ID: 964379492

View in Genome Browser
Species Human (GRCh38)
Location 3:156083608-156083630
Sequence TAGGAGACATTAATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964379492 Original CRISPR TAGGAGACATTAATGGAGCA GGG (reversed) Intronic
903751456 1:25623917-25623939 TAGGGGCCATGCATGGAGCAGGG + Intronic
904244537 1:29177622-29177644 TAGGAGACCTTAATGGGAAATGG + Intronic
904779269 1:32932955-32932977 TTAGAGACTTTAATGGAGCAAGG - Intergenic
904868994 1:33604815-33604837 AAGGAGAGTATAATGGAGCAGGG + Intronic
905603844 1:39278789-39278811 AAGGACACAATAATGGATCACGG - Intronic
911523945 1:98961893-98961915 TAGGATTCCTTAGTGGAGCAGGG - Intronic
911556499 1:99351700-99351722 TAGAAGACATTTAGGGATCAGGG + Intergenic
913247765 1:116885329-116885351 AAGGTGACATTAACAGAGCATGG - Intergenic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
917949625 1:180017464-180017486 TTGAAGACATTAATATAGCAGGG - Intronic
918223324 1:182455951-182455973 CAGGAGACCTTAATGGAGGAAGG + Intronic
921290712 1:213654562-213654584 TTTGAGACATTCCTGGAGCATGG - Intergenic
921507712 1:215993043-215993065 CAGGAGACATTAAAGGAGTCAGG + Exonic
921599918 1:217095736-217095758 TAGAAGAGATTTATGAAGCATGG + Intronic
1068064792 10:52115912-52115934 TAGCAGACTTTATTTGAGCAAGG + Intronic
1068644548 10:59451149-59451171 TAGAAGACATGAATTGACCAGGG + Intergenic
1068714017 10:60167696-60167718 TATGAGACACTAATGGTACAAGG + Intronic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1073734586 10:106331123-106331145 TAGGAGACATTAAGGGTAGAAGG - Intergenic
1074925988 10:118071506-118071528 TATTACACATTAATGGAGCAGGG + Intergenic
1074958143 10:118412565-118412587 AAGGAGACGTGAATGGAGGAGGG + Intergenic
1075182086 10:120220544-120220566 CGGAAGACATTGATGGAGCAAGG - Intergenic
1075512508 10:123083913-123083935 TGGGAGACAGGAGTGGAGCAGGG - Intergenic
1079506148 11:21154642-21154664 GAGGAGAGATTAATGTAGAAAGG + Intronic
1080918989 11:36689734-36689756 TAGGAGACAGGAAGGGAGAAAGG - Intergenic
1081203090 11:40241965-40241987 TAGGAGAAATTCCTGAAGCAGGG - Intronic
1086259152 11:84916641-84916663 AAAGAGACTTTAAGGGAGCAAGG - Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1091096050 11:132823192-132823214 TAGGAGAAAAAAATGGAACAGGG - Intronic
1091772012 12:3158223-3158245 TAGGAGGCATCCATGGGGCAGGG - Intronic
1092011425 12:5116066-5116088 AAGGAGACTTTATGGGAGCAGGG - Intergenic
1092252087 12:6905182-6905204 TAGAAGAAATGAATGGAGCAGGG + Intronic
1092657962 12:10707130-10707152 GAAGAGACCTAAATGGAGCAAGG - Intronic
1094461226 12:30698324-30698346 GAGGAGAGATTTATGGAACAGGG - Intergenic
1096865134 12:54558227-54558249 TAGGAGGTATTAAGGGGGCAGGG - Intronic
1097908814 12:64947697-64947719 AAGGAGACCTGAATGGAGAAGGG - Intergenic
1100244542 12:92743853-92743875 TAAGAGTCATTAATGGGGCTGGG - Intronic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1101045523 12:100801721-100801743 CAGGTGACTTTGATGGAGCAGGG + Intronic
1101305941 12:103527953-103527975 TATGAGTAATTAATGGGGCAAGG - Intergenic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1103257653 12:119555960-119555982 CAGGAGACATTATGAGAGCATGG + Intergenic
1109863376 13:68229041-68229063 AGGCAGACAGTAATGGAGCAGGG + Intergenic
1115274061 14:31586928-31586950 TAAGTGACATTAATAGAGTAAGG - Intronic
1121343171 14:93116645-93116667 AAGGAGATTTTGATGGAGCAGGG + Intergenic
1125706983 15:41747174-41747196 TAAGAGACATCAAAGAAGCAGGG - Intronic
1126309162 15:47296253-47296275 TTGGAGAGATGAATGGAGAATGG + Intronic
1128407468 15:67357812-67357834 TAGAATACCTTAATGAAGCAGGG + Intronic
1136237865 16:28925470-28925492 GAGGAGGCATAATTGGAGCAGGG - Exonic
1136948212 16:34682208-34682230 TAGGAAACATTAACTGAGCCTGG - Intergenic
1136955601 16:34782083-34782105 TAGGAAACATTAACTGAGCCTGG - Intergenic
1140231422 16:73120419-73120441 TATGAAAAATTAATGGAGCATGG - Intergenic
1140449009 16:75054956-75054978 GAGCAGAAATTAAAGGAGCAGGG + Intronic
1140489696 16:75324772-75324794 TAGGAAAGATTAGTGGAGCTGGG + Intronic
1148498311 17:48068839-48068861 CAGGAGACATAAGTGGAGCTGGG - Intergenic
1149651662 17:58279790-58279812 GAGGAGTCACTAGTGGAGCAGGG + Intronic
1151842907 17:76630360-76630382 TAGGAGGCCTTAATGGAGGAAGG - Intronic
1153913846 18:9728064-9728086 TAGAAGACATTAGTAGAGAAAGG - Intronic
1155788535 18:29933486-29933508 TGGAAGATATGAATGGAGCAAGG + Intergenic
1156446454 18:37240613-37240635 TGGCAGACATCAATGCAGCATGG + Intergenic
1157681469 18:49610705-49610727 TAGGAGAGATGAATGGACCTTGG + Intergenic
1159976472 18:74719083-74719105 TAGGGGACATTAATGATGCTTGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163738800 19:18998115-18998137 TAGGAGAGATGAATGGAGGCAGG - Intronic
1166001438 19:39879841-39879863 CAGGAGACATGCAAGGAGCAGGG - Exonic
1166004221 19:39896092-39896114 CAGGAGACATGCAAGGAGCAGGG - Exonic
1168045250 19:53789779-53789801 TACTAAACATTAGTGGAGCATGG - Intergenic
926375965 2:12227694-12227716 GAGTAGAGATTAATGGACCATGG + Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928727867 2:34195873-34195895 TAGGAGAATTTAAAAGAGCAAGG - Intergenic
930499743 2:52198710-52198732 TAGTATACATTAATAGATCATGG + Intergenic
931494480 2:62787411-62787433 AAGAACACATTAATGGAGCAAGG - Intronic
931812761 2:65870625-65870647 GGAGAGACATCAATGGAGCAAGG - Intergenic
933918612 2:87022030-87022052 AAGGAGACATGAAGGCAGCATGG - Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
935856551 2:107280926-107280948 GAGGGGAAATGAATGGAGCATGG + Intergenic
936411720 2:112264473-112264495 TAGGAGACCATAATGAAGAAGGG + Intergenic
938593730 2:132765783-132765805 TAGGAAACATTATTTGAGGAAGG - Intronic
941474145 2:165927459-165927481 CAGGAGAAAATAATAGAGCATGG - Intronic
944614156 2:201442995-201443017 TAGGGATAATTAATGGAGCAAGG - Intronic
945978919 2:216292946-216292968 GAGGAGAGATGAATGGAGAAGGG + Intronic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
947349377 2:229226531-229226553 TAGGAAACATCACTGGAGCTTGG - Intronic
1168916710 20:1494412-1494434 TAGGAGAGAATAATGAACCAAGG + Intergenic
1169743043 20:8915980-8916002 TGGGAGATGTTAATGGAGAATGG - Intronic
1170006895 20:11679176-11679198 AAGGAGAAATTAATAAAGCAGGG - Intergenic
1170025138 20:11881047-11881069 TAGGAGAGATTAATGGAGACTGG + Intergenic
1172073208 20:32274126-32274148 AAGGAGACATTAGTGGCCCAGGG + Intergenic
1172170809 20:32930835-32930857 GAGAAGACAGTGATGGAGCACGG - Intronic
1172307667 20:33892843-33892865 TAGGGGACAAGAATGGAGCTGGG - Intergenic
1173125927 20:40336049-40336071 TAGGAGTCATTAATGGGGACTGG + Intergenic
1175008716 20:55712648-55712670 GAGAAGACAGAAATGGAGCAGGG + Intergenic
1175898827 20:62352030-62352052 TAGGAGAAATTCATGGCGCCCGG + Exonic
1180229793 21:46420212-46420234 TAGGATACGTGAATGGAGGAAGG - Intronic
1183387415 22:37522904-37522926 TAGGAGGCATTAATGGGCCTGGG + Intergenic
950214500 3:11149554-11149576 GAAGAGAAATGAATGGAGCAGGG + Intronic
953821406 3:46210394-46210416 TAAGAGAAATGAATGGAGCAAGG - Intronic
954613813 3:51959532-51959554 TGGGACACATTACTGGAGAAGGG - Intronic
955541948 3:59985893-59985915 TAGGATACATTTATAGAGCCTGG + Intronic
955828326 3:62973622-62973644 TAAGACAAATTAATGAAGCAAGG + Intergenic
956872934 3:73435920-73435942 TATGAGACATTGATGGACAAAGG - Intronic
958652121 3:96950103-96950125 TAGCAGACATTAAAGGATCTTGG + Intronic
964379492 3:156083608-156083630 TAGGAGACATTAATGGAGCAGGG - Intronic
966841401 3:184091244-184091266 TAAGAGACATTACTGGAGGCTGG - Intergenic
970523267 4:16906708-16906730 TGAGAGAAAGTAATGGAGCATGG - Intergenic
973032004 4:45356919-45356941 AAGTAGAAATTAATGGAGTATGG + Intergenic
973744431 4:53949297-53949319 TTAGAGTCATTAATGGAGCTAGG - Intronic
974519851 4:62969791-62969813 AAGGAGACATAAAGGGACCATGG + Intergenic
974544898 4:63289856-63289878 TATGAAACATAAATGAAGCATGG + Intergenic
974808273 4:66911043-66911065 TATAAGCCATAAATGGAGCATGG + Intergenic
976566371 4:86554669-86554691 TAGGAGAGATTGATGGGGGAGGG - Intronic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
978330199 4:107604228-107604250 TGGGAGAAATGAATGGAGTAAGG - Intronic
982341789 4:154307794-154307816 TAGGAGACCTGAATGGAAGAGGG - Intronic
982658087 4:158173864-158173886 TAGGAGACATTTTTGGAGTGGGG - Intergenic
984088337 4:175339778-175339800 TAAGAGACATAAATTCAGCAGGG - Intergenic
986713436 5:10504154-10504176 GAGGTGAAATTAATAGAGCATGG + Intergenic
987168008 5:15220980-15221002 GTGGAGACATTAATAGAACATGG - Intergenic
987337126 5:16906749-16906771 CAGGAGACATTACTGCAGAAGGG - Intronic
987608292 5:20167791-20167813 AAGGACACCTTTATGGAGCAGGG + Intronic
987812349 5:22853861-22853883 TAGGAGAAATTGCTTGAGCATGG - Intergenic
990789456 5:59460687-59460709 TTGGAGACCTTAAGGAAGCATGG - Intronic
991052488 5:62288024-62288046 AAGGAGACTTTAAGGGAGAAGGG - Intergenic
992656823 5:78919249-78919271 AAGCAGACATTAATGGAATAAGG - Intronic
992795265 5:80250257-80250279 GAGGAAACATTAATTGAGCTGGG + Intronic
993843177 5:92906370-92906392 TAGGAAACACTAATGCAGCCAGG - Intergenic
994324091 5:98428380-98428402 TGGGAGACATTAATAAAACATGG + Intergenic
996928168 5:128853863-128853885 TAGGAAAGATTAATGGATCGGGG + Intronic
998754318 5:145359355-145359377 AGGGAGAGATTAATGGAGGATGG - Intergenic
1000598243 5:163241105-163241127 TAGGAAACATAAATGGGGCAAGG - Intergenic
1000671707 5:164071444-164071466 GAGGAGACATTCAGGGATCAAGG - Intergenic
1004852939 6:19719107-19719129 TAGGAGAAGTTTATGCAGCAGGG - Intergenic
1005604923 6:27467168-27467190 TAGGAGAGTTTCATGGAGGATGG - Intronic
1007943538 6:45804467-45804489 TAGGAGACACTAATGGGGTGTGG - Intergenic
1008177851 6:48290022-48290044 CAGGAGACATTCATGGGGCTAGG + Intergenic
1010059527 6:71606567-71606589 TTGGAGACATGAATGCAGCTGGG - Intergenic
1011400727 6:86958655-86958677 TAGCAGACAATAATGGCACAAGG - Intronic
1011551141 6:88532032-88532054 TAGGAGAGAAACATGGAGCAGGG + Intergenic
1013432805 6:110070124-110070146 TAGGACACATGAATGGTGCCTGG + Intergenic
1013435504 6:110101693-110101715 ATGGAGGCATTAATGGAACATGG + Exonic
1017777739 6:157692548-157692570 TGGGAGACATGAATGGGGCAAGG - Intergenic
1018457772 6:163967959-163967981 GAGGAGATATTGATGGAGAAAGG + Intergenic
1023465228 7:40447410-40447432 TAAGAGACTTTCATGGAGGAGGG + Intronic
1023756372 7:43421858-43421880 TAGGAGACATTACAGAAGCCAGG + Intronic
1023987037 7:45102788-45102810 TTGGAGACATTATGGGAGAAGGG - Intronic
1026155709 7:67823873-67823895 AAGAAGACAATAATGAAGCAAGG + Intergenic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1027557568 7:79685373-79685395 TAGGAGAAAATAATGGAAGAGGG - Intergenic
1027887121 7:83922764-83922786 TTGGAGACATAAATGAAGCGTGG - Intergenic
1027888882 7:83945626-83945648 TAAGAGACATTAATCCAGCTGGG + Intergenic
1030047704 7:105512404-105512426 AAGGAGACAAAAATGGACCAGGG + Intronic
1034030869 7:147762238-147762260 TAAGTGACATCAATGGAGCAAGG + Intronic
1034385090 7:150734381-150734403 TAGGAGACCTTCATGGAATAGGG + Intronic
1034729493 7:153373200-153373222 TATGATACATTAAAGGAACAGGG + Intergenic
1036976039 8:13413713-13413735 CAGGAGACAGCAATAGAGCAGGG - Intronic
1037361356 8:18077962-18077984 TACAAGTCACTAATGGAGCAGGG - Intronic
1039322980 8:36453142-36453164 GAGTAGACATGAATGGATCAAGG - Intergenic
1040127440 8:43754092-43754114 TTGGAGCCATTAATTCAGCAGGG + Intergenic
1041528506 8:58836176-58836198 AAGGTGACATTAAGGGAACAGGG + Intronic
1042416793 8:68529032-68529054 TAGGAGAAAGGAATGGTGCAGGG - Intronic
1046920796 8:119726258-119726280 TAGGAGACACAAATAGAGCCAGG + Intergenic
1059863887 9:118491758-118491780 TAAGAGATATTAAAGGAGAAGGG - Intergenic
1185786032 X:2891708-2891730 TAGAAGACAGTAATGAAGGAAGG - Intergenic
1186663220 X:11690933-11690955 TAAGAAACATTAAATGAGCAAGG + Intergenic
1193411653 X:81170169-81170191 TAGGAGGCATTACTACAGCAAGG + Intronic
1195703146 X:107719969-107719991 TAGGAGACATTAATCTAACAGGG + Intronic
1199302098 X:146224616-146224638 GAGGAGACATCACTGGAGAAAGG - Intergenic
1199963208 X:152796187-152796209 TTGGAGTACTTAATGGAGCAAGG + Intergenic
1200832611 Y:7702150-7702172 GAGGAGAAAAAAATGGAGCAAGG + Intergenic