ID: 964384158

View in Genome Browser
Species Human (GRCh38)
Location 3:156129515-156129537
Sequence CTCTGATATCAGGCTGACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964384151_964384158 29 Left 964384151 3:156129463-156129485 CCTCCTCTATAAGTCACCACAGA 0: 1
1: 0
2: 0
3: 4
4: 99
Right 964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG 0: 1
1: 0
2: 0
3: 26
4: 258
964384152_964384158 26 Left 964384152 3:156129466-156129488 CCTCTATAAGTCACCACAGATAT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG 0: 1
1: 0
2: 0
3: 26
4: 258
964384156_964384158 13 Left 964384156 3:156129479-156129501 CCACAGATATATAAACTGGGGAC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG 0: 1
1: 0
2: 0
3: 26
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964384158 Original CRISPR CTCTGATATCAGGCTGACTT AGG Intronic
900285204 1:1895738-1895760 CTCTGAGAGGAGGCTGACTGTGG + Intergenic
901586413 1:10297655-10297677 CTCTGCTCTTGGGCTGACTTTGG + Intronic
903370758 1:22834330-22834352 CTCTCATATCTGGATGTCTTTGG - Intronic
904598458 1:31661174-31661196 CTCTGATGTGAGGTTGACTTGGG - Intronic
904954038 1:34268116-34268138 CTATGGCATCAGGCAGACTTGGG + Intergenic
904990657 1:34590133-34590155 CTCTGATACTGGGGTGACTTAGG - Intergenic
905430400 1:37918367-37918389 CTTTTAGATCAGGCTGTCTTTGG - Intronic
906199320 1:43948918-43948940 CTCTGATTTCACACTGGCTTTGG + Intronic
907365714 1:53957846-53957868 CTTTGTTATCAGGCAGACCTTGG - Intronic
907509020 1:54944734-54944756 CTCAGCTATCAGGCTGAGATGGG + Intergenic
911314377 1:96338519-96338541 CTCTGACTTCAGGTTGAATTTGG + Intergenic
913444712 1:118938426-118938448 CTTTGTTCTCAGGATGACTTTGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916474737 1:165158337-165158359 CTCTCATATCAAGCTGATTCAGG - Intergenic
916757331 1:167785324-167785346 ATCAGCCATCAGGCTGACTTTGG + Intronic
920318531 1:205098254-205098276 CTCTGAAGTCAGACTGCCTTGGG - Intronic
922515747 1:226207069-226207091 CTGTGGTATCAGGCAGACCTGGG + Intergenic
924035664 1:239934011-239934033 CTTTGTTTTCAGGCTGACTGTGG + Intergenic
924500189 1:244630214-244630236 CTTTGCTATCAGACTGACTGAGG - Intronic
1063225522 10:4011937-4011959 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063225527 10:4011974-4011996 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063225532 10:4012011-4012033 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063225537 10:4012048-4012070 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063225542 10:4012085-4012107 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063225547 10:4012122-4012144 ATCTGGTTTCAGGCTGTCTTCGG - Intergenic
1063277730 10:4589473-4589495 CTGTGACATCAGGATGCCTTAGG - Intergenic
1064256955 10:13750535-13750557 CTCTGATGTAAGACTGGCTTTGG + Intronic
1067877432 10:50018603-50018625 CTCTGACAACAGGCTGTCTGGGG + Intergenic
1068291586 10:55008628-55008650 ATCTGATATCTAACTGACTTAGG + Intronic
1068338859 10:55674818-55674840 TTTTGGTATCAGGCTGATTTTGG + Intergenic
1070980143 10:80638272-80638294 CTTTGGTATCAGGATGACGTTGG + Intronic
1072273140 10:93796859-93796881 CTCTTGTTTCAGGCTGATTTGGG + Intronic
1074153826 10:110781590-110781612 CTGTGAGATCAGGCTTGCTTTGG - Exonic
1074669228 10:115769670-115769692 ATCTGATAACTGGCTGATTTCGG + Intronic
1076498174 10:130913145-130913167 CTCTCCTATGAGGCTGCCTTGGG + Intergenic
1076503096 10:130952337-130952359 CTCTCCTATGAGGCTGCCTTGGG - Intergenic
1077963589 11:7102064-7102086 CTCTGAAAGCATGCTTACTTTGG + Intergenic
1078898884 11:15622901-15622923 CTCTGATATCAAGCTGCCCTTGG - Intergenic
1079051216 11:17161909-17161931 CACTGGTAATAGGCTGACTTTGG - Intronic
1079370906 11:19851445-19851467 CTCTGGGATCAGGCTGACCTAGG + Intronic
1079583760 11:22098944-22098966 CTCTCAATTCTGGCTGACTTTGG + Intergenic
1081641296 11:44756129-44756151 CTCTGAAATCCGACTGACTTGGG + Intronic
1081961336 11:47139829-47139851 CTCTGGATTCAGGCTGACTGCGG - Intronic
1082122004 11:48389461-48389483 CTTTGGTATCAGGATGATTTTGG + Intergenic
1084075827 11:66775361-66775383 CTCTAAAGTCAGGCAGACTTTGG - Intronic
1084188133 11:67486170-67486192 CTCTGACATCTGGCTGCCTGTGG + Intronic
1084291279 11:68170199-68170221 CTCTGAAGTTAGGCTGACTGGGG + Intronic
1084948663 11:72652788-72652810 CTCTTGCAGCAGGCTGACTTGGG + Intronic
1085061679 11:73453134-73453156 CTCTGATAGCAGGTACACTTTGG + Intronic
1085252615 11:75153523-75153545 CTCTGGTACCAGGCAGACCTGGG - Intronic
1085426975 11:76413397-76413419 CTCTGCCATCATGTTGACTTGGG + Intronic
1085610576 11:77945148-77945170 CTCTGATTTTAAGCTGATTTTGG - Intronic
1085637507 11:78169937-78169959 CTCTTAAAACAGTCTGACTTTGG - Intergenic
1086784745 11:90954178-90954200 CTCAAATATCACACTGACTTTGG + Intergenic
1086832262 11:91580595-91580617 CTTTGGTATCAGGATGATTTTGG - Intergenic
1092892350 12:12980713-12980735 CTCTGAGATCAGGTTGACATGGG + Intronic
1093270078 12:17049722-17049744 CTTTGGTATCAGGATGACGTTGG - Intergenic
1093332743 12:17863001-17863023 CTCTGAAATAAGGCTGAATTAGG - Intergenic
1093760953 12:22909726-22909748 CTTTGATATCAGGCTAATGTTGG - Intergenic
1093860632 12:24162386-24162408 CCCTGATATCAGACTTACTTAGG - Intergenic
1093965645 12:25322063-25322085 CTTTGAAACCAGACTGACTTGGG - Intergenic
1094868864 12:34575868-34575890 CTTTGATATCAGGATGATGTTGG - Intergenic
1098443130 12:70538612-70538634 CTCTGACATCAAGCAGACCTGGG - Intronic
1100381676 12:94067911-94067933 CTTTGGTATCAGGATGACGTTGG - Intergenic
1106354367 13:28965753-28965775 CTCTGCTTCCAGACTGACTTGGG - Intronic
1106780801 13:33057180-33057202 CTCTGATAGCAGCCTGAGTCTGG + Intronic
1108230595 13:48336171-48336193 CTTTGGTATCAGGATGATTTTGG + Intronic
1108811488 13:54230105-54230127 CTCTGATAACAGTCTGTCCTTGG + Intergenic
1109859240 13:68175607-68175629 CTATGATGTCAGGATGACATAGG - Intergenic
1110245497 13:73319000-73319022 CTCTGATAACAGCTTGATTTTGG - Intergenic
1110543423 13:76730578-76730600 CCCTGATATCTGGCTTCCTTCGG - Intergenic
1110641491 13:77829992-77830014 CTCTGAAATCAGGCAAATTTTGG - Intergenic
1110795394 13:79631233-79631255 CTCCGATGCCAGGCAGACTTGGG - Intergenic
1111216270 13:85146212-85146234 CCCAGATATAAGGCTGACTGAGG - Intergenic
1111658741 13:91182769-91182791 CTCTGATACCATTTTGACTTTGG + Intergenic
1115671680 14:35620027-35620049 CTTTGATATCAGGATGATGTTGG - Intronic
1115743806 14:36415350-36415372 CTTTGATATCAGGATGATGTTGG - Intergenic
1117204498 14:53427413-53427435 CTTTGATATCAGGATGATGTTGG - Intergenic
1117833834 14:59781171-59781193 CTCTGGCATCAGGGAGACTTGGG - Intronic
1118900039 14:69979022-69979044 CTCCCATCTCAGGCTGAGTTTGG + Intronic
1119161813 14:72459082-72459104 CTGTGCTATCAGGCTCACTTAGG - Intronic
1119534764 14:75394055-75394077 CTCTGATCTCGGGCTGCCCTAGG + Intergenic
1120930763 14:89845896-89845918 CTCCAAAATGAGGCTGACTTAGG + Intronic
1121849318 14:97205454-97205476 CTCTGCTTCTAGGCTGACTTAGG - Intergenic
1122451856 14:101815229-101815251 CTTTGCTATCAGACTGACTGAGG - Intronic
1125127421 15:36240342-36240364 CTCTTATTTTAGGCTGAATTGGG - Intergenic
1125513627 15:40306217-40306239 CTCTGCTTTCAGGCTGCTTTTGG - Intronic
1126644388 15:50860301-50860323 CTTTGAACTCAGGCAGACTTGGG - Intergenic
1128941236 15:71789428-71789450 CTTTGAAATGAGGCGGACTTGGG - Intergenic
1130621230 15:85464712-85464734 CTCTGGTATCAGACTGCCTGAGG - Intronic
1130860113 15:87878345-87878367 GTCTCATGTCACGCTGACTTTGG + Intronic
1130890821 15:88132523-88132545 GTCTGAAATCAGACAGACTTAGG - Intronic
1131249827 15:90822999-90823021 CTCTGTTCTCAGGCAGATTTGGG - Intergenic
1131925512 15:97378809-97378831 CTCTAAGATGAGGCTGACTGGGG - Intergenic
1132907248 16:2289030-2289052 CTTTGAGATCAGGCTGACCAGGG + Intronic
1133091927 16:3411443-3411465 CTCTGAACTCAGGCAGACATGGG - Intronic
1133720047 16:8486295-8486317 CTCAAATACCAGCCTGACTTGGG + Intergenic
1137051588 16:35718268-35718290 CTTTGGTATCAGGATGATTTTGG + Intergenic
1137441627 16:48503297-48503319 ATTTGATGTCAGACTGACTTGGG + Intergenic
1138692571 16:58782366-58782388 CTTTGGTATCAGGATGACGTTGG + Intergenic
1139154907 16:64429211-64429233 GTCTGATATCTGGCCTACTTGGG + Intergenic
1141230423 16:82162253-82162275 CTCTGAAGTCAGGCAGACCTGGG - Intronic
1146102822 17:30001968-30001990 CTTTGAAGTCAGGCTGACCTGGG - Intronic
1146932098 17:36784768-36784790 CTGTGATATCAGGCTGAATCTGG - Intergenic
1148440222 17:47708382-47708404 CTCTGACTTCAGGGTGAATTTGG + Exonic
1152084808 17:78211554-78211576 CTCTGATTTCAAGCTGCCTGGGG - Intergenic
1152625334 17:81385573-81385595 CTCTGATGTCAGGCCGGCTGGGG - Intergenic
1157559442 18:48636323-48636345 TTGTCATATCTGGCTGACTTTGG + Intronic
1157729077 18:49988315-49988337 CTCTGGTGTCAGGCTGTCCTCGG - Intronic
1159094247 18:63884619-63884641 CTTTGATCTCAGGCTGAGTTGGG - Intronic
1161468148 19:4443541-4443563 CCCTCATACCAGGCTGACCTGGG + Intronic
1162323465 19:9984764-9984786 CTTTGACATCAGACAGACTTGGG - Intronic
1163492049 19:17622931-17622953 CTTTGATGTCAGGTAGACTTGGG - Intronic
1164553775 19:29234145-29234167 CCCTGGTGTCAGGCTCACTTGGG - Intergenic
1165425155 19:35741330-35741352 CTCTGATAACCGGCTCAGTTGGG - Intronic
1167102787 19:47414598-47414620 CCCTGTGATCAGGCTGACTGTGG + Intronic
928108190 2:28486372-28486394 CTCTGACCTCAGGCTCACTGAGG - Intronic
929732878 2:44514471-44514493 CTCTGAGAGCAGGCGGACATTGG + Intronic
930747579 2:54900710-54900732 CTCTGGTTTCAGGTTGACTTTGG - Intronic
930885440 2:56320795-56320817 CTTTGATATCAGGATGATGTTGG - Intronic
933049353 2:77583431-77583453 CTTTGATATCAGGGTGATTGTGG - Intronic
933556999 2:83843209-83843231 TTCTGATATCAGGATGACTGAGG - Intergenic
935252883 2:101280540-101280562 CTTTGATTGCATGCTGACTTAGG - Intronic
936864838 2:117065545-117065567 CTCTGAAATTACGCAGACTTAGG - Intergenic
938067547 2:128289451-128289473 CTCTGGTATCTGGGAGACTTTGG - Intronic
938799600 2:134748998-134749020 CTTTGATATCAGGATGATGTTGG + Intergenic
940001664 2:148972673-148972695 CTGTGATATCAGGTAGTCTTAGG - Intronic
942380252 2:175383759-175383781 ATGTGACATCAGGCTTACTTAGG - Intergenic
942474825 2:176308388-176308410 CTCTGGTATCAGGATGATGTTGG + Intronic
942927878 2:181455953-181455975 GTGTGATATGAGGCTGACTTAGG - Intergenic
944404533 2:199368161-199368183 CTCTGCATTCAGGCAGACTTGGG - Intronic
945978570 2:216289894-216289916 CTCTAATCTCAGGAAGACTTGGG + Intronic
946638308 2:221755046-221755068 TTCTGACTTCAGGTTGACTTTGG + Intergenic
948333059 2:237185390-237185412 CTCTGATGTCAGACGGACTGGGG + Intergenic
1168835998 20:877868-877890 CTCTGTAAAAAGGCTGACTTGGG + Intronic
1168889681 20:1286817-1286839 CTCTGATCTCAGGCTGGGTGGGG + Intronic
1169874437 20:10281631-10281653 CTCTGAAATCAGGTAGACCTGGG - Intronic
1170073743 20:12396902-12396924 CTCTGGAATCAGGCAGACTTGGG - Intergenic
1170799794 20:19581772-19581794 CTTGGAAATCAGGCTGACTTGGG - Intronic
1171032357 20:21688896-21688918 CTGTATTACCAGGCTGACTTAGG - Intergenic
1171130969 20:22652674-22652696 CTCTTCTATCAGGCAAACTTGGG - Intergenic
1171339320 20:24414777-24414799 CTCTGATGTCAGGTTCACTCTGG + Intergenic
1172110639 20:32542839-32542861 CTCTGGTGTCAGGGTGACCTTGG + Intronic
1172232921 20:33349148-33349170 CTCTGACACCAGGCTGTCCTTGG + Intergenic
1173066577 20:39718844-39718866 CTCTGGAATCAGACAGACTTGGG + Intergenic
1173329872 20:42066666-42066688 CTCTGATAGCAGGTCAACTTGGG + Intergenic
1174557558 20:51406692-51406714 CTGTGGTATCAGTCTGACTCTGG + Intronic
1175526030 20:59634251-59634273 CTCTGAAATCAGGCGGAGCTGGG + Intronic
1175542830 20:59758743-59758765 CTTTGACATCAGGCCGACCTGGG + Intronic
1177341870 21:19814214-19814236 CTCTGGTATCAGGATGATATTGG - Intergenic
1179900550 21:44391205-44391227 CTTTGAGATCAGGATGACATGGG + Intronic
1180724328 22:17934109-17934131 CTTTGGTATCAGGATGAGTTAGG - Intronic
1181446074 22:22975859-22975881 CTCGGATGTCAGGCTTACTGGGG + Intergenic
1181465625 22:23109239-23109261 CTCTGCTGCCAGGCTCACTTGGG - Intronic
1182556054 22:31128892-31128914 CTCTGAAACCAGACTCACTTGGG - Intronic
1182879775 22:33723541-33723563 CACTGATATCAGGCGGATTTGGG + Intronic
1183150575 22:36033999-36034021 CTCTGATGTCAAACTGACATGGG + Intergenic
1184339390 22:43877861-43877883 CTCTGAATTCAGGCTGACCTGGG - Intergenic
1184689400 22:46110604-46110626 CTCTGAGCTGAGGCTGACTCAGG - Intronic
1184867146 22:47208009-47208031 CTCTGAAATTAGGCAGACCTGGG - Intergenic
949427818 3:3938350-3938372 CTTTGATATCAGGTTGATGTTGG + Intronic
950690255 3:14650517-14650539 CTCTGATCTCTGTCTGACTCTGG + Intergenic
951362418 3:21740688-21740710 CTTTGAACTCAGACTGACTTGGG + Intronic
954413777 3:50382995-50383017 CTCTCAGATCATGCTGAGTTGGG + Intronic
956212051 3:66812074-66812096 CTCTGATTTCCTGCTAACTTGGG - Intergenic
958553863 3:95648719-95648741 CTTTGATATCAGGATGATTCTGG - Intergenic
960320424 3:116228370-116228392 CTCTGAAATCTGACAGACTTAGG + Intronic
961643976 3:128382706-128382728 CTCAGAGTTCAGGCTGCCTTTGG - Intronic
964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG + Intronic
964634781 3:158847040-158847062 CTCTGAAATCAGTGTGACTCTGG + Intergenic
964648485 3:158985248-158985270 CTCAGATATCACACTGACTCTGG + Intronic
964931079 3:162023981-162024003 CTCTGTTATCAGAAGGACTTTGG - Intergenic
965027553 3:163322033-163322055 TTTTGATATCAAGCTGACATTGG + Intergenic
967713693 3:192739120-192739142 ATCTGGTATCATGCTGACTAGGG - Intronic
969237358 4:5875205-5875227 CTCTGAGCTGAGGCTGACTGTGG - Intronic
970776044 4:19675284-19675306 CTGTGATATCAGGGTTACTTTGG + Intergenic
971576403 4:28280501-28280523 GTCTGAGCTCAGGCTGTCTTAGG - Intergenic
972068415 4:34982261-34982283 TTCTGCTATCAGACTGCCTTAGG + Intergenic
974514568 4:62892835-62892857 CACTGATATTTGACTGACTTAGG + Intergenic
974683332 4:65193825-65193847 CTCGGTTATCAGATTGACTTTGG + Intergenic
975087303 4:70357282-70357304 CCCTCATATCAGGTGGACTTTGG + Intergenic
976085140 4:81400170-81400192 CTTTGAAATCAAACTGACTTGGG + Intergenic
977175332 4:93813362-93813384 AACTGATATCAGGCTGATTAAGG - Intergenic
978166904 4:105620266-105620288 TTTTAATATCAGGTTGACTTGGG + Intronic
979598016 4:122555782-122555804 TTCTTATCTCAGGCTCACTTTGG + Intergenic
985121487 4:186647421-186647443 CTCTGGAATCAGACAGACTTGGG - Intronic
985275272 4:188232353-188232375 CTTTGACATCAGGCAGACATAGG - Intergenic
985474520 5:72078-72100 CTCTTATGTCAGACTCACTTGGG + Intergenic
989009191 5:36850942-36850964 CTTTGGTATCAGGATGATTTTGG - Intergenic
989561421 5:42856583-42856605 CTCTGATATTAGACTCACTAGGG - Intronic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991602835 5:68370684-68370706 CTCTGCCATCAGGATGAATTAGG + Intergenic
992019582 5:72608513-72608535 ATCTGAAAACAGCCTGACTTTGG - Intergenic
992428633 5:76685439-76685461 CTCAGATATCATGCAGACATTGG - Intronic
993310246 5:86321273-86321295 CTTTGATATCAGGGTGAAGTTGG - Intergenic
994024119 5:95061939-95061961 CTTTGATTACAGGCTGACTCTGG + Intronic
995128651 5:108606661-108606683 CTGTGAAAAAAGGCTGACTTTGG - Intergenic
995641056 5:114258330-114258352 CTCTGGTATTAGGGTGACATTGG + Intergenic
995911459 5:117192807-117192829 CTTTGAAAACAGACTGACTTGGG + Intergenic
997166807 5:131669333-131669355 CTCTGATATCAGGATAATATTGG - Intronic
997343584 5:133167691-133167713 CTTTGATATCAGGATGACGTTGG + Intergenic
997564434 5:134876098-134876120 CTCTGAAGTCAGGCAGACATGGG - Intronic
997629862 5:135359117-135359139 TTCTGATCTGAGGCTGCCTTTGG + Intronic
998922174 5:147081681-147081703 CTCTGCAGTCAGCCTGACTTTGG - Intronic
999542599 5:152590006-152590028 CTTTGGTATCAGGATGACGTTGG - Intergenic
1001440814 5:171741384-171741406 CTTTGGGATTAGGCTGACTTGGG - Intergenic
1001597946 5:172910145-172910167 CTGTGAGATCAGGCTGAGTTTGG - Intronic
1003464796 6:6368679-6368701 CTCTGAGGTCATGCTGATTTAGG + Intergenic
1004590556 6:17047343-17047365 CTCTGATATCTGGAGCACTTTGG + Intergenic
1004802711 6:19168270-19168292 ACCTAATATGAGGCTGACTTAGG - Intergenic
1006848094 6:37077344-37077366 CTTTGATCTCTGCCTGACTTTGG + Intergenic
1007318897 6:41012117-41012139 CACTGACACCAGGCTGACCTGGG + Intergenic
1007570242 6:42884865-42884887 CACTGATTTCAGGTTGACTGTGG - Intronic
1007665990 6:43513236-43513258 CTCTGATCTCAGCCTCACCTAGG + Intronic
1007689263 6:43688191-43688213 ATCGGATATCAGGCAGACCTGGG + Intergenic
1008038996 6:46776005-46776027 CTCTTTGATCAGGCTGACTTGGG - Intergenic
1009264763 6:61539327-61539349 TTCTTATATCAGACTGAATTTGG + Intergenic
1009401161 6:63257704-63257726 CACTGATTTGAGTCTGACTTAGG + Intergenic
1009599133 6:65775290-65775312 ATTTGATATCAGGATGAGTTAGG - Intergenic
1009825713 6:68863760-68863782 CTCAGAAATCAGCCTTACTTAGG + Intronic
1011337823 6:86280629-86280651 CTTTGATATCAGGATGATGTTGG + Intergenic
1012204172 6:96440256-96440278 CTTTGGTATCAGGATGACGTTGG - Intergenic
1013029668 6:106321089-106321111 CTTTGAAATCAGACTGACATGGG + Intronic
1013033601 6:106360270-106360292 CTCTGATCTCTGGGTGGCTTGGG - Intergenic
1013258569 6:108414427-108414449 CTTTGGTATCAGGATGATTTTGG - Intronic
1013497086 6:110708299-110708321 CTCCAATATCAGGCTGAAGTGGG - Intronic
1013860017 6:114624418-114624440 CTCTGCCATCAGCCTGATTTGGG + Intergenic
1014858497 6:126432537-126432559 CTCAGATATCAGGTTGAGTCAGG + Intergenic
1018962146 6:168456664-168456686 CTCTGAGATCAGCCTGACCTGGG - Intronic
1021514232 7:21465391-21465413 CTCTGGATTCAGGCTGACCTAGG + Intronic
1021708603 7:23393025-23393047 CTCTGATATCTGACTTCCTTAGG + Intronic
1024420643 7:49161740-49161762 CTCTGAAATCATGTTGTCTTAGG - Intergenic
1024679434 7:51669386-51669408 CTTTGATATCAGGGTGATTCTGG - Intergenic
1024986446 7:55197985-55198007 CTTTGGTATCAGGATGACATTGG + Intronic
1025842529 7:65163898-65163920 CTCTGATTTTAAGCTGATTTTGG + Intergenic
1025880516 7:65532071-65532093 CTCTGATTTTAAGCTGATTTTGG - Intergenic
1025892921 7:65670533-65670555 CTCTGATTTTAAGCTGATTTTGG + Intergenic
1027301727 7:76845057-76845079 CTCTGGAATCAGGCAAACTTGGG - Intergenic
1029951357 7:104589598-104589620 CTTTGATATCAGGATGATGTTGG + Intronic
1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG + Intronic
1030091672 7:105863623-105863645 CTCTGGAATCAGCCTGCCTTGGG + Intronic
1031555413 7:123169325-123169347 CTCTGGTTTCAGGCTGACGCTGG - Exonic
1031935339 7:127730299-127730321 CTCTGATATCCGTCTGTTTTTGG + Intronic
1032108312 7:129053789-129053811 CTTGGTTATCTGGCTGACTTAGG - Intronic
1032671251 7:134084522-134084544 CTCTCATCTCAGGCTGACATTGG + Intergenic
1033914421 7:146306401-146306423 CTTTGTTATCAGGCTGATGTTGG - Intronic
1034103823 7:148473646-148473668 ATCTGATTTCAGGCTTTCTTGGG + Intergenic
1037574367 8:20187300-20187322 CTCAGATTGGAGGCTGACTTTGG + Intergenic
1040731044 8:50447331-50447353 CTCTGATAACAGCCTCACTGAGG + Intronic
1042636327 8:70879780-70879802 CTTTGGTATCAGGATGACGTTGG - Intergenic
1043081349 8:75769048-75769070 CTTTGGTATCAGGATGATTTTGG + Intergenic
1043725458 8:83605079-83605101 CTTTGGTATCAGGATGACTCTGG - Intergenic
1045068545 8:98476309-98476331 CTCTAATATTGGGCAGACTTGGG + Intronic
1045202059 8:99993770-99993792 CTTTGGTATCAGGATGACGTTGG - Intronic
1045270023 8:100653754-100653776 CTCTGGTATGAGGCTGACTGTGG - Intronic
1045969390 8:108062688-108062710 CTTTGATATCAGGATGATTCTGG - Intronic
1046180675 8:110643165-110643187 CTTAGATATATGGCTGACTTTGG - Intergenic
1048059421 8:130902573-130902595 CTCTGAGACTAGGCTGTCTTTGG - Intronic
1048414878 8:134215423-134215445 CTCTGAAGTCAGGCAAACTTGGG - Intergenic
1048459568 8:134610396-134610418 CTGTGACATCAGGCTGCCCTTGG + Intronic
1048657390 8:136556086-136556108 CTCACATATCAGACTGACTGTGG + Intergenic
1049345198 8:142135008-142135030 CTGTGATTTCTGGCTCACTTTGG - Intergenic
1051002572 9:12303015-12303037 CTGTGGCATCAGGCTGACATGGG - Intergenic
1051245186 9:15102724-15102746 CTATGATAGCAAGCTGTCTTTGG - Intergenic
1051610459 9:18956965-18956987 CTTTGAAATCAGGCAGACCTGGG - Intronic
1052286545 9:26792496-26792518 CTCTGATTTCAGAATGAATTGGG + Intergenic
1052657675 9:31383864-31383886 CTCTGAAATTAGGCTGACATGGG + Intergenic
1056448523 9:86690711-86690733 CTCTGATGTCAGGATCACTTGGG + Intergenic
1057254965 9:93538780-93538802 ATCTGTTATAATGCTGACTTTGG - Intronic
1060718793 9:125959697-125959719 CTGTGATATCAGGCTGGGTGGGG - Intronic
1061308133 9:129744328-129744350 CTGTGATCTCAGGCTGAAGTGGG + Intronic
1186782417 X:12926402-12926424 CTTTGGTATCAGGATGACTCTGG - Intergenic
1187039645 X:15580144-15580166 CTTTTATATCAGGCAGTCTTTGG - Intronic
1189189407 X:39086204-39086226 CTTTGATATCAGGGTAATTTTGG - Intergenic
1189736979 X:44081172-44081194 TTCTGACATCAGACTGAGTTAGG + Intergenic
1190298522 X:49042778-49042800 CTCTGATTAGAGGCTGAATTCGG - Intronic
1191706611 X:64100659-64100681 CTCTGAAATCAGCCAGTCTTAGG + Intergenic
1192200386 X:69062826-69062848 CTCTAAAACGAGGCTGACTTGGG - Intergenic
1192294517 X:69833529-69833551 CTTTGATATCAGGATGATGTTGG + Intronic
1195974484 X:110511453-110511475 CTCTGGCATCTGGCTGAGTTTGG + Intergenic
1197729441 X:129797441-129797463 CTCAGATATCAGGCCCAGTTTGG + Intergenic
1197960659 X:132002363-132002385 TTCTGATATCAGGGAGACCTGGG - Intergenic
1198593075 X:138205883-138205905 CTGTGAAATCAGGAGGACTTTGG - Intergenic
1198751008 X:139936213-139936235 CTCTAATTTCAGGTTGAGTTTGG - Intronic
1201740731 Y:17322249-17322271 CTTTCATATCAGGATGATTTTGG + Intergenic