ID: 964369538

View in Genome Browser
Species Human (GRCh38)
Location 3:155985413-155985435
Sequence TTCTGTGTTTTTAGTGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964369535_964369538 -5 Left 964369535 3:155985395-155985417 CCACTGCGCCTGGCTAATTTCTG No data
Right 964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG No data
964369531_964369538 22 Left 964369531 3:155985368-155985390 CCAAGTAGCTGGAATTACAGGCG 0: 1046
1: 26905
2: 154114
3: 179387
4: 261172
Right 964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG No data
964369533_964369538 -1 Left 964369533 3:155985391-155985413 CCCGCCACTGCGCCTGGCTAATT 0: 214
1: 2191
2: 21575
3: 51921
4: 72849
Right 964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG No data
964369530_964369538 23 Left 964369530 3:155985367-155985389 CCCAAGTAGCTGGAATTACAGGC 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
Right 964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG No data
964369534_964369538 -2 Left 964369534 3:155985392-155985414 CCGCCACTGCGCCTGGCTAATTT 0: 177
1: 1881
2: 21010
3: 46426
4: 56957
Right 964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964369538 Original CRISPR TTCTGTGTTTTTAGTGGAGA CGG Intergenic
No off target data available for this crispr