574708-137574730 GAGGGGAGGTATGTGGGAAGGGG + Intronic
1198832735 X:140767939-140767961 GAGGTGAGATCTTTAAGAGGTGG - Intergenic
1198967735 X:142244946-142244968 GAGGTTGGGTCTATGGGAGCAGG - Intergenic
1199156683 X:144557514-144557536 GAGGTGGGGCCTTTAGGGGGTGG - Intergenic
1199218686 X:145291454-145291476 GTGGGGAAGTGTTTGGGAGGAGG + Intergenic
1199634989 X:149805938-149805960 GAGGAGAGGGCTTTGGTATGAGG + Intergenic
1200168432 X:154053430-154053452 GAGATGGGGTATTTGAGAGGTGG - Intronic
1200588995 Y:5046156-5046178 GAGCTGTGTTCTTTTGGAGGAGG + Intronic
1200707345 Y:6454162-6454184 GAGGAGGGGTCTTTGGGTGATGG + Intergenic
1201026767 Y:9710546-9710568 GAGGAGGGGTCTTTGGGTGATGG - Intergenic
1201165326 Y:11204074-11204096 GAGGTGGGATCTGTGGGAGCAGG + Intergenic
1201250511 Y:12053024-12053046 GAGGTGGTGCTTTTGGGAGGTGG - Intergenic
1201282588 Y:12354177-12354199 GGGGTGAGGGCCTGGGGAGGGGG + Intergenic
1201859555 Y:18581729-18581751 AAAGTGGGGACTTTGGGAGGAGG - Intronic
1201873766 Y:18738652-18738674 AAAGTGGGGACTTTGGGAGGAGG + Intronic
1201949574 Y:19549296-19549318 CAGATGAGGTTTTTGGTAGGTGG - Intergenic