ID: 964371820

View in Genome Browser
Species Human (GRCh38)
Location 3:156008189-156008211
Sequence TGAACATGGTGCCATCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964371816_964371820 2 Left 964371816 3:156008164-156008186 CCATAGGTTTTTTGTGGCACCTT No data
Right 964371820 3:156008189-156008211 TGAACATGGTGCCATCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964371820 Original CRISPR TGAACATGGTGCCATCCTAT GGG Intergenic
No off target data available for this crispr