ID: 964364750

View in Genome Browser
Species Human (GRCh38)
Location 3:155937981-155938003
Sequence CTGTGAATATGTATGAAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964364746_964364750 23 Left 964364746 3:155937935-155937957 CCTTTGCCTCACTTATTCTTTAT 0: 1
1: 0
2: 3
3: 41
4: 502
Right 964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG 0: 1
1: 0
2: 2
3: 23
4: 202
964364747_964364750 17 Left 964364747 3:155937941-155937963 CCTCACTTATTCTTTATGTATAA 0: 1
1: 0
2: 6
3: 40
4: 451
Right 964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG 0: 1
1: 0
2: 2
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964364750 Original CRISPR CTGTGAATATGTATGAAGGT GGG Exonic
902165150 1:14564130-14564152 CTGAGAATAGATAGGAAGGTAGG - Intergenic
903428151 1:23270193-23270215 CTGTGAATATGTTATTAGGTTGG + Intergenic
904894679 1:33805593-33805615 ATGTGAATATATTTGAAGATGGG + Intronic
905893171 1:41529581-41529603 GTATGTATGTGTATGAAGGTGGG - Intronic
907043094 1:51281068-51281090 CTGAGCATATGTCTGAAGGTAGG + Intergenic
908050658 1:60226009-60226031 CTTTGACTGTGGATGAAGGTGGG - Intergenic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
909944170 1:81644708-81644730 CGGTGATGATGTATCAAGGTAGG + Intronic
910107320 1:83645537-83645559 CTCCCAATATGTATGAGGGTAGG + Intergenic
911144450 1:94539243-94539265 GTGTGGATATGTATGGGGGTGGG - Intronic
912573631 1:110643785-110643807 CTAAAAATATGTATGGAGGTGGG + Intergenic
919310146 1:195896570-195896592 CTAGGAATATGTATGAGGATAGG + Intergenic
921616332 1:217272062-217272084 CTGTGAATATGGGTGAATGTAGG - Intergenic
922222080 1:223616318-223616340 GTGTGGATGTGTAGGAAGGTAGG - Intronic
922922618 1:229319554-229319576 CTGTGAACATGTGAGTAGGTGGG + Intergenic
923771851 1:236944406-236944428 CTCTGATTATGTAAGTAGGTAGG - Intergenic
924714363 1:246558994-246559016 CTATTAATATTTATTAAGGTTGG + Intronic
1068369319 10:56092928-56092950 CTGTGAATCTGTCTGATCGTGGG + Intergenic
1069008228 10:63342062-63342084 TTTTGCATATGTAAGAAGGTTGG - Intronic
1069580901 10:69566060-69566082 CTGTGAATTTATATGAATCTGGG - Intergenic
1071332964 10:84579082-84579104 ATGTGTATATATATGAGGGTAGG + Intergenic
1071847166 10:89532814-89532836 CTATGAATATGGAGGAAAGTGGG + Intronic
1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG + Intergenic
1073715046 10:106095203-106095225 CTTAAAATATGTGTGAAGGTAGG + Intergenic
1074168979 10:110914273-110914295 CTATGAATATTTATTAAGTTGGG + Intronic
1074833752 10:117269138-117269160 GTGTGCATATGTATGTGGGTGGG - Intronic
1075945661 10:126430889-126430911 CTAGGAATATCTAAGAAGGTAGG + Intronic
1076332420 10:129680202-129680224 CTGTGAATTTTCATTAAGGTTGG + Intronic
1076832420 10:133002719-133002741 CTGAGAATATGTATGCAAGGTGG + Intergenic
1077405429 11:2380442-2380464 GTGTGAGTGTGTGTGAAGGTGGG - Intronic
1078460508 11:11511647-11511669 GTGTGATGATGTTTGAAGGTAGG + Intronic
1080564572 11:33496328-33496350 CTGATAATATCTATGAAGGTAGG + Intergenic
1081919886 11:46764310-46764332 CTGTGAATATCTTTGAATGTAGG - Intronic
1082122872 11:48398273-48398295 ATGTGAAGGTGTTTGAAGGTTGG - Intergenic
1082556570 11:54569549-54569571 ATGTGAAGGTGTTTGAAGGTTGG - Intergenic
1083570277 11:63757074-63757096 ATGTGAAAATAAATGAAGGTGGG - Intronic
1083743800 11:64724117-64724139 CTGTGCATGTGTATGAGTGTGGG + Intergenic
1086104949 11:83137554-83137576 TTGTGAATTTCTATGAAGTTTGG + Intergenic
1088832014 11:113545042-113545064 CTGAGAATATGTGGGAGGGTTGG - Intergenic
1091354513 11:134925447-134925469 ATGTGAGTGTGTATGAATGTGGG + Intergenic
1095604232 12:44047491-44047513 TCTTGAATATGGATGAAGGTAGG - Intronic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1098056267 12:66509030-66509052 CTGAGAATATATATTAAGTTAGG - Intronic
1098947689 12:76606712-76606734 CTGTGTATATGTTTGAGGATGGG + Intergenic
1099316419 12:81088027-81088049 CTGCTAATATGTAGGAAGATTGG + Intronic
1099835042 12:87899046-87899068 CTGTGTGTATGTGTGATGGTTGG - Intergenic
1102036203 12:109771851-109771873 CTTTGATTATGAATGAGGGTGGG - Intergenic
1102633745 12:114304446-114304468 CTGTGAAGATGCATGGAGTTGGG - Intergenic
1106370579 13:29128633-29128655 CAGTGAATATTTATGAATGGTGG + Intronic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1108339208 13:49480364-49480386 GTGTGTATATCTTTGAAGGTGGG + Intronic
1108566455 13:51703633-51703655 CTGTGAAAAACTATCAAGGTAGG + Exonic
1108796909 13:54043390-54043412 ATGTGTATATGTATGTTGGTGGG + Intergenic
1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG + Intergenic
1111073685 13:83204465-83204487 ATGTGAATATGTAGCAAGATTGG + Intergenic
1111409062 13:87850801-87850823 CTATGAATCTGTTTTAAGGTGGG - Intergenic
1111532900 13:89563081-89563103 CAGGGAATGTGTATGAAGGAGGG - Intergenic
1113821010 13:113212937-113212959 CTGTGCAAATGTATGAAGCTGGG - Intronic
1114255053 14:20994498-20994520 CTGTGAGTGTGTAGGAAGTTAGG - Intronic
1114742434 14:25111546-25111568 CAGTGAGTATGCATGAATGTGGG + Intergenic
1115135761 14:30106510-30106532 TTGTGAAGATGTAAGAGGGTTGG + Intronic
1120663504 14:87278660-87278682 CTGGGAAGATGTATGGAGATGGG + Intergenic
1121175992 14:91891006-91891028 CTCTGAATATGGCTGAGGGTAGG - Intronic
1121218690 14:92268514-92268536 CTGGGAATCTGTATCAAGTTGGG + Intergenic
1121298419 14:92849457-92849479 TTGTGAATGTGTATGTATGTAGG + Intergenic
1121940303 14:98064088-98064110 CAGTGAATATATATGAATGATGG - Intergenic
1123738919 15:23215571-23215593 CAGTGAATAAGTTTGAACGTGGG + Intergenic
1124290140 15:28444542-28444564 CAGTGAATAAGTTTGAACGTGGG + Intergenic
1124293098 15:28473026-28473048 CAGTGAATAAGTTTGAACGTGGG - Intergenic
1124406669 15:29398859-29398881 CTGTGAATATGTATGTGATTAGG + Intronic
1126435880 15:48637032-48637054 GTTTGAATATATATGGAGGTGGG + Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131211879 15:90504632-90504654 CTTTAAAAATGAATGAAGGTGGG - Intergenic
1131647992 15:94366768-94366790 CTCTGTTTATGTATGCAGGTGGG - Intronic
1133321339 16:4915439-4915461 CTGTGAATATGTCTGAGGTCTGG - Intronic
1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG + Intergenic
1134533921 16:15008999-15009021 ATGTGAATGTCCATGAAGGTTGG + Intronic
1139120194 16:64007119-64007141 ATTTGAATATATTTGAAGGTGGG + Intergenic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139862116 16:70031726-70031748 ATGTGAATGTCCATGAAGGTTGG - Intergenic
1143075960 17:4343531-4343553 CTTTTCATATATATGAAGGTTGG + Intronic
1147412828 17:40265922-40265944 CTGTGAATTTGTGGGAAGATAGG + Intronic
1147471766 17:40668915-40668937 TTGAAAATATGTATGTAGGTCGG - Intergenic
1148441336 17:47713208-47713230 CCTTGAGTATGTCTGAAGGTGGG + Intergenic
1149189861 17:54048356-54048378 ATCTGAATATGTAAGAAAGTAGG + Intergenic
1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG + Intergenic
1156705288 18:39874260-39874282 CTCTAAATATGTATGAGTGTTGG - Intergenic
1157051588 18:44172362-44172384 CTTTGAATATGTCTTAAGGTGGG + Intergenic
1157069296 18:44387133-44387155 CTGTGTACATGTATGTATGTTGG - Intergenic
1157165299 18:45353281-45353303 CTGTGGATATGTATAATTGTTGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159251138 18:65878417-65878439 CAGCTAATATGTAGGAAGGTTGG + Intronic
1159664059 18:71135530-71135552 CTGTGAATATAAATGAACGGAGG + Intergenic
1162252046 19:9453855-9453877 CTGTTTTTTTGTATGAAGGTTGG - Intergenic
1163014719 19:14447454-14447476 CAGTGACTATGTGTGATGGTAGG - Intronic
1164232526 19:23302777-23302799 CTGTGAAGCTCTATGAAAGTGGG + Intergenic
1165293604 19:34908197-34908219 ATGTAAATATGTTTGAAGGTGGG + Intergenic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
925521002 2:4745927-4745949 GTGTGTATAGGTATGCAGGTGGG - Intergenic
928498945 2:31866526-31866548 GGGTAAATATGTATGAAGTTAGG + Exonic
928849715 2:35730459-35730481 CTGGGAAAAGGTATAAAGGTAGG + Intergenic
931296063 2:60927038-60927060 CTGGGCTTCTGTATGAAGGTTGG + Exonic
931599855 2:63992271-63992293 CCTTGAATGTGTATGGAGGTAGG - Intronic
932446328 2:71783917-71783939 CTGTGAATAACTATGCAGTTTGG - Intergenic
932771332 2:74502393-74502415 CTGTGAATGTGTAGCAGGGTTGG + Intronic
933009714 2:77044815-77044837 GTGTGAATATATATGCATGTAGG + Intronic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
935715602 2:105936514-105936536 CTGTGTAGATGTATGCATGTTGG - Intergenic
940558097 2:155257956-155257978 CTGTGTATATGTATAAAGAAAGG - Intergenic
941878887 2:170461822-170461844 GTATGTATATGTATGGAGGTCGG + Intronic
942155502 2:173123330-173123352 CTGGGAATATGTGTGGGGGTAGG - Intronic
942163337 2:173215701-173215723 CTCTGAACAGGTATGGAGGTGGG - Intronic
942872262 2:180749414-180749436 CATTGAATATTTATGAAGTTTGG + Intergenic
943262323 2:185681995-185682017 CTGTGCAAATATATGAAGCTGGG - Intergenic
943794082 2:191969839-191969861 CTATGAGTATTTCTGAAGGTGGG + Intronic
945438058 2:209842366-209842388 CTGTGAAGCTTTCTGAAGGTGGG + Exonic
945899855 2:215525569-215525591 GTGTGAATATGCAGGAATGTGGG - Intergenic
946881025 2:224177230-224177252 ATGTGACTATATTTGAAGGTAGG - Intergenic
947796901 2:232899089-232899111 AAATGAGTATGTATGAAGGTGGG + Intronic
1169684665 20:8257739-8257761 CAGTGAAAATTCATGAAGGTTGG - Intronic
1169914183 20:10671475-10671497 CTGTGTCTGTGTATGAAGCTTGG - Intronic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170326942 20:15166379-15166401 ATGTGAATATGCAAGAAGTTAGG + Intronic
1173688278 20:44939238-44939260 CTCTGTATGTGAATGAAGGTTGG + Exonic
1174530617 20:51210512-51210534 CTGTGTATATGTATGAAGGGAGG - Intergenic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1176650681 21:9544174-9544196 CTGTAAATTTGTATGCCGGTAGG + Intergenic
1177383070 21:20370845-20370867 ATGTGACTATATTTGAAGGTAGG + Intergenic
1179436896 21:41368509-41368531 GGGTGAACATGTGTGAAGGTCGG - Intronic
1184606316 22:45576658-45576680 CTGTGCATATTCATGAAGGTGGG - Intronic
949821868 3:8124384-8124406 CTGTGAATATTCATGAAAGGGGG + Intergenic
952217602 3:31293400-31293422 CAGGGAATATGTCTGAAGGTGGG - Intergenic
953308550 3:41853921-41853943 CTGTGAATATTCATGAAGGGGGG - Intronic
953491052 3:43351440-43351462 ATGTGAATGTGTATGAAGGAAGG - Intronic
953898024 3:46817981-46818003 CTGTGTATCTGTATGAGGCTAGG + Intergenic
955358958 3:58256218-58256240 TTGTGATTATGTATGTATGTAGG - Intronic
955986879 3:64582770-64582792 TTGTGAATAGGTATGAAGAAGGG - Intronic
957403272 3:79744433-79744455 ATGTGATGATGTCTGAAGGTAGG + Intronic
957405510 3:79770685-79770707 CTGTGAACATCTATAAAAGTTGG + Intergenic
957570346 3:81939501-81939523 GGGAGAAAATGTATGAAGGTAGG - Intergenic
957605345 3:82391597-82391619 CAGTGCATCTGTATGAAGATAGG + Intergenic
960211176 3:114968518-114968540 CTTTGAATAAGCATGCAGGTTGG + Intronic
961199192 3:125030634-125030656 CAGTAAATATGCATGGAGGTAGG + Intronic
961456170 3:127025128-127025150 CTGTGAGTTTGGATGAACGTAGG + Intronic
961781255 3:129321701-129321723 GTGTGAATGTGTAAGAAAGTGGG - Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962557337 3:136567539-136567561 CTGTATATATGTGTGAATGTGGG - Intronic
964019260 3:151987936-151987958 CTGTGCATATTTATGAATCTTGG - Intergenic
964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG + Exonic
964669005 3:159204785-159204807 GTGTGAGTGTGAATGAAGGTAGG + Intronic
964855652 3:161142788-161142810 ATTTGAATATGTATGCAGCTTGG - Intronic
973684655 4:53356959-53356981 CTATTAATATTAATGAAGGTAGG - Intronic
977677448 4:99763526-99763548 GTGTGAATCTGTCAGAAGGTGGG + Intergenic
977882819 4:102225287-102225309 ATGTGACTATGTTTGAAGATAGG - Intergenic
978474787 4:109114371-109114393 CTATGAGTAAGTATGAATGTAGG + Intronic
978633359 4:110773973-110773995 CTGGGAACGGGTATGAAGGTTGG - Intergenic
980529646 4:134036389-134036411 CTATGAATATGTTTGAAGCTTGG - Intergenic
983925415 4:173396011-173396033 CTGTGAAGATGTATTGTGGTGGG + Intronic
984613055 4:181863252-181863274 CTTTGAAGAAGTATGAATGTTGG - Intergenic
991083792 5:62629578-62629600 CTGTGAAATTTCATGAAGGTGGG - Intergenic
992385332 5:76279229-76279251 CTGTGAAGATGTAAGTAGGCAGG + Intronic
993340547 5:86719968-86719990 CTGAGAAAATGTAGGAAGGAGGG + Intergenic
993559127 5:89381694-89381716 TTGAGAATATTTATGAAAGTTGG - Intergenic
993646203 5:90466344-90466366 CTGTGAATATTTGTGAAGTAAGG - Intronic
994548051 5:101193964-101193986 GTGTGTATATGTATGTAGGTAGG - Intergenic
995691665 5:114832968-114832990 CTGTGAATATGTCTGATCCTGGG - Intergenic
999284976 5:150389086-150389108 ATGTACATATGTATGTAGGTAGG - Intronic
1000155349 5:158545775-158545797 ATATGAATATGTTTGAAGCTTGG + Intergenic
1000495892 5:161984146-161984168 CTGAGAATATGTATGAGAGCAGG - Intergenic
1000671911 5:164073493-164073515 GTGTGTCTATGTATGGAGGTTGG + Intergenic
1002383087 5:178844541-178844563 CTCTGAATATGTTTTAAGATCGG - Intergenic
1004055338 6:12130970-12130992 CTTTTAATATGTATTTAGGTGGG + Intronic
1007746276 6:44045162-44045184 GTGTGTATATGAATGTAGGTAGG - Intergenic
1010106450 6:72174968-72174990 GTGTGAATGTGTATGTGGGTGGG - Intronic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1015006440 6:128287226-128287248 CTGTGAATTGGGATGAACGTAGG + Intronic
1016573318 6:145539316-145539338 CTGTTTATATGTAATAAGGTAGG + Intronic
1017183280 6:151574572-151574594 CTGTGAATGTGATTGACGGTAGG - Intronic
1017766337 6:157610087-157610109 CTGTGAATATTTAAGGTGGTTGG - Intronic
1018644067 6:165931549-165931571 ATGTGAACATGAAAGAAGGTGGG + Intronic
1023740877 7:43279569-43279591 CTGTGCAAAGGTATGAAGATGGG - Intronic
1024752623 7:52486254-52486276 CTGTGTATATGTATGTACATAGG - Intergenic
1024954140 7:54898402-54898424 TTGTGTTTATGTATGAAGGTAGG - Intergenic
1026486381 7:70825362-70825384 CTGTGAAAATGTCTGAGGGTAGG - Intergenic
1027503464 7:78984572-78984594 CTGTGATTATATCTGAAGGCAGG - Intronic
1031727062 7:125253101-125253123 ATGTGATAATGTTTGAAGGTGGG + Intergenic
1032978448 7:137252921-137252943 CTGTGAAACTGTGTGGAGGTTGG + Intronic
1034130014 7:148707042-148707064 CTTTTAATATATATGAATGTAGG - Intronic
1034994702 7:155570572-155570594 AGGTGAGTGTGTATGAAGGTGGG - Intergenic
1035244995 7:157556742-157556764 ATGTGCATATGTATGAGTGTGGG - Intronic
1035922146 8:3689217-3689239 CTGTGGATAAGTTAGAAGGTGGG - Intronic
1036166438 8:6438532-6438554 CTGTGAGTGTGTTTGAGGGTAGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039374498 8:37019628-37019650 CTATGAATGTGTATGAGTGTTGG - Intergenic
1040745883 8:50641872-50641894 CTGTGAATGTGTACAAAGATAGG - Intronic
1041376792 8:57214360-57214382 CTGGAAATATGCATGAAGGTGGG + Intergenic
1042014706 8:64295672-64295694 CTGTGAATATCTGGGAAGTTAGG - Intergenic
1042592981 8:70415892-70415914 TTATGAATATCTATGAAGATGGG - Intergenic
1050830701 9:10008546-10008568 CTGTGAATATGCATGAAATGGGG - Intronic
1051727264 9:20101200-20101222 CTGTAAATATGTCTGAAGGTCGG + Intergenic
1052199199 9:25757338-25757360 ATGTGACTATGTATGAAGATAGG + Intergenic
1052570910 9:30222310-30222332 CTGTAAATATTTATGAAGTGTGG - Intergenic
1053793924 9:41707494-41707516 CTGTGAATATTTATCAAAGTAGG + Intergenic
1054151248 9:61607292-61607314 CTGTGAATATTTATCAAAGTAGG - Intergenic
1054182335 9:61919509-61919531 CTGTGAATATTTATCAAAGTAGG + Intergenic
1054471028 9:65538471-65538493 CTGTGAATATTTATCAAAGTAGG - Intergenic
1054656175 9:67668970-67668992 CTGTGAATATTTATCAAAGTAGG - Intergenic
1055304214 9:74911897-74911919 CTATTAATATGTCTGAAGTTGGG - Intergenic
1056125950 9:83537126-83537148 GGGTGAATATGTAGGCAGGTGGG - Intronic
1056394341 9:86167966-86167988 CTGTGAATATTTATGAAAGAGGG + Intergenic
1186295004 X:8139692-8139714 CTGTAATTATGTTTGAAGTTTGG + Intergenic
1187255383 X:17637143-17637165 GTATGAAAATGTATGAATGTAGG - Intronic
1188818686 X:34746886-34746908 CTGTGAATATGTGTGTGGGGTGG + Intergenic
1188990333 X:36811296-36811318 CTATGAAAATGTATTAAGGGAGG + Intergenic
1189928875 X:45986652-45986674 CTGTACATATGGATCAAGGTGGG - Intergenic
1190709495 X:53056294-53056316 TTGGGTATATGTATGAAAGTAGG + Intronic
1191955554 X:66639180-66639202 CTGTGAGTGTGTATGCAGGCTGG - Intronic
1192171557 X:68858767-68858789 CTGTGAATATCTGTGCGGGTCGG - Intergenic
1192830016 X:74741590-74741612 CAGTCAATATGGATGATGGTCGG - Exonic
1192909214 X:75585464-75585486 CTGTGCCTATGTTTGCAGGTGGG + Intergenic
1193913351 X:87332994-87333016 CTTTGAAAATGTATTAAGATTGG + Intergenic
1194814998 X:98430425-98430447 TTGTATATATGTATGTAGGTAGG - Intergenic
1195952346 X:110288318-110288340 CTGTAAAGATATATGAGGGTGGG - Intronic
1196596558 X:117552660-117552682 CAGTGAAAATGAATGAAGGCTGG + Intergenic
1196691699 X:118565765-118565787 GTATGAATATGTATAAAGTTGGG - Intronic
1196874788 X:120147451-120147473 CTGTGTATGTGTGTGAATGTGGG + Intergenic
1196921475 X:120590190-120590212 CTGTGAATATGTTTCTAGTTTGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic