ID: 964382325

View in Genome Browser
Species Human (GRCh38)
Location 3:156110020-156110042
Sequence CTGGAGGCCCACAGATGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964382325 Original CRISPR CTGGAGGCCCACAGATGTGA GGG (reversed) Intronic
901070338 1:6513834-6513856 CTGTTGGCCCACAGAAGTCAAGG + Intronic
901781617 1:11598228-11598250 CTGGAGTCCCACAGTGTTGAAGG + Intergenic
902459784 1:16565456-16565478 CTGGAAGCCCAGACATGGGATGG - Intronic
903152972 1:21426057-21426079 CTGGAAGCCCAAACATGGGATGG - Intergenic
903160160 1:21481924-21481946 CTGGAAGCCCAAACATGGGATGG + Intronic
903237829 1:21961866-21961888 CTGGATGCCCTGAGAGGTGAGGG + Intergenic
903576979 1:24345211-24345233 GTGGAGGCGCACAGGTGTGGAGG - Intronic
904340482 1:29830833-29830855 CCAGAAGCCCACAGATATGAGGG - Intergenic
905120701 1:35679636-35679658 CAGGAGGCCTAGAGATGTGGGGG - Intergenic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
909754516 1:79207292-79207314 CTGGAGACTCACAGATGACACGG - Intergenic
910428955 1:87142231-87142253 CTGGCAGCCCACAGAAGTTAGGG - Intronic
913609184 1:120493702-120493724 CTGGAGACCCATGGATGTGTAGG - Intergenic
913960827 1:143337071-143337093 CAGGAGGCCCATCCATGTGATGG - Intergenic
913989411 1:143596636-143596658 CTGGAAGCCCAGACATGAGATGG - Intergenic
914055181 1:144162643-144162665 CAGGAGGCCCATCCATGTGATGG - Intergenic
914123965 1:144803718-144803740 CAGGAGGCCCATCCATGTGATGG + Intergenic
914210618 1:145575470-145575492 CTGGAAGCCCAGACATGGGATGG - Intergenic
914367014 1:146988281-146988303 CTGGAAGCCCAGACATGGGATGG + Intronic
914367550 1:146993039-146993061 CTGGAAGCCCAGACATGGGATGG + Intronic
914485433 1:148105183-148105205 CTGGAAGCCCAGACATGGGATGG - Intronic
914632806 1:149524772-149524794 CTGGAAGCCCAGACATGGGATGG + Intergenic
914634412 1:149539003-149539025 CTGGAAGCCCAGACATGGGATGG + Intergenic
914634945 1:149543740-149543762 CTGGAAGCCCAGACATGGGATGG + Intergenic
914635480 1:149548477-149548499 CTGGAAGCCCAGACATGGGATGG + Intergenic
914636015 1:149553214-149553236 CTGGAAGCCCAGACATGGGATGG + Intergenic
915108270 1:153547528-153547550 TAGGAGGCCCAGAGATGTGAGGG - Exonic
915338035 1:155159061-155159083 CTGGATGTCCACAGGTGTCAAGG + Intergenic
917734546 1:177908500-177908522 CAGGAAGCCCAAAGAAGTGATGG + Intergenic
918706205 1:187665522-187665544 CAGTAGGACCACAGATTTGAAGG + Intergenic
920079386 1:203361266-203361288 GTGGAGGCTCAGAGATGTGTGGG + Intergenic
920250525 1:204619577-204619599 CTGGAGGACCACAGCTTTGCAGG - Exonic
921545743 1:216472916-216472938 ATGGAGGCCTACAGAGGTGAAGG - Intergenic
921975236 1:221195185-221195207 CTAGAGGGATACAGATGTGAAGG - Intergenic
922775370 1:228212055-228212077 CTGCAGGCCCACAGCAGCGAAGG - Exonic
923220655 1:231889603-231889625 CTGGAGACCCTGAGAGGTGAAGG + Intronic
923252757 1:232192318-232192340 CTGGAAGCACACAGAGGAGATGG + Intergenic
923737345 1:236623291-236623313 CTGGAGGCTCTCAGTTTTGATGG - Intergenic
924831175 1:247596779-247596801 CTGGGGACCAACAGATGTGGAGG + Intergenic
1065112350 10:22452644-22452666 ACGGAGGCCCAGAGAGGTGAGGG + Intronic
1070706420 10:78642406-78642428 CTGGAGGCCCACGGATCATAAGG + Intergenic
1070724785 10:78780515-78780537 TTTCATGCCCACAGATGTGAGGG - Intergenic
1070803096 10:79254994-79255016 CTGGAGGCCCACAGCCCTGCGGG - Intronic
1071730009 10:88238474-88238496 CTGGAGGCTGATGGATGTGAGGG + Intergenic
1073514481 10:104064533-104064555 GTGGAGGACCACACATGGGAGGG + Exonic
1074929735 10:118112187-118112209 CTGAAGGCCCTCAGATGGGATGG + Intergenic
1075285499 10:121182136-121182158 TTGGAGGCACACCAATGTGAAGG - Intergenic
1075981668 10:126745738-126745760 CAGGAGGCCCTAGGATGTGAGGG - Intergenic
1075993541 10:126858240-126858262 CTCGAGGGCCACAGACATGAGGG - Intergenic
1076062965 10:127427838-127427860 CTGGTGTCCCTCAGATGAGAGGG + Intronic
1076863212 10:133152468-133152490 CTCCAGGCACACACATGTGATGG - Intergenic
1076994506 11:291511-291533 CTGGAGGCCGACGGGGGTGACGG + Intronic
1076997744 11:307204-307226 CTGGAGGCCCACCTGGGTGACGG - Intergenic
1080948147 11:36998177-36998199 CCTGAGTCCCACAGATGTGAAGG - Intergenic
1082171295 11:49008553-49008575 CTGAAGGACCATAGATGTGCTGG + Intergenic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083853134 11:65379279-65379301 CTGGCGACCCACAGCTGTGGAGG - Intronic
1084207525 11:67604651-67604673 CTGGAGGAGCCAAGATGTGAGGG + Exonic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1085793896 11:79519495-79519517 CTAGAGACCCACAGCTCTGATGG + Intergenic
1086694605 11:89828547-89828569 CTGAAGGACCACAGATGTGCTGG - Intergenic
1086711542 11:90015952-90015974 CTGAAGGACCACAGATGTGCTGG + Intergenic
1087189306 11:95235712-95235734 CAAAAGGCCTACAGATGTGAAGG + Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1088187701 11:107191298-107191320 ATGGTGGCCCACATTTGTGAGGG + Intergenic
1088765330 11:112970009-112970031 CTGGACCTCCACAGATATGAAGG + Intronic
1089798888 11:121007142-121007164 CTGGTGGCCCAGAGATGTCTGGG + Intergenic
1089970231 11:122687419-122687441 CTGGACGCCCAGTGCTGTGAGGG - Intronic
1090666825 11:128919911-128919933 CTGGGGTCCATCAGATGTGATGG - Exonic
1094080907 12:26534104-26534126 CTGGAAGGCCACTGACGTGATGG - Intronic
1097080117 12:56423762-56423784 CTGGAAGGAGACAGATGTGAAGG + Intronic
1100096298 12:91041835-91041857 TTGGAGTTCCACAGATTTGAAGG + Intergenic
1101200314 12:102428586-102428608 CTGAGTGCCCACAGAAGTGAGGG - Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1103357045 12:120329379-120329401 CTGGAACCCCATAGAGGTGATGG - Intergenic
1107685471 13:42893382-42893404 CTGGAGGTCAACAGAGGTGAAGG + Intronic
1108128751 13:47274150-47274172 CTGGAGTCCCACTGGTTTGAGGG + Intergenic
1108771913 13:53713013-53713035 CTGGAGGGCGGCAGATGAGAAGG + Intergenic
1110697457 13:78507960-78507982 CAGCAGGCCCACAGCAGTGATGG + Intergenic
1112007220 13:95264472-95264494 CCGGAGGCACACAGTGGTGATGG - Intronic
1112741782 13:102482818-102482840 TTGGATGCCCACATATCTGATGG + Intergenic
1113404217 13:110023011-110023033 CTGGAGGGCCACTGATGTGTTGG - Intergenic
1113703866 13:112411958-112411980 TAGGAAGCCCACTGATGTGATGG - Intronic
1113755631 13:112808850-112808872 GTGGAGGCCCATGCATGTGATGG - Intronic
1113775015 13:112939228-112939250 CCGGAGGCCCTCAGATGCCAAGG - Intronic
1118317468 14:64734011-64734033 CTTGGGTCCCACAGATGTGTTGG + Intronic
1119669869 14:76510169-76510191 CAGGAGGCCAACAGAGGGGAGGG + Intergenic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1121220294 14:92279774-92279796 CAGGTGGCCCACAAATGTGTAGG - Intergenic
1122379949 14:101295703-101295725 CTGCAGGTGCACAGATGTCAAGG - Intergenic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1128020668 15:64387702-64387724 CAGGAGGCGCACAGATGGGCGGG + Intergenic
1130274193 15:82468102-82468124 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1130588835 15:85200069-85200091 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1131508111 15:93033756-93033778 CTGGAGGACCACAGTAATGAGGG - Intergenic
1132819797 16:1859007-1859029 CATGAGGCTCACATATGTGAGGG + Intronic
1133584147 16:7175632-7175654 CTGGAGGCACACAGCTGTTGGGG - Intronic
1134686057 16:16159475-16159497 CTGGACGCCCAAGGAGGTGATGG - Exonic
1135293868 16:21262819-21262841 ATGGAGGCTCAAAGAAGTGAAGG + Intronic
1135539737 16:23320783-23320805 CTGGAGCCCCAGGGATGGGAGGG + Intronic
1138558845 16:57788175-57788197 CTGGGGGCCCACGGATAGGAGGG + Intronic
1141149879 16:81556660-81556682 CTGGAGGCCGACAGTGGCGATGG + Intronic
1141886010 16:86892934-86892956 TCTGAGGCCCACAGAAGTGAGGG + Intergenic
1142292253 16:89198551-89198573 CTGTAGCCGCAGAGATGTGAGGG + Intronic
1143031605 17:3971120-3971142 GTGGAGGCCCCCAGAGATGAAGG + Intergenic
1143854893 17:9841365-9841387 TGGGTTGCCCACAGATGTGAGGG + Intronic
1144020447 17:11236442-11236464 CTGGAAGACCAGAGATGGGAAGG + Intergenic
1146207910 17:30920721-30920743 TTGGAGGCTCAGAGAAGTGAAGG + Intronic
1148049664 17:44763497-44763519 CCTGAGGCCCAGAGAAGTGAGGG + Intronic
1149679421 17:58494964-58494986 CTGGAGGGGCACAGCAGTGACGG + Exonic
1149962893 17:61131613-61131635 CTGGAGGCTCACAGACCTCAAGG - Intronic
1151473968 17:74334989-74335011 CTTGAGGCCCAGAGAAGTGTTGG + Intronic
1152268611 17:79310616-79310638 CTGCAGGCTCACAGAGGAGAAGG + Intronic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1156587186 18:38444389-38444411 CTGAGGGCCCACTGATATGATGG - Intergenic
1157311727 18:46557782-46557804 CTGGATGCCCACATCTGTGGTGG + Intronic
1157564751 18:48672495-48672517 CTGAAGGCCCCCAAATGGGAGGG + Intronic
1158306707 18:56114226-56114248 CTGGAGGGTCATAGAAGTGATGG + Intergenic
1158479962 18:57813381-57813403 CAGGTGCCCCACAGATGTCATGG - Intergenic
1158498210 18:57975702-57975724 CTGGTGTCCCACACATGTGGGGG + Intergenic
1159923609 18:74247614-74247636 CTCCTGCCCCACAGATGTGAGGG - Intergenic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161718217 19:5889400-5889422 CTGACGGACCACATATGTGAAGG - Intronic
1162851998 19:13438209-13438231 CTGAGGGCCCACAGAAGTCAGGG + Intronic
1165461584 19:35946968-35946990 CTGGAGGGACACTGGTGTGAGGG + Intergenic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1166746755 19:45145455-45145477 ATGGAGGCCGACAGCTGTGGCGG - Exonic
1167696954 19:51020408-51020430 CTGGTGGCACACAGATGGCAGGG - Intergenic
1202676028 1_KI270711v1_random:7640-7662 CTGGAAGCCCAGACATGGGATGG - Intergenic
1202694663 1_KI270712v1_random:115320-115342 CAGGAGGCCCATCCATGTGATGG - Intergenic
925274848 2:2641425-2641447 CTGGAGGCAGACAGCTGTGGAGG + Intergenic
925314133 2:2908269-2908291 CTGGTTGACCACAGATATGAAGG + Intergenic
926752015 2:16205393-16205415 CTGGAGGGCCACATATGTCCAGG + Intergenic
926922190 2:17950016-17950038 CTGCAGGCCCACTGATGCTAAGG + Intronic
927097977 2:19762679-19762701 GTGGAGACCCACAGATGGGCAGG + Intergenic
927491823 2:23525979-23526001 CTGCAGGTCCACGGATGTCAGGG - Intronic
929601398 2:43206883-43206905 CTGGGAGCGCACAGATGGGAGGG - Intergenic
930024824 2:47023649-47023671 CTGGAGCCCCCCAGAGCTGAAGG - Intronic
931319237 2:61159902-61159924 CTGGAGGCAGACAGTGGTGATGG - Intronic
931895148 2:66720279-66720301 CTGGATGCCCTCAGAGGAGAAGG + Intergenic
932394794 2:71435438-71435460 CTGGTGGTCCACAGAAGTAATGG - Intergenic
934720711 2:96574097-96574119 ATGGAGGGCCACAGATATGGAGG - Intergenic
934874829 2:97907922-97907944 CCGGAGGACCATAGATGTAAAGG - Intronic
935217956 2:100989149-100989171 CTGGAGGATAACAGATGGGAAGG + Intronic
935652112 2:105391332-105391354 CTGGAGGTGCACAGGTATGATGG + Intronic
936982339 2:118276334-118276356 TTCTAGGCCCACAGATGAGATGG - Intergenic
937909739 2:127069655-127069677 CTGCAGGCACACACATGTGTAGG + Intronic
945964824 2:216175394-216175416 CTGCAGGATCACAGAGGTGATGG - Intronic
947136002 2:226977151-226977173 CTTGAGGCCCAGAGAAGTCAAGG + Intronic
947287051 2:228528683-228528705 CTAGAGGATTACAGATGTGAAGG + Intergenic
948579514 2:238974905-238974927 CTGGAGTCCCACAAATGTGTTGG - Intergenic
948995996 2:241579099-241579121 TTGGAAGCACACAGAAGTGATGG + Intergenic
1168916189 20:1490327-1490349 CCGGAGGACCAAAGATGTCATGG + Intronic
1170336256 20:15273623-15273645 CTGAAGGCCTACAGATGGAAGGG + Intronic
1171520117 20:25769356-25769378 CTGGAGGCCCAGGAATGTAAGGG - Intronic
1171556802 20:26087137-26087159 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1172620070 20:36312946-36312968 ATGGAGGCCCAGAGAGGTGCAGG - Intronic
1172664370 20:36588991-36589013 TTGGAGGACCATAGAGGTGAAGG + Intronic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174172379 20:48625619-48625641 CTGGAGACCCATAGAGCTGATGG - Exonic
1174235645 20:49088927-49088949 ATTGAGGCCCACAGAAGTTAAGG + Intronic
1176654252 21:9575642-9575664 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1176788232 21:13285565-13285587 CCCGAGCCCCACAGATGTTAGGG - Intergenic
1178742254 21:35212806-35212828 ATGGAGCCCCACAGATCTGGTGG - Intronic
1179354550 21:40646828-40646850 ATGGAGGCTCTCAGCTGTGATGG - Intronic
1181132894 22:20744125-20744147 ATGGAGGCCCACAGATGTGATGG + Intronic
1182417013 22:30227887-30227909 ATGGAGGCCCAGAGAAGTGGTGG - Intergenic
1182803341 22:33050151-33050173 ATGGAGGTCCACAGAAGTTAGGG - Intronic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1183132317 22:35850481-35850503 CTGGAGGCCTCCAGATATGCAGG + Intronic
1183178878 22:36245208-36245230 CTAGAGGCCCACAGCTGTGCAGG - Intergenic
1183383512 22:37502389-37502411 ATGGAGGCCCAGAGAAGTGAAGG + Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183656676 22:39189702-39189724 TTGGAGGCACACACCTGTGAAGG - Intergenic
1184231132 22:43159073-43159095 CAGGAGGCGCAGAGATGTGCGGG - Intronic
1184949854 22:47833497-47833519 GAGGAGGGCCACAGCTGTGAAGG + Intergenic
1185000571 22:48242962-48242984 CTGCAGGCTCAGAGATGTGCTGG + Intergenic
1185398312 22:50603704-50603726 CCGGAGGCCCTCAGAGGTGAGGG + Exonic
949471746 3:4403781-4403803 CTGCAGGACCACAGCTGTCAGGG + Intronic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950408599 3:12820018-12820040 CTGGAGGCTCACAGATCAGAAGG - Intronic
953330165 3:42046067-42046089 CTGCAGGCTCAGAGATGTGTAGG - Intronic
954605097 3:51903309-51903331 CTGGATGAACACAGATGTGAGGG - Exonic
955429550 3:58828402-58828424 CTGGAGGCACAGAGATGTTAGGG + Intronic
960057733 3:113287165-113287187 CAGGAGGCCCACAGATAAGCTGG + Exonic
960615462 3:119591996-119592018 CTCAAGGCCCACAAAGGTGAAGG - Intergenic
961683363 3:128613597-128613619 CTTGAGGCCCAGAGAGGTCAGGG + Intergenic
964382325 3:156110020-156110042 CTGGAGGCCCACAGATGTGAGGG - Intronic
964474912 3:157089432-157089454 ATTGAGGCCCAAAGAGGTGATGG + Intergenic
965319941 3:167241013-167241035 CTGGAGGCAAGCAGATGTGAGGG + Intronic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
967299700 3:188000699-188000721 CAGGAAGCCCACAGCTGTGGTGG + Intergenic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968483104 4:845566-845588 TTGGAGGCCCACAGAGTTGGGGG + Intergenic
970176557 4:13345592-13345614 TTGCAGGCCCACAGAGGTGGAGG + Intergenic
976850188 4:89536149-89536171 CTGGATCCCCACAGAGGTCAAGG + Intergenic
979410751 4:120375764-120375786 CTGGTGGAACACAGAGGTGATGG - Intergenic
982327229 4:154140954-154140976 CAGGAGGCCCACACGTGTCAGGG - Intergenic
982502392 4:156173130-156173152 CTGGGGTCCCACAGATCTGTTGG + Intergenic
983904872 4:173171633-173171655 CAAGAGGCCCAGAGATGGGAAGG - Intronic
985688358 5:1293980-1294002 CTGGCGGCCCACGGATGGGTGGG + Exonic
985963259 5:3319849-3319871 CTGGAGGCCCACAGTGGGGGCGG - Intergenic
988297969 5:29390710-29390732 CCGGAGGCCTACAGATGAGAGGG - Intergenic
988715204 5:33819757-33819779 CTGATGGCCCCCAGATGAGATGG - Intronic
989661580 5:43804564-43804586 AAGGAGGAACACAGATGTGAGGG - Intergenic
994961995 5:106617041-106617063 CTGGAGGTATACAGATATGATGG - Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
997622883 5:135310814-135310836 CTGGAGGGCAACAGATTTCAAGG - Intronic
998531451 5:142889007-142889029 CAGGGGGCCCAAGGATGTGATGG + Intronic
999144659 5:149384282-149384304 ACGGAGGCCCACTGAAGTGAGGG - Intronic
1000247024 5:159457009-159457031 TTGGAGGACCACAGAGGTGAGGG - Intergenic
1000345160 5:160308094-160308116 CAAGGGGTCCACAGATGTGATGG - Intronic
1000929530 5:167234596-167234618 CAAGAGCCCCACAGTTGTGATGG - Intergenic
1001890237 5:175332402-175332424 GTGGAGGCCCAGAGAAGTTAAGG - Intergenic
1001951536 5:175820086-175820108 TTGGAGGCCCAGTGATGTGCAGG + Intronic
1002547733 5:179962224-179962246 GTTGAGGCTCACAGATGTCAGGG - Intronic
1003131695 6:3400368-3400390 CACGAGGCCCACTCATGTGAGGG - Intronic
1004428167 6:15520198-15520220 CTGGAGGCTGACAGACGGGAGGG - Exonic
1004784112 6:18946534-18946556 CTGTGGCCCCACAGATGTCAGGG - Intergenic
1005894558 6:30166813-30166835 CTTAGTGCCCACAGATGTGAAGG - Intronic
1006786668 6:36672350-36672372 CTGGAGGCCCACAGAGGACTTGG - Intergenic
1007388197 6:41533676-41533698 GTGGAGGCAATCAGATGTGAAGG - Intergenic
1011401286 6:86965079-86965101 CTGGAAGCCCACATATGGCATGG - Intronic
1017285279 6:152667770-152667792 CTGGGGGCACACAGTAGTGATGG + Intergenic
1018395270 6:163373534-163373556 CTGGAGGCCATCAGGAGTGAAGG + Intergenic
1018589563 6:165404290-165404312 CTTGAGGCTCCCGGATGTGAAGG + Intronic
1020370229 7:7423964-7423986 CTGAAGGACCACAGATGACATGG - Intronic
1022665989 7:32410833-32410855 CTTCAGGCCCACAAGTGTGATGG + Intergenic
1024111683 7:46153769-46153791 CTGAGGTCCCACAGCTGTGAAGG + Intergenic
1025280605 7:57624310-57624332 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1025304125 7:57841197-57841219 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1026197838 7:68188302-68188324 CTGGAGGCCTAAAAAGGTGAGGG + Intergenic
1027133849 7:75610625-75610647 CTGTAGGCCCACAGTCGCGAAGG + Intronic
1029992757 7:104976952-104976974 CTGCTGGAACACAGATGTGAGGG + Intergenic
1030265849 7:107621117-107621139 GTGGTGGCGCACAGATGGGAGGG - Exonic
1030344267 7:108415111-108415133 CTGTTGGCTCACAGGTGTGATGG - Intronic
1032480825 7:132245387-132245409 ATGGAGGTCCCCAGAGGTGATGG - Intronic
1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG + Intronic
1033980192 7:147155022-147155044 CTGGAGCACCACAGCTGTGAAGG + Intronic
1034325790 7:150230751-150230773 CTGCATGCCCACAAATTTGATGG - Intergenic
1034767416 7:153738508-153738530 CTGCATGCCCACAAATTTGATGG + Intergenic
1034918406 7:155059684-155059706 ATGGAGGCCCAAAGGTGTCAAGG - Intergenic
1035037277 7:155903573-155903595 CTGGAGGCTCCAAGATGTCAAGG - Intergenic
1036111229 8:5905098-5905120 ATGGAGGTCTACAGATGTAAAGG - Intergenic
1036489566 8:9212360-9212382 ATGGAGGCCCAGAGATATTAAGG - Intergenic
1036656794 8:10682069-10682091 CTGGAGGCTCCCCGATGTGAGGG - Intronic
1038320947 8:26526869-26526891 TTGGAGGCCCAAGGAAGTGAGGG + Intronic
1038690719 8:29760659-29760681 CTGGGGGCCCACACATGTCCTGG + Intergenic
1042483225 8:69325951-69325973 CTGGAGACCCACGGATGAGCTGG + Intergenic
1048614445 8:136058712-136058734 CTGGAGTCCCAGGGATTTGAGGG - Intergenic
1048857678 8:138698146-138698168 AGGGAGGCCCACAGATGTCAGGG + Intronic
1048867466 8:138771324-138771346 CTGGTAACCCACAGATGGGAAGG + Intronic
1049294812 8:141826843-141826865 CTGGAGGCTCGGAGATGAGAGGG + Intergenic
1049301947 8:141875398-141875420 CTGGGGGCGCACAGAGGTGCTGG + Intergenic
1049352302 8:142170772-142170794 ATGAAGGGCCACAGATGAGAGGG + Intergenic
1049531907 8:143159307-143159329 CGGGAGGCTCTCAGAGGTGACGG + Intronic
1050928794 9:11299298-11299320 CTGGAGGGACAGAGATGTGAAGG + Intergenic
1051715219 9:19975806-19975828 ATGCAGGCCCACAGATATGGAGG - Intergenic
1055938525 9:81626350-81626372 GAGAAGGCACACAGATGTGATGG - Intronic
1057294819 9:93828693-93828715 CTGGAGGCCCAGACAGGTCAGGG - Intergenic
1057821994 9:98339564-98339586 GTGGAGGCAGACAGAAGTGATGG + Intronic
1060413891 9:123417469-123417491 CAGGAGGCCCAGAGAGGTTAAGG + Intronic
1061206402 9:129166416-129166438 CTGGAGGCTCAGGGAGGTGAAGG + Intergenic
1061935125 9:133853272-133853294 CTGGAGACCCACACTTGGGAAGG - Intronic
1062203330 9:135320954-135320976 CTGGAAAACTACAGATGTGAAGG - Intergenic
1185772508 X:2775535-2775557 CTGGAAGTACACAGAGGTGATGG + Intronic
1186526031 X:10249183-10249205 CTGAAGGCACACAGAGGTCAGGG - Intergenic
1187469177 X:19553012-19553034 TTGGAGGGCCACAGAGGTGCTGG + Intronic
1192054783 X:67761893-67761915 ATGGAGGCCCAGAGATGTTAAGG - Intergenic
1194114006 X:89873573-89873595 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1194364745 X:93001114-93001136 CTGAAGGCTGACAGAAGTGAGGG + Intergenic
1198249472 X:134866262-134866284 CTCATAGCCCACAGATGTGATGG - Intergenic
1199577046 X:149322363-149322385 CTGAGGGCCCACAGAGGAGAAGG + Intergenic
1200151054 X:153951673-153951695 CTGGGGGGCCACAAATGTGTTGG + Exonic
1200466746 Y:3528929-3528951 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1201298234 Y:12483917-12483939 CTGGAAGCACACAGAGGTGATGG - Intergenic