ID: 964375043

View in Genome Browser
Species Human (GRCh38)
Location 3:156041416-156041438
Sequence GCCAGCCGGCCTGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 2, 1: 4, 2: 20, 3: 47, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964375034_964375043 17 Left 964375034 3:156041376-156041398 CCGGGTGGGCGTGGGCTCGGCGG 0: 79
1: 581
2: 637
3: 391
4: 425
Right 964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG 0: 2
1: 4
2: 20
3: 47
4: 297
964375041_964375043 -8 Left 964375041 3:156041401-156041423 CCGGCACTCGGAGCGGCCAGCCG 0: 13
1: 108
2: 492
3: 592
4: 623
Right 964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG 0: 2
1: 4
2: 20
3: 47
4: 297
964375030_964375043 29 Left 964375030 3:156041364-156041386 CCAGCGCGAGTTCCGGGTGGGCG 0: 119
1: 275
2: 784
3: 689
4: 391
Right 964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG 0: 2
1: 4
2: 20
3: 47
4: 297
964375040_964375043 -7 Left 964375040 3:156041400-156041422 CCCGGCACTCGGAGCGGCCAGCC 0: 1
1: 19
2: 226
3: 509
4: 677
Right 964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG 0: 2
1: 4
2: 20
3: 47
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964375043 Original CRISPR GCCAGCCGGCCTGCAAGCCC CGG Intronic
900012804 1:131376-131398 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900042868 1:487363-487385 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900064305 1:722360-722382 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900158451 1:1212643-1212665 ACAACCAGGCCTGCAAGCCCTGG - Exonic
900408468 1:2502577-2502599 GCCTGCCTGCTTGCAGGCCCCGG - Intronic
901018179 1:6243351-6243373 GCCACCCAGCCTGGAAGCCCAGG + Intergenic
903792921 1:25906612-25906634 CCCAGGCGCCCTGCAACCCCCGG - Intronic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905695303 1:39969267-39969289 GCCAGCCCGTCAGCCAGCCCAGG + Intronic
906136768 1:43505535-43505557 TCCAGCCGGACTGCCTGCCCTGG - Intergenic
906492493 1:46279239-46279261 GCCAGCAGGCCAGCATTCCCTGG + Exonic
907371159 1:54004489-54004511 GCCAGCCAGCCCACAAGCCCGGG - Intergenic
910113814 1:83710773-83710795 GCCAGCTGGGATGCAGGCCCAGG + Intergenic
911001446 1:93170364-93170386 GCCGGCCGGCCTGCAAGCCCTGG + Intronic
913486103 1:119333849-119333871 GCCGGCAGGCCTGCGAACCCCGG + Intergenic
915165595 1:153946305-153946327 GCCGGCCGGCCGGGAAGCGCGGG - Exonic
915593074 1:156881582-156881604 GCACGCCCGGCTGCAAGCCCTGG + Exonic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
917472197 1:175335343-175335365 GCCAGCCAGCCTGCAGGTCAGGG - Intronic
919049795 1:192499316-192499338 GCCAGCCGGCCCACCGGCCCAGG - Intergenic
920689215 1:208132935-208132957 GCCAGCCTGGGTTCAAGCCCTGG - Intronic
922099205 1:222468372-222468394 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
922152344 1:223017125-223017147 GCCACCCGGCCGGCCAGCACTGG - Intergenic
922261242 1:223947866-223947888 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
922575836 1:226660094-226660116 GCCAGCCAGGCTGCCAGCCGTGG - Intronic
922735830 1:227977874-227977896 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
923052981 1:230401781-230401803 GCCAGGGCGCCTCCAAGCCCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923499800 1:234555245-234555267 CCCAGCCGGCCTCCATGCTCAGG + Intergenic
923623238 1:235594650-235594672 AGCGGCCGGCCCGCAAGCCCCGG - Intronic
924075006 1:240324507-240324529 GCCAGCCACCATGCATGCCCAGG - Intronic
924342409 1:243050046-243050068 GCCATCTGCCCTGAAAGCCCAGG + Intergenic
924429402 1:243984191-243984213 GCCATCCGGCCTGCAGGTACAGG + Intergenic
1063309317 10:4937646-4937668 GCCCCCCGGCCCGCAAGCCCCGG - Intronic
1063321055 10:5053364-5053386 GCTGGCCAGCCTGCAAGCCCAGG - Intronic
1064008121 10:11714152-11714174 CCCTGCCGGCCAGCAGGCCCAGG + Intergenic
1064953049 10:20875732-20875754 GCCAGCCAGCCAGCCAGCCATGG + Intronic
1066734068 10:38455509-38455531 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1067456629 10:46423748-46423770 CCCAGCAGGCCTGCTAGCCAGGG + Intergenic
1067630573 10:47960891-47960913 CCCAGCAGGCCTGCTAGCCAGGG - Intergenic
1067741403 10:48898362-48898384 GCCAGCTGCCCTGGAGGCCCAGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070987300 10:80699926-80699948 CCCTGCCTGCCAGCAAGCCCAGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1074545191 10:114396777-114396799 GCCAGGCAGCCAACAAGCCCAGG - Intronic
1075305711 10:121365673-121365695 GCCGGCGGGCCTGCCGGCCCCGG + Intergenic
1076159787 10:128234898-128234920 GCCATCTGGCCTCCAGGCCCAGG - Intergenic
1076969140 11:123580-123602 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1077266487 11:1653281-1653303 GGCTGCCAGCCTGCACGCCCTGG + Intergenic
1077339799 11:2021235-2021257 GCAGGCCTGCCTTCAAGCCCAGG - Intergenic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1079296796 11:19241552-19241574 GCCAGCCGGCCCGCCAGTCCCGG - Exonic
1079353397 11:19712353-19712375 CCCAGCCGGCCTGGAAGAGCAGG + Intronic
1079708684 11:23653413-23653435 GCCGGCCGGCCTGCAAACCCCGG - Intergenic
1079756818 11:24274504-24274526 ACCGGCCGGCCCACAAGCCCTGG - Intergenic
1080893309 11:36428029-36428051 GCCAGCCATCCTGCACTCCCTGG - Intronic
1081315193 11:41622972-41622994 GCTGGCCCGCCTGCAAGCCCCGG + Intergenic
1081692797 11:45089487-45089509 CCCAGCTGGCCTCCAAGGCCAGG + Intergenic
1084089398 11:66870246-66870268 GCCTGCCGGCCTGTGAGCACAGG + Intronic
1084435567 11:69137321-69137343 CCCAGCAGGGCTGGAAGCCCAGG + Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086724638 11:90167285-90167307 GCCGGCCAGCCTGCAAGCCCGGG + Intronic
1089560340 11:119340349-119340371 GCGAGCCGGCCGCCAGGCCCAGG + Exonic
1090401891 11:126454314-126454336 GACAGCAGGGCTGCACGCCCTGG - Intronic
1090776738 11:129972084-129972106 GCCAGCCGGCCTTGCCGCCCCGG - Intronic
1202822784 11_KI270721v1_random:76424-76446 GCAGGCCTGCCTTCAAGCCCAGG - Intergenic
1091447820 12:554030-554052 GCCAGCTGGCCTGGAAGGCAGGG + Intronic
1091991603 12:4960355-4960377 CCCAGCAGCCCTGCCAGCCCGGG - Intergenic
1092058162 12:5524056-5524078 GCGAGACAGCCGGCAAGCCCAGG + Intergenic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1094507088 12:31071421-31071443 AGCAGCCGGCCCGCCAGCCCCGG + Intergenic
1094722050 12:33075442-33075464 GCCGGACGGCCCACAAGCCCGGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099436813 12:82655925-82655947 GCCAGCTGGTCAGCAAGCCTGGG - Intergenic
1101605825 12:106247374-106247396 GCTCGACGCCCTGCAAGCCCTGG + Exonic
1101612098 12:106302221-106302243 GCCAGTGCGCCTGGAAGCCCAGG + Intronic
1102043294 12:109814615-109814637 GCCAGTCGCCCTGCTGGCCCAGG - Exonic
1102904010 12:116660822-116660844 GCCGGCCAGCCTGCAAGCCCCGG + Intergenic
1103510132 12:121467890-121467912 GCCAGCGGTCCTGCAGGCTCTGG - Intronic
1104262221 12:127194639-127194661 GCCAGAATGCCTGAAAGCCCTGG - Intergenic
1104537308 12:129630124-129630146 CCCAGCTGGCCTGGAACCCCTGG + Intronic
1106112050 13:26785964-26785986 GCCTGCCGGCATGCAGGCACTGG + Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1108685468 13:52815482-52815504 GGCGGCCGGCCCACAAGCCCTGG - Intergenic
1108857960 13:54819504-54819526 GCCAGAAGGACTGCAATCCCTGG + Intergenic
1113126743 13:106987601-106987623 GCCAGCTGGCCGGCACACCCCGG - Intergenic
1113787257 13:113008964-113008986 GCCCGCCCGCCCGCAAGCCCTGG - Intronic
1116426511 14:44798690-44798712 GCCGGCCGCCCCGCCAGCCCCGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116849425 14:49893344-49893366 GCCCGCCGGCCTGCGAGCACTGG - Exonic
1118222449 14:63867765-63867787 GCCAGCCAGCCAGCCAGCCAAGG + Intronic
1118822855 14:69356202-69356224 GACAGCCCAGCTGCAAGCCCAGG - Exonic
1118932353 14:70254812-70254834 GCCGGCCAGCCCACAAGCCCAGG + Intergenic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1121407171 14:93726110-93726132 GCCTGCTGCCCTCCAAGCCCAGG - Intronic
1122985876 14:105211424-105211446 GCCAGTGGGCCTGGGAGCCCTGG - Intronic
1123038079 14:105479347-105479369 GCGAGCCGGCCTGCACGTTCTGG + Intronic
1123417303 15:20103121-20103143 GCCAGCCAGCCAGCAAAGCCGGG - Intergenic
1123526578 15:21109975-21109997 GCCAGCCAGCCAGCAAAGCCGGG - Intergenic
1124198591 15:27656668-27656690 GCCAGTGGGCCCACAAGCCCCGG - Intergenic
1124500889 15:30225570-30225592 GCCAACCGCCCTGCGGGCCCAGG + Intergenic
1124742681 15:32313097-32313119 GCCAACCGCCCTGCGGGCCCAGG - Intergenic
1125516506 15:40323983-40324005 GCCTGGCGGCCTGCAAGGACTGG - Intergenic
1126358572 15:47822266-47822288 GCCTGCAGGCCTGCCAGGCCGGG + Intergenic
1127973520 15:63980432-63980454 GCCTGCAGCCCTGCCAGCCCTGG - Intronic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1129232710 15:74205685-74205707 GCCAGCCTGGCTGCAGCCCCTGG - Intronic
1131054132 15:89365650-89365672 GGAGGCCGGCCTGCAAGCCTAGG - Intergenic
1131250245 15:90825610-90825632 GCCGGCCAGCCCGCAAGCCCGGG + Intergenic
1131265306 15:90912051-90912073 GCCTGTCCGCCTGCCAGCCCTGG + Exonic
1131563690 15:93466193-93466215 CCCAGGTGGCCTGTAAGCCCAGG + Intergenic
1132029794 15:98430278-98430300 CACAGCCGGCCTCCAACCCCTGG - Intergenic
1132196287 15:99916882-99916904 CCCAGCAGGCCTGCAGGCTCTGG + Intergenic
1132352271 15:101147320-101147342 ACTATCCAGCCTGCAAGCCCAGG - Intergenic
1132505608 16:306973-306995 GCCACCCAGCCTCCAGGCCCCGG - Intronic
1132720858 16:1314949-1314971 GCAAGCCGGCCTGGAGTCCCTGG - Intronic
1132751789 16:1461018-1461040 CCCAGACCGCCTGCAGGCCCCGG + Intronic
1132759154 16:1500550-1500572 GCCAGCAGTTCTGCAAGCACCGG - Exonic
1134230607 16:12426313-12426335 GCCAGGAGAGCTGCAAGCCCCGG - Intronic
1136057211 16:27699277-27699299 ATCTGCCCGCCTGCAAGCCCAGG + Intronic
1136639476 16:31550608-31550630 GCCACCCGCCATGCAAGCCTGGG - Intergenic
1138095824 16:54210593-54210615 GCCAGCCTCCCTGCAGGCCCTGG + Intergenic
1138688761 16:58748952-58748974 GCCAGCCAGCCCGCCGGCCCCGG + Intergenic
1141166407 16:81663931-81663953 GCCTGCTGGCCTGCGTGCCCAGG + Intronic
1142398588 16:89847392-89847414 GCCAGCCGGCCTCCCAGCCCTGG - Intronic
1142451534 16:90175542-90175564 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1203138843 16_KI270728v1_random:1747108-1747130 GCCACCCGGCCAGCAAAGCCAGG + Intergenic
1142750631 17:1985378-1985400 GCCAGGCGGCTTGCGAGCCCTGG - Intronic
1142979349 17:3662742-3662764 GCCCACCTGCCTGAAAGCCCGGG - Intergenic
1147044623 17:37743746-37743768 GCCAGCCGGCCTGAACTCCCGGG + Intronic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1148342448 17:46881324-46881346 GCCAGCTGGTCTCCAGGCCCAGG - Intronic
1149550431 17:57535447-57535469 CCCAGCAGGCCTGCTTGCCCTGG + Intronic
1149614643 17:57988007-57988029 GCCCGCCCGCCCGCCAGCCCGGG + Intronic
1150435063 17:65147283-65147305 GCCAGCCAGCGTGCAGACCCAGG - Intronic
1150775812 17:68080753-68080775 GGCCCCCGGCCCGCAAGCCCCGG + Intergenic
1152009278 17:77700961-77700983 GCCAGCCAGCCAGCCATCCCTGG - Intergenic
1152308576 17:79535574-79535596 TGCAGCAGACCTGCAAGCCCAGG - Intergenic
1152451484 17:80383976-80383998 CCCAGCAGGCCTGAAGGCCCTGG + Intronic
1156036610 18:32772108-32772130 GCCCGCCGGCCCGCCCGCCCGGG + Exonic
1156610504 18:38718648-38718670 GCCCGCCAGCCCGCAAGCCCTGG - Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1159322214 18:66866802-66866824 GCGGGCCGGCCCGCAAGCCCGGG + Intergenic
1160645946 19:193506-193528 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1160960652 19:1719188-1719210 CCCATCCCGCCTGCAGGCCCGGG + Intergenic
1161162893 19:2770435-2770457 GGCAGCCGGCCAGCCTGCCCCGG - Intronic
1161314813 19:3612852-3612874 GCCAGTGGGCCAGCAAGCCCAGG + Intronic
1161321856 19:3645126-3645148 AGCAGCCTGCCTGCAAGCGCTGG + Intronic
1161327123 19:3669330-3669352 CTCAGCCGGCCTGGAAGCCAGGG - Intronic
1162119442 19:8453836-8453858 GCCATCAGGCTTGGAAGCCCGGG - Intronic
1162230131 19:9259611-9259633 GCAGGCCGGCCTGCCGGCCCTGG + Intergenic
1163583907 19:18153816-18153838 GCCAGCCCGCCCCCACGCCCCGG - Intronic
1163639243 19:18452034-18452056 GACAGCCTTCCTGGAAGCCCAGG + Intronic
1163640131 19:18457381-18457403 GCCAGCCTGCCGCCAAGCCAGGG + Intronic
1163648967 19:18506090-18506112 CCCAGCCTCCCTCCAAGCCCTGG + Intronic
1163701159 19:18787312-18787334 GCAAGCTGGGCTGCAAGGCCAGG - Intronic
1163830141 19:19543687-19543709 GCCAGCCAGCCTGCGACCCCCGG + Exonic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166040108 19:40197216-40197238 GCCAGCAGACATGCAAGGCCTGG + Intronic
1167643627 19:50694853-50694875 GCGGGCCGGCCGGCAGGCCCCGG - Intronic
927215961 2:20667873-20667895 ACCAGCCGGCCTGCAAGGCCAGG - Intronic
928081668 2:28317533-28317555 GCCAGCCCACATGGAAGCCCAGG + Intronic
929000397 2:37342750-37342772 GCCAGCCGGCCTCCAACAGCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929372402 2:41241969-41241991 GCCAGCAGGCCTGCTATCCAAGG + Intergenic
929581118 2:43082331-43082353 GCCAGCCGGCCTGCCAGCTGGGG + Intergenic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
933962623 2:87415301-87415323 GCCAGCCAGCCAGCAAAGCCAGG + Intergenic
933963138 2:87417612-87417634 GCCAGCCAGCCAGCAAAGCCAGG + Intergenic
934244804 2:90297364-90297386 GCCAGCCAGCCAGCAAAGCCAGG + Intergenic
934264042 2:91500060-91500082 GCCAGCCAGCCAGCAAAGCCAGG - Intergenic
936069121 2:109353588-109353610 CCCAGCAGGCCTGCCAGCCCTGG - Intronic
938904703 2:135826833-135826855 GTCAGCCAGCCCGCAAGCACAGG + Intronic
940112660 2:150171290-150171312 GCCGGCCGGCCCGGAAGCCCCGG - Intergenic
941666309 2:168247130-168247152 GCTAGCCTGCATGCACGCCCTGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944055178 2:195515775-195515797 GCCGGCCTGCCTACAAGCCCCGG + Intergenic
944066747 2:195626868-195626890 GCCAGCCAGTCTGTAAGCCTGGG - Intronic
944482793 2:200174880-200174902 GCCGGCCGGCCGGCAAGCCCGGG + Intergenic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
945451497 2:210000836-210000858 GCCGGCTGGCCTGCTGGCCCCGG - Intergenic
945953044 2:216058124-216058146 CGCAGCCGTCGTGCAAGCCCTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948604768 2:239127856-239127878 CCCAGCTGCCCTGCGAGCCCTGG - Intronic
1171122128 20:22577135-22577157 GCCCGCCGCCCTCCGAGCCCCGG - Intergenic
1174842352 20:53912147-53912169 GCCAACTGGCCTGCAGGCCCAGG - Intergenic
1175176047 20:57112714-57112736 TGCAGCCGGCGTTCAAGCCCCGG - Intergenic
1175904422 20:62372492-62372514 GCCAGAAGGCCTCGAAGCCCAGG + Intergenic
1175947229 20:62564596-62564618 GCCAGGCGGCCTCCATGCTCTGG - Intronic
1176089548 20:63312833-63312855 GCCAGCTGGACTGCATCCCCTGG - Exonic
1176279560 20:64292710-64292732 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1176301823 21:5102225-5102247 GGCAGCCGGCCTGCCACCCTGGG - Intergenic
1179816524 21:43909739-43909761 CACAGCCGGCCTGCAGGCCTGGG - Intronic
1179855208 21:44159675-44159697 GGCAGCCGGCCTGCCACCCTGGG + Intergenic
1179893431 21:44349305-44349327 GGCAGCAGGCCTGCACACCCAGG + Intergenic
1180555257 22:16567090-16567112 GCCAGCCAGCCAGCAAAGCCAGG + Intergenic
1181001147 22:19988307-19988329 GCCAACCTGCCTGGAACCCCTGG + Intronic
1181639959 22:24191124-24191146 GCTGCCCGTCCTGCAAGCCCTGG - Intergenic
1182338038 22:29598285-29598307 GCCGGCCCGCCGGCAAGCCCCGG - Intergenic
1182550854 22:31100105-31100127 GCAGGCCGGCCTACCAGCCCGGG + Intronic
1183363084 22:37393075-37393097 GGGAGCAGGCCTGCTAGCCCCGG - Intronic
1183368716 22:37420313-37420335 CCCAGCCGGCCTCCAGACCCAGG + Intronic
1183508499 22:38222080-38222102 GCCAGAGGGCCTGGAAGCCAGGG + Intronic
1183688841 22:39376932-39376954 GCCAGCCGAGCTGCCAGCCCAGG - Intronic
1184346553 22:43917187-43917209 TCCAGCCTGCCTTCAGGCCCTGG - Intergenic
1184583070 22:45430133-45430155 GCCAGCCTGCCTTCAGTCCCAGG + Intronic
949125164 3:438441-438463 TCCAGCCTGATTGCAAGCCCAGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950068959 3:10136655-10136677 CTCAGCCGGCCTGCAAGCCCAGG - Intergenic
950644398 3:14368397-14368419 GCCAGCCCGCCTGCCGGCCAAGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
954217965 3:49134866-49134888 GGCAGCCACCCTGCAGGCCCTGG - Intergenic
954449504 3:50564022-50564044 GCCAGCCAGCAAGCAGGCCCAGG - Intronic
956423714 3:69111278-69111300 GCCTGCCAGCCTTCAAGCCAAGG + Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
959944385 3:112111682-112111704 GCCAGCCACCCTGCATTCCCAGG - Intronic
960101292 3:113746048-113746070 GCAAGCCGGCCTCCTAGCCTGGG + Exonic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
962348300 3:134638456-134638478 GCCAGGCAGCCTGGAATCCCAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963106113 3:141648659-141648681 CCCAGCCTCCCTGCAGGCCCTGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
966372429 3:179263272-179263294 GCCGACCGGCCTACAAGCCACGG - Intronic
968126559 3:196164307-196164329 CCCAGCCGGCCTGCCAGGCGGGG - Intergenic
968371735 3:198226020-198226042 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
968659630 4:1793693-1793715 GCCAGGCGGCCCGGGAGCCCTGG + Intronic
968899229 4:3423135-3423157 GGCAGCCCCCCTACAAGCCCGGG + Intronic
969222279 4:5768932-5768954 GCCAGCCAGCCAGCAAGGCAGGG - Intronic
969657578 4:8507079-8507101 GCCTGCTGGCCTCCAGGCCCAGG - Intergenic
970108306 4:12609729-12609751 GCCGGCAGGCCTGCAAGCCCCGG + Intergenic
970460102 4:16266068-16266090 GGCTGCCAGCCTGCAAGCTCAGG - Intergenic
970794065 4:19891235-19891257 GCCTGCCTGCCTCCAAGCACTGG + Intergenic
970896659 4:21111545-21111567 GCCAGTCTGCCTGCAACCTCAGG - Intronic
973146302 4:46831136-46831158 GCCGGCCGGCCTGCCAGCCCCGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
979260423 4:118638498-118638520 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
979445682 4:120808829-120808851 GCCGGCCAGCCCGCAAACCCTGG - Intronic
980827332 4:138088828-138088850 GCCGGCCAGCCCGCAAGCACCGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982024323 4:151236264-151236286 CCCCGCCAGCCCGCAAGCCCCGG - Intronic
985412114 4:189695917-189695939 ACCAGCCTGCCCACAAGCCCCGG - Intergenic
985748064 5:1658836-1658858 GCCGACCGGCCTGCTAGCCGCGG - Intergenic
985770943 5:1810320-1810342 CCCAGCAGGCCTCTAAGCCCAGG - Intronic
985904561 5:2823294-2823316 GTCAGAGGCCCTGCAAGCCCAGG - Intergenic
986347667 5:6849955-6849977 CCCAGCAGGACTGCAAACCCTGG - Intergenic
986446518 5:7825913-7825935 GCCATCCGACCTGCAGGGCCTGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988796430 5:34656760-34656782 CCCAGCCGGCCTGCGAGTCGCGG - Intronic
988856190 5:35230084-35230106 GGCAGCCGGCGGGGAAGCCCGGG - Intronic
989643740 5:43607028-43607050 GCCTGCCAGCCTGCCAGCCTGGG - Intronic
991054427 5:62306272-62306294 TCCTGCCGGCCTGCAGGCCCGGG + Intronic
992732884 5:79690081-79690103 GCTAGCTGCCCTGCAGGCCCTGG - Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
997208820 5:132066027-132066049 GCCAGGAGGCCTGAAAGGCCTGG - Intergenic
997210008 5:132071702-132071724 GAGATCCTGCCTGCAAGCCCAGG - Intergenic
997352205 5:133239084-133239106 GGCTGCCAGCCGGCAAGCCCCGG + Intronic
997626907 5:135337258-135337280 TGCAGCCGGGCTGCATGCCCAGG + Intronic
999325434 5:150640791-150640813 TCCTGCCGGCCTTCAAGCCTTGG - Intronic
1000212352 5:159119271-159119293 GCGGGCCCGCCTGCAAGCCCTGG + Intergenic
1000889327 5:166784760-166784782 GCTGGCAGGCCCGCAAGCCCAGG - Intergenic
1001134388 5:169090369-169090391 GCCAGCTGACATGCAAGCCTGGG + Intronic
1001602768 5:172939765-172939787 GCCAGCCGGCCGGCTGTCCCTGG + Intronic
1001999547 5:176189988-176190010 GGCAACTGGCCAGCAAGCCCAGG + Intergenic
1002443159 5:179274708-179274730 GGCAGCCGCCCAGCAGGCCCTGG - Intronic
1002649620 5:180681918-180681940 GGCAACTGGCCAGCAAGCCCAGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002730975 5:181331566-181331588 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1002753558 6:142538-142560 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1003465584 6:6376916-6376938 GCCAGAAAGCCTGAAAGCCCCGG + Intergenic
1003490038 6:6613510-6613532 GCCGGCCTGACAGCAAGCCCCGG - Intronic
1003506686 6:6745937-6745959 GCGGACCGGCCCGCAAGCCCCGG - Intergenic
1003836219 6:10074928-10074950 GCCGGCCGGCAGGCAAGCCCCGG - Intronic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1006472972 6:34238283-34238305 GCCGGCCGGCCTGCAACGGCCGG + Intronic
1006568471 6:34980171-34980193 TACAGCCGGCCTGCCAGCCATGG - Intronic
1006940425 6:37748411-37748433 TCCTGCCAGCCTGCAAGCCCTGG - Intergenic
1007724493 6:43906850-43906872 GCCAGCCTGCCAGCCAGGCCAGG + Intergenic
1010277957 6:73990888-73990910 GCGGGCCAGCCCGCAAGCCCCGG - Intergenic
1012624860 6:101393231-101393253 ACCAGCAGCCCTCCAAGCCCTGG + Intergenic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1015620849 6:135130149-135130171 GCCAGCTGAACTGCAAACCCAGG + Intergenic
1016104745 6:140148383-140148405 GCTGGCCCGCCCGCAAGCCCCGG - Intergenic
1018452722 6:163924237-163924259 GCCCGGCGGGCTGCAGGCCCAGG + Intergenic
1021452766 7:20798037-20798059 GCTCGCCGGCCCGCAAGGCCCGG + Intergenic
1022598969 7:31738667-31738689 GCCAGGAGGGCAGCAAGCCCAGG + Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023633412 7:42185072-42185094 GCCTGCCTGCCTGCATGCCCAGG - Intronic
1023804976 7:43866473-43866495 GTCAGCCTTCCTGCAAACCCTGG + Intergenic
1024076121 7:45818728-45818750 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1024647483 7:51382562-51382584 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1024735837 7:52303176-52303198 GGCTGACGGCCCGCAAGCCCAGG - Intergenic
1025051317 7:55737057-55737079 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025060083 7:55798312-55798334 GCCACCTGCCCTGAAAGCCCAGG + Intronic
1025128282 7:56362724-56362746 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025176664 7:56805605-56805627 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025695128 7:63770781-63770803 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1026959363 7:74398731-74398753 TCCTGCCGGCCTTCAAGTCCTGG + Intronic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1032052653 7:128658491-128658513 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1032190081 7:129759975-129759997 ACCAGCCAGCCTGCCCGCCCAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035689301 8:1549301-1549323 GCAAGCCGGAGGGCAAGCCCCGG + Exonic
1035833902 8:2727933-2727955 GCAGGCCGGCCCGCAAGCCCCGG + Intergenic
1037590918 8:20311312-20311334 GCCAGCAGGACCCCAAGCCCAGG - Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037819893 8:22130510-22130532 GCCCGCCGGCCGGGAGGCCCCGG - Exonic
1037951135 8:23019360-23019382 GCCAGCCGCCCTGGAGGCCGTGG - Intronic
1042022320 8:64380623-64380645 GGCTGCCGGGCTGCAAGGCCTGG - Intergenic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1044853568 8:96452426-96452448 AGCGGCCGGCCTGCAAGCCTCGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047100192 8:121667679-121667701 AGCAGCCAGCCCGCAAGCCCCGG - Intergenic
1048852752 8:138660051-138660073 GCCAGCAGGCAAGCCAGCCCGGG - Intronic
1048945803 8:139446016-139446038 GCCAGAGGGCATGGAAGCCCAGG - Intergenic
1049595218 8:143480300-143480322 GCTCCCGGGCCTGCAAGCCCTGG + Intronic
1049857925 8:144875268-144875290 GCTGGCCGGCCTGCAAGCCCTGG + Intergenic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1051449415 9:17178647-17178669 GCCGGCCAGCCGGCAGGCCCCGG - Intronic
1054143220 9:61544494-61544516 ACCTGCCGGCCTGCATTCCCAGG + Intergenic
1055182328 9:73402812-73402834 CCCAGTCCGCCTGCAAGGCCAGG + Intergenic
1057300692 9:93880039-93880061 GCCCTCCGGCCCACAAGCCCAGG + Intergenic
1057440439 9:95079110-95079132 GCCTGGCTGCCTGCGAGCCCAGG + Intronic
1057498951 9:95581734-95581756 GCCAGCCGGCCTGCATGCTGCGG - Intergenic
1058786476 9:108393603-108393625 GCCAGCCAGCCAGCCAGCCCTGG + Intergenic
1060586078 9:124786872-124786894 GCCAGCTGGCCAGCCAGCCTTGG - Intronic
1060945228 9:127566541-127566563 GCCAGCCTGCCTGCAAGTCCTGG - Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061370478 9:130194776-130194798 GCCTCCAGGCCTGCAGGCCCAGG - Intronic
1061398944 9:130358004-130358026 CCCAGCTGGCTTGCCAGCCCTGG - Intronic
1062049312 9:134438838-134438860 GCCAGCCAGCCAGCCAGCGCCGG - Intronic
1062080278 9:134620073-134620095 GCCAGCTGGCCGGGAAACCCTGG - Intergenic
1062232202 9:135487791-135487813 GCCAGCCTGCCTGCCCCCCCAGG - Exonic
1062379732 9:136281504-136281526 GCCACCCGACCAGCCAGCCCAGG + Exonic
1062381405 9:136288509-136288531 GCCAGGCCTCCTGCATGCCCTGG - Intronic
1062482401 9:136758588-136758610 GCCAGGCGGGCTGCAAGCCTGGG - Intergenic
1062581814 9:137232177-137232199 GCCTGCCAGCCTGCCACCCCCGG - Intronic
1062755381 9:138284073-138284095 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1203579294 Un_KI270745v1:28245-28267 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1203670480 Un_KI270755v1:7064-7086 ACCAGCCTGCCCACAAGCCCCGG + Intergenic
1186274736 X:7927200-7927222 CCCTGCCGGCCTCCAAGCCGCGG - Intronic
1190413983 X:50163593-50163615 GCCGGCCAGCCTGCTGGCCCCGG - Intergenic
1191654160 X:63577547-63577569 GCCAGCCTCCCTGCAGGCACTGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1192610113 X:72559202-72559224 GGCAGCACGCCTGCAATCCCAGG - Intronic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1194890496 X:99372299-99372321 GCAGGCCGGCCCGCAAGCCCCGG - Intergenic
1196705931 X:118717199-118717221 GCCGGCCGGCCAGCCGGCCCCGG - Intergenic
1196874440 X:120144620-120144642 TCCTGCCGGCCGGCAAGGCCGGG - Intergenic
1197345737 X:125324733-125324755 ACCAGCCTGCCTGAAAGACCTGG + Intergenic
1197533790 X:127663233-127663255 GCCGGCCTGCCCACAAGCCCCGG - Intergenic
1197607910 X:128606702-128606724 GCCGGCGGGCCCGCCAGCCCTGG + Intergenic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1199944840 X:152657063-152657085 GCCGGCCGGACTGCATGCCCAGG + Exonic
1200115588 X:153768436-153768458 CCCAGCCGGACAGCAAGGCCGGG - Intronic
1200120899 X:153790072-153790094 GCAAGACGACCTGTAAGCCCAGG - Intronic
1200163148 X:154019385-154019407 GCCCGCCGGCCTCCCAGCCGTGG + Intronic
1200283617 X:154800120-154800142 GACAGCTGCCCAGCAAGCCCTGG + Intronic
1202381901 Y:24280867-24280889 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1202488883 Y:25389258-25389280 GCCACCTGCCCTGAAAGCCCAGG + Intergenic