ID: 964381679

View in Genome Browser
Species Human (GRCh38)
Location 3:156103922-156103944
Sequence GGTAACATCCTGAGTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964381673_964381679 12 Left 964381673 3:156103887-156103909 CCTGAGGAACTTTCAAGTTAGAG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 964381679 3:156103922-156103944 GGTAACATCCTGAGTCCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964381679 Original CRISPR GGTAACATCCTGAGTCCTTC TGG Intronic
900741812 1:4334782-4334804 GGTCACATTCGGAGTCCTGCTGG + Intergenic
901215276 1:7551520-7551542 GGCAACTTCCTGTGTCCATCGGG + Intronic
902244866 1:15114233-15114255 GGTAACCAACTGAATCCTTCCGG + Intronic
902292362 1:15443590-15443612 GGTGACGTCCTGCTTCCTTCAGG - Intronic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
903327979 1:22582202-22582224 GAGAACATCCTGATCCCTTCTGG + Intronic
903449134 1:23441178-23441200 AGCCACATCCTGAGTTCTTCCGG + Exonic
910015916 1:82523072-82523094 GGTCGCATCCTCAATCCTTCAGG - Intergenic
914337133 1:146725441-146725463 GGTACCATCATGAGTCCTGGGGG + Intergenic
916426382 1:164685078-164685100 AGAAACATCCTGTGTCCTTGAGG - Intronic
916529480 1:165642371-165642393 GCTAAAATCCTGCTTCCTTCTGG + Intronic
918636162 1:186776924-186776946 GCTAACTTCATGATTCCTTCTGG - Intergenic
919899849 1:202035746-202035768 GGTAGGATGCTGAGACCTTCAGG - Intergenic
1065621262 10:27584631-27584653 GCTAGCATCCTGAATCCATCAGG + Intergenic
1070859841 10:79644656-79644678 GTTAACATCATTAGTCATTCAGG - Intergenic
1072737428 10:97888667-97888689 CGTAACATCTTAAGTCTTTCCGG + Intronic
1073278724 10:102335451-102335473 GAAAACTGCCTGAGTCCTTCAGG - Intronic
1075531538 10:123234360-123234382 GGTAACACCCTATGTCCTTTGGG + Intergenic
1080086058 11:28283823-28283845 AGTAACATCCTGTGTTCTCCAGG - Intronic
1090113754 11:123943793-123943815 GGTAACAAGCTTTGTCCTTCTGG - Exonic
1091010064 11:131992972-131992994 GGAAACATACTCAGTACTTCTGG + Intronic
1091098804 11:132850183-132850205 GGAAACCTCCTGTGTCCATCAGG + Intronic
1094140937 12:27181636-27181658 GGTACCGTTCTGAGTGCTTCAGG - Intergenic
1096076667 12:48810303-48810325 GGAAAAATCCAGACTCCTTCTGG + Intergenic
1099334842 12:81342144-81342166 GATAGTATCCTGAGTCATTCTGG - Intronic
1102214920 12:111154084-111154106 GGTCACATCCTGAGTTCTGGAGG + Intronic
1104137109 12:125951083-125951105 TGTAACATCCTGAGCACTACAGG - Intergenic
1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG + Intergenic
1105451384 13:20502987-20503009 GGTATGATCCTGCGTGCTTCCGG - Intronic
1106110916 13:26776130-26776152 GGTACTATACTGAGTACTTCAGG - Intergenic
1109128397 13:58547814-58547836 CCTAACATCCAGAATCCTTCTGG + Intergenic
1111805181 13:93031679-93031701 GGAAGCTTCCTGAGGCCTTCAGG + Intergenic
1113844791 13:113380712-113380734 GGTAAAAGGCTGAGACCTTCTGG + Intergenic
1121863039 14:97337319-97337341 GGGAACATCCTGAGACCATGAGG - Intergenic
1121912586 14:97805059-97805081 CTCAACATCCTGAGTCCTTAAGG + Intergenic
1121981051 14:98454177-98454199 AGTAACATCCTGAAACCTTGGGG - Intergenic
1123048720 14:105530594-105530616 GGGAACACCCTGATTCCATCTGG - Intergenic
1126653885 15:50955618-50955640 GGGAAAATCCTGACTCCATCAGG + Intronic
1134803336 16:17105392-17105414 GGTGAGATCATGAGTCCTTCCGG - Exonic
1139997138 16:70991878-70991900 GGTACCATCATGAGTCCTGGGGG - Intronic
1140916911 16:79502153-79502175 TGTACCTTTCTGAGTCCTTCTGG - Intergenic
1148726821 17:49798452-49798474 GATCACTGCCTGAGTCCTTCAGG - Exonic
1148743546 17:49906403-49906425 GGTTTCATCTTGTGTCCTTCGGG - Intergenic
1151585139 17:75004199-75004221 GGGAACATGCTGCGTGCTTCCGG - Exonic
1154272406 18:12931525-12931547 GGAAACTTCCTGAGCCCTTTGGG - Intergenic
1158320046 18:56252367-56252389 GGTCACATTCTGAGGTCTTCGGG + Intergenic
1160380859 18:78454352-78454374 GCTTACATGCTGAGTCCTTACGG + Intergenic
1161306046 19:3568861-3568883 GGTCACATTCTGAGGCCTTGGGG - Intronic
1162935642 19:13980238-13980260 GGCCACATCCTGGCTCCTTCTGG - Intronic
1166420365 19:42631801-42631823 TGTAGGATCCTGAGTCATTCAGG + Intronic
927633121 2:24791574-24791596 CTTAACCTGCTGAGTCCTTCTGG + Intronic
931075284 2:58704274-58704296 GGTAAGATTCTGAATTCTTCTGG + Intergenic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
937675586 2:124586429-124586451 GGTAAAATCATGTGTCCTGCAGG - Intronic
940233373 2:151483063-151483085 GGTCACATTCTGAGGCCTTGGGG + Intronic
941159737 2:162022985-162023007 AGTTATATCCTGGGTCCTTCTGG + Intronic
945451263 2:209999324-209999346 GGTAATAGCTTGACTCCTTCAGG + Intergenic
1171467622 20:25341783-25341805 GATAACGTCCTGAGTCTTTCTGG - Intronic
1171965196 20:31524552-31524574 GGTAACATACTGAGTCGGTGGGG - Intronic
1172250530 20:33476040-33476062 GGTCACACCCTGAGTCTTTCTGG - Intergenic
1173819431 20:46011050-46011072 GGTGAGATTCTGAGTCCTCCTGG + Exonic
1175385808 20:58594433-58594455 GGTAAAGTCCTGAGCTCTTCTGG + Intergenic
1175768819 20:61609992-61610014 GGGAACATCATAATTCCTTCTGG + Intronic
1177234078 21:18363243-18363265 GGTAACATCTTAGGTTCTTCAGG + Intronic
1177848473 21:26319010-26319032 GGTAATCTACTGAGTCCTTCTGG - Intergenic
1178488518 21:33033462-33033484 GGTATCATCCTGGTTCCTGCAGG - Intergenic
1184949379 22:47829498-47829520 CTTAACATCCTGGGTCCTGCAGG + Intergenic
949338404 3:3002472-3002494 GGTAACATCCTGAGTTATAAGGG + Intronic
954875529 3:53800638-53800660 ATGAGCATCCTGAGTCCTTCCGG + Intronic
959019940 3:101177843-101177865 GGTCACATCCTGAGTACTAGGGG + Intergenic
960428301 3:117536439-117536461 GGTAACATGCTGAGTACCACAGG + Intergenic
961678467 3:128583017-128583039 GGGAACATCCAGATGCCTTCCGG + Intergenic
964381679 3:156103922-156103944 GGTAACATCCTGAGTCCTTCTGG + Intronic
964985248 3:162730855-162730877 GATAATATCTTGATTCCTTCAGG + Intergenic
967113770 3:186318508-186318530 GGTTACATCCTGAGTTATTGAGG - Intronic
967229715 3:187325883-187325905 GGTCACATCCTGAGGCCATGGGG + Intergenic
967792776 3:193566714-193566736 GCTAACATCTTCAGTCCTTTTGG + Intronic
972570326 4:40304738-40304760 GGGACCATCATGAGTCCATCTGG - Intergenic
980482311 4:133402556-133402578 GGTAATACCCTAAGTCCTGCAGG - Intergenic
985947688 5:3199764-3199786 GGTGAGATCATGAGTCCTCCTGG - Intergenic
986152735 5:5142108-5142130 GGAAATCTCCTGAGTCCCTCTGG - Intronic
1004303382 6:14478313-14478335 GTTGACATCCTGTCTCCTTCTGG + Intergenic
1007338151 6:41170249-41170271 GGTTAGTTCCTGAGTCCTTTGGG + Intergenic
1007461197 6:42020441-42020463 GGAACCATACAGAGTCCTTCCGG - Intronic
1011660733 6:89591928-89591950 TGTGACATCCTGAGAGCTTCAGG - Intronic
1013117370 6:107113858-107113880 GGTAAGGAACTGAGTCCTTCAGG - Exonic
1014538087 6:122640668-122640690 GTTCACCACCTGAGTCCTTCTGG - Intronic
1017630423 6:156391522-156391544 GGAAACAGCCTGAGTTTTTCAGG - Intergenic
1019225292 6:170503379-170503401 GGTCACATCCTGAAGCCATCTGG + Intergenic
1019569700 7:1705127-1705149 GGTAACAGCCTGAGGGCTGCAGG + Intronic
1019843368 7:3472612-3472634 TGTAACATCCTGTGTATTTCAGG - Intronic
1019845717 7:3498696-3498718 GGCAACATTCTGAGACATTCCGG - Intronic
1020744728 7:12067294-12067316 GCTATCATCCTGTTTCCTTCTGG - Intergenic
1021450751 7:20781938-20781960 GCCAACAACCTGACTCCTTCTGG + Intergenic
1022509809 7:30927852-30927874 GATTACATCCTGCTTCCTTCTGG - Intergenic
1026806355 7:73431792-73431814 TGAAACATTCTGAGTCCTCCAGG + Intergenic
1027750886 7:82144124-82144146 GGTTACAGCCTGAATCCTTGAGG + Intronic
1027799960 7:82738151-82738173 GCTAACAGCCTAAGTCATTCAGG + Intergenic
1029156562 7:98521631-98521653 GGTCACATCGTGAGTCCCTGTGG + Intergenic
1030061274 7:105623268-105623290 GGTGCCAGCCTGAGTCCTGCAGG - Intronic
1030092284 7:105868134-105868156 GGTAACTTCCTGTATCCTCCAGG + Intronic
1033924766 7:146444446-146444468 GGAAGAATCCTGGGTCCTTCAGG - Intronic
1033956258 7:146852101-146852123 GGTAACATTCTGAGACATTGGGG + Intronic
1036516636 8:9450461-9450483 GCTAACATCCTGAGCATTTCAGG + Intergenic
1040887963 8:52285657-52285679 GGTCACAGCCTGAGTCCCTCTGG - Intronic
1043634812 8:82373435-82373457 GGTAACATCCTCTCTCCTCCTGG - Intergenic
1044674661 8:94717550-94717572 GGCAACATCTTGAGTAGTTCAGG + Intergenic
1047361849 8:124176265-124176287 GGTCACATTCTGAGTCCTGAAGG - Intergenic
1048551627 8:135438687-135438709 AGTGTCATCCTGAGTCCTGCAGG + Intergenic
1056017723 9:82408258-82408280 GATAGCATTCTGAGTCCTTGGGG + Intergenic
1056893942 9:90523344-90523366 GTTAACATCATGTCTCCTTCAGG + Intergenic
1059451130 9:114372110-114372132 AGTATCATCCTGCTTCCTTCCGG + Intronic
1059603656 9:115809293-115809315 GGAATCATCCAGAGTCCTTAGGG + Intergenic
1061629812 9:131865007-131865029 GGTAATATCCTAAGGCCTTGGGG - Intronic
1186074711 X:5865624-5865646 GGTAATATCATGTTTCCTTCTGG - Intronic
1189133749 X:38527876-38527898 AGTAACATACTGAGTTCTTAAGG + Intronic
1192534862 X:71918574-71918596 GTTAACATCCTCTGTCCTTGGGG + Intergenic
1195952288 X:110287667-110287689 GGTAACAGACTAAGTCTTTCAGG - Intronic
1201465822 Y:14279435-14279457 AGGAACATCCTGAGTCCCTACGG - Intergenic
1201685996 Y:16703029-16703051 GGTGACCTGCTGAGTCTTTCAGG - Intergenic