ID: 964381660

View in Genome Browser
Species Human (GRCh38)
Location 3:156103812-156103834
Sequence TTGAATTAGCTCCAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964381660 Original CRISPR TTGAATTAGCTCCAGGTGAA AGG Intronic
904397949 1:30235434-30235456 TTGAATGTGGTCAAGGTGAAGGG - Intergenic
905791896 1:40794138-40794160 CCGAGTGAGCTCCAGGTGAAGGG + Intronic
907263453 1:53239059-53239081 GTGAATTAGTTCCAGGAAAACGG - Intergenic
910174269 1:84412403-84412425 GTGAATGAGCTCCTGGTGAAAGG - Exonic
921324551 1:213977911-213977933 TTGAAGTAGCTCCCAGTGAAGGG - Intergenic
1067820551 10:49525279-49525301 TTTAAATAGCTGCAGGTGACTGG - Intronic
1075086615 10:119418201-119418223 TTCTTTTACCTCCAGGTGAAGGG + Intronic
1075188229 10:120282567-120282589 ATGAATTGGCTCCAGGTGTGGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078666815 11:13332748-13332770 TTGAGTAAGATCCAGGTCAAGGG + Intronic
1079306326 11:19326810-19326832 TTGGATATGCTCCAGGAGAATGG + Intergenic
1079735076 11:23987025-23987047 TTAAAATACCTCCAGGGGAAAGG - Intergenic
1079992684 11:27263078-27263100 TTGAGTCATGTCCAGGTGAAAGG + Intergenic
1080112829 11:28588101-28588123 TTGAAATTGCTCTTGGTGAAGGG + Intergenic
1083350777 11:62027348-62027370 TCAGATTAGCACCAGGTGAATGG - Intergenic
1085173112 11:74465468-74465490 TTGAATGGGGTCCAGGTGCAGGG - Intronic
1088726932 11:112647145-112647167 TTAAATTAGCTCAAAGTGATGGG + Intergenic
1091578108 12:1758278-1758300 TTGCATTAGCTCAAGATAAAAGG - Intronic
1092763969 12:11836090-11836112 TAGAATTGCCTCCAGGTGCAAGG + Intronic
1092798177 12:12135194-12135216 TTGAAGTAGAACCAGGTGCATGG + Exonic
1094177270 12:27553701-27553723 TTGAATTAGGGCCACATGAATGG - Intronic
1095293529 12:40503292-40503314 TTGAATAGGCTGCAGGGGAAAGG + Intronic
1096317419 12:50580294-50580316 TCTAATTATCTCCAGGTAAAGGG + Intronic
1098012386 12:66067136-66067158 TTGAATTTGGTCTTGGTGAATGG - Intergenic
1098656120 12:73031990-73032012 TTGCAATAGCTTCAGGAGAAGGG + Intergenic
1099193389 12:79584157-79584179 CTGAAGTATCTGCAGGTGAAAGG + Intronic
1099322745 12:81171476-81171498 TTGAATTATCTTCTGGGGAATGG + Intronic
1101986104 12:109448536-109448558 TTAAAGTCGCTCCAGGTGGAAGG - Intronic
1102565335 12:113793871-113793893 TTGAATGAACTCCATGTGAGAGG - Intergenic
1104266191 12:127235066-127235088 TTGAATTAACTCCAAGAGAAGGG + Intergenic
1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG + Intronic
1108322607 13:49302786-49302808 ATGAATTGGCTGCAGGTGAGAGG + Intergenic
1110271763 13:73599233-73599255 TGGAATAATCTCCATGTGAATGG - Intergenic
1110329045 13:74250398-74250420 AAGAATTAACACCAGGTGAAAGG + Intergenic
1111131076 13:83976285-83976307 GTGAATTTGCTCTAGGTGCATGG + Intergenic
1111217983 13:85169284-85169306 TTGAATTCAGTCCAAGTGAAGGG - Intergenic
1112582308 13:100687021-100687043 TAGAGCTAGCTCCAGCTGAATGG - Intergenic
1113708827 13:112451143-112451165 TTGAATAAGATCCAACTGAAAGG - Intergenic
1117833064 14:59772909-59772931 GTGAATGAACTCCAGGTAAATGG + Intronic
1118216921 14:63817571-63817593 TTGAACTAGCTCCATTTTAAGGG - Intergenic
1120420006 14:84272743-84272765 TTTAGCTAGCTCCAGGGGAACGG + Intergenic
1122773298 14:104106570-104106592 TGGCCTTAGCTCCAGGGGAAGGG + Intronic
1122920811 14:104879349-104879371 TTAAGTTCGCTCCAGGTTAACGG + Intronic
1124870834 15:33540534-33540556 TTGAATCAGCTCCAGCTGAGGGG + Intronic
1126704285 15:51393343-51393365 CTAAATTAGCCCCAGGTTAAAGG - Intronic
1128308271 15:66614195-66614217 TTGCACCAGCTCCAGGTGCAGGG - Intronic
1139198955 16:64952813-64952835 TTGAATTAGCTCCTGTAGTAGGG + Intronic
1140321333 16:73954644-73954666 ATGAATGAGCTCCTGATGAAGGG - Intergenic
1140856144 16:78979496-78979518 CTGAATTAGAGGCAGGTGAAAGG + Intronic
1141116228 16:81312207-81312229 TTGAAGTAACTGGAGGTGAATGG - Intergenic
1142928495 17:3261614-3261636 CAGAAGGAGCTCCAGGTGAAGGG - Intergenic
1146540896 17:33693782-33693804 GTGAATTCTCTCTAGGTGAAAGG + Intronic
1146618782 17:34379612-34379634 GTTAATTTGCTCCAGGTGATAGG - Intergenic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1148912481 17:50950250-50950272 TTGACGTAGCACCAGGGGAAGGG - Intergenic
1149382881 17:56111176-56111198 TTGGATTCCCTCCAGGTTAAAGG - Intronic
1151891259 17:76951763-76951785 TTTAATAAGCTCCAGGTGGGCGG + Intergenic
1152324168 17:79625978-79626000 TTGCAGTTGCTCCAGGGGAAAGG + Intergenic
1153627416 18:7035119-7035141 TGAAGATAGCTCCAGGTGAAAGG + Intronic
1154963761 18:21336093-21336115 TTAAACTAGCTACAGGTGAAAGG + Intronic
1164050309 19:21580505-21580527 TCCAATTAGCTCCACATGAATGG - Intergenic
925467642 2:4123267-4123289 TTGAACTACCTCCATGTGACTGG + Intergenic
926399897 2:12486699-12486721 GTGAACTAGCTGCAGATGAAAGG + Intergenic
926439476 2:12872951-12872973 TTGAAATAGCTGCAGGGAAAAGG + Intergenic
928319049 2:30268705-30268727 TTGAATTAGTCCTAGGTGAAAGG - Intronic
929418941 2:41771329-41771351 TTGAATCAGCTGAAGGTGACTGG - Intergenic
934503945 2:94877698-94877720 CTGAGTTAGCCCCACGTGAAAGG - Intergenic
935511470 2:103981261-103981283 ATGAATTACCTGCACGTGAAAGG + Intergenic
940619928 2:156099076-156099098 TTTCTTTAGCTCCAGGTGAATGG + Intergenic
941454442 2:165698355-165698377 GAGAATTAGCTCCAGGTGCATGG + Intergenic
945034676 2:205694466-205694488 ATGAATTTGCCCCAGGTGAAAGG + Intronic
947986490 2:234452079-234452101 TTGAGTGAGCTCCAGCTGAAGGG - Intergenic
947990283 2:234482005-234482027 TTAAATTAGCTAAAGGTAAATGG + Intergenic
1172329903 20:34068268-34068290 GTGAAGTAGCTCCTGCTGAATGG + Intronic
1177829129 21:26117239-26117261 TTGAATTATGCCCAGGTTAAGGG - Intronic
1179095091 21:38307064-38307086 TTGGATTTGCTCCAGCAGAATGG + Exonic
1182342622 22:29636132-29636154 TTGAATTTGCTCTGGGTGACTGG + Intronic
1182797964 22:33005032-33005054 ATGAATGAGTGCCAGGTGAAGGG - Intronic
1183171906 22:36194552-36194574 TAGAATGAACTCCAGGTCAAAGG - Intronic
949619051 3:5789489-5789511 TTAAATTTTCTCCAGGTGATGGG - Intergenic
951067957 3:18289679-18289701 TGGATGTAGGTCCAGGTGAAAGG - Intronic
952465126 3:33576262-33576284 ATGAATTAGGTCCAGGTTATGGG - Exonic
956053747 3:65276972-65276994 TTGACTTAGCAAGAGGTGAAGGG + Intergenic
956208583 3:66779515-66779537 TTGTATTACTTCCAGGTGGAGGG + Intergenic
961361423 3:126370506-126370528 ATGAATTGTCTCCAGGTGCAGGG - Intergenic
961490906 3:127256183-127256205 TTGAATTAACTCCAGGGGCAGGG - Intergenic
962483111 3:135814967-135814989 TTGAATTACATGCAGCTGAAAGG - Intergenic
964381660 3:156103812-156103834 TTGAATTAGCTCCAGGTGAAAGG + Intronic
965513365 3:169593737-169593759 TTGAATTAACTCCTTGGGAATGG - Intronic
967222526 3:187259524-187259546 TTAAAAAAGCTCCTGGTGAAGGG + Intronic
969341108 4:6542021-6542043 TTGACTTAGCTCCTGGATAAAGG - Intronic
978625707 4:110683095-110683117 TTGAATTAGAGCCAGATTAAAGG - Intergenic
979454229 4:120908403-120908425 TTGCATCACCTCCATGTGAAGGG - Intronic
983475342 4:168205850-168205872 TTAAATTAGCTACAGTAGAAAGG - Intergenic
983783796 4:171706547-171706569 TTGGATTATCTGCAGGTAAAAGG + Intergenic
984954341 4:185030790-185030812 TTCAGTTTGCACCAGGTGAATGG + Intergenic
985186811 4:187326548-187326570 TTGAATTAGAATCAAGTGAATGG - Intergenic
988159041 5:27495156-27495178 TTGAATTTGCTCCTGTTGATAGG - Intergenic
989093402 5:37757769-37757791 TTGAATTAGCACAAATTGAATGG - Intergenic
994145002 5:96384771-96384793 CTGAATATGCTCCAGGAGAAAGG + Intergenic
994590451 5:101765506-101765528 TTGAATTGGCTGTAAGTGAAAGG - Intergenic
994879351 5:105467917-105467939 TTGAATTATTTCCAGGACAAGGG - Intergenic
997650109 5:135510763-135510785 TTGTATTACCTCTTGGTGAATGG + Intergenic
1001884195 5:175273990-175274012 TTGAATTAGTTAAAAGTGAAAGG - Intergenic
1003362304 6:5439641-5439663 GTGAATGCACTCCAGGTGAAAGG + Intronic
1003522791 6:6872961-6872983 TTGAATTAGCTCTCTGTGAAGGG - Intergenic
1003870544 6:10399307-10399329 TTGAATTATCTCCAAGTAACAGG - Intronic
1004731206 6:18360912-18360934 TTGAAGTAGCTCCAATGGAAGGG + Intergenic
1009883988 6:69602702-69602724 TTCCATTAGATCCAGGTGACAGG - Intergenic
1010410283 6:75553775-75553797 TAGACTTAGGTCCAGGTGGAGGG - Intergenic
1010960584 6:82141363-82141385 TTGAATTGGTTGCAGGTGAATGG - Intergenic
1011871685 6:91902167-91902189 CTGAATGAGCTCCTGGTCAAGGG - Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017252855 6:152300658-152300680 CTGTATTAGCCACAGGTGAAGGG + Exonic
1017967517 6:159279381-159279403 TTGAATTTCCCCCATGTGAATGG - Intergenic
1018615690 6:165684362-165684384 TTTATTTATCTCCAGGTGCATGG - Intronic
1027893153 7:84004037-84004059 TTGCATTAACTACAGGAGAATGG - Intronic
1028910109 7:96198308-96198330 TTGATTTTTGTCCAGGTGAAAGG + Intronic
1030085109 7:105809183-105809205 TTGAATTTTCTCAAGGTTAAGGG - Intronic
1030535309 7:110758982-110759004 TTAAATTTCCTCCAGATGAAAGG + Intronic
1040611056 8:48982690-48982712 TTGAATCAGCTGCAGGTGCCAGG - Intergenic
1041346118 8:56899928-56899950 TTGAATTTGCTCAAGGTCAAAGG + Intergenic
1043800622 8:84605476-84605498 TGAAATGAGCACCAGGTGAATGG - Intronic
1044941038 8:97344003-97344025 TCAAATTAGCTCAAGGGGAAAGG - Intergenic
1045733847 8:105272424-105272446 TTGATTTCTCTCAAGGTGAAAGG - Intronic
1047250652 8:123179857-123179879 GAGAATTAGTTCCAGGTGAAAGG + Exonic
1051758423 9:20433007-20433029 TTGCGTTAGCTCCAAGTGGATGG - Intronic
1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG + Intronic
1054912066 9:70464204-70464226 TTCAATTAGCCACAGATGAAGGG + Intergenic
1060803130 9:126557172-126557194 GTGATTTATCTCCACGTGAAGGG - Intergenic
1203745274 Un_GL000218v1:37885-37907 CTGAGTTAGCCCCACGTGAAAGG + Intergenic
1203564834 Un_KI270744v1:81599-81621 CTGAGTTAGCCCCACGTGAAAGG - Intergenic
1186808174 X:13161065-13161087 TGGACTTAGCTCCAGGAGCAGGG + Intergenic
1189704207 X:43743647-43743669 ATGACTTAGCCCAAGGTGAAAGG - Intronic
1193492217 X:82163808-82163830 TATAATTAGTTCCAGATGAAAGG + Intergenic
1196257256 X:113535700-113535722 TTGAATTAATTTCAGGTGCAGGG - Intergenic
1197232979 X:124026674-124026696 ATAAATTACCTCCAGGTGATAGG - Intronic
1197412545 X:126137616-126137638 TTAAATTAGATCCAAGAGAAAGG - Intergenic
1201158596 Y:11152904-11152926 CTGAGTTAGCCCCACGTGAAAGG + Intergenic