ID: 964384225

View in Genome Browser
Species Human (GRCh38)
Location 3:156130218-156130240
Sequence ATTACCTTCTGCACTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964384223_964384225 6 Left 964384223 3:156130189-156130211 CCACTATCTATGTGTTCGCTATT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 964384225 3:156130218-156130240 ATTACCTTCTGCACTGGACATGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964384225 Original CRISPR ATTACCTTCTGCACTGGACA TGG Intronic
909063457 1:70905252-70905274 TTTCCCTTCTGCACTGCAGAAGG - Intronic
911133528 1:94415630-94415652 CTGAACTTCTGCACTGGAAATGG - Intergenic
913199726 1:116485765-116485787 TTTACCAGCTGCACTGGTCATGG + Intergenic
920314134 1:205065724-205065746 ATGGCCTGCTGCACTGGTCAGGG + Intronic
921123133 1:212153874-212153896 CTTTCCTTCTGCACTGAAAAGGG - Intergenic
923756909 1:236799631-236799653 ATTACATTCTGGAATGTACAAGG + Intronic
1064408510 10:15085419-15085441 TTTACTTTCTGCAATGAACATGG + Intronic
1070050085 10:72880191-72880213 CTTGCCTTCTGCACTGGCTAGGG - Intronic
1074101133 10:110355669-110355691 TATGCCTTCAGCACTGGACAGGG - Intergenic
1079154029 11:17927243-17927265 AGTCCCTTCCACACTGGACAAGG - Intronic
1082658307 11:55878048-55878070 CTTTCCTGCTGCATTGGACATGG + Intergenic
1086048541 11:82561643-82561665 AATTTCTTCTGCAATGGACATGG - Intergenic
1086299235 11:85407533-85407555 ATTTCCTTCTGAAGTGGACTAGG + Intronic
1087006937 11:93480300-93480322 ACCACCGTCAGCACTGGACATGG + Intronic
1089743258 11:120599639-120599661 AGTACTTTCTGCACTGAAAACGG - Intronic
1092845752 12:12583403-12583425 AGTTCCTGCTGCATTGGACAAGG - Intergenic
1095926863 12:47587103-47587125 AGTAACTGCAGCACTGGACACGG - Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1099604161 12:84780638-84780660 ATTACCACTTGCCCTGGACATGG - Intergenic
1100723791 12:97387111-97387133 ATTGCCTTCTGTACCAGACAAGG + Intergenic
1102977599 12:117217788-117217810 ATTTCCTCCCACACTGGACAGGG + Intronic
1103577988 12:121892893-121892915 ATTACCTTTTACACTTTACATGG + Intronic
1104071457 12:125349667-125349689 ATTATCTTCTCCACTGAAAATGG - Exonic
1104388040 12:128367626-128367648 CTTGGCTACTGCACTGGACAGGG - Intronic
1109382876 13:61587404-61587426 ATTTCATACTTCACTGGACAAGG - Intergenic
1110419917 13:75295408-75295430 ATAAGCTTCTGCACTGAACATGG - Intronic
1110845973 13:80190693-80190715 CCTACCCTCTGCACAGGACAAGG + Intergenic
1118411302 14:65481058-65481080 ATTTCCATCAGCACTGCACAGGG + Intronic
1119370789 14:74140539-74140561 AGTACTTCCTGCACTGGAGAGGG - Intronic
1121390165 14:93566791-93566813 AATACCATCTCTACTGGACATGG - Intronic
1122288755 14:100668228-100668250 ATCTCCCCCTGCACTGGACAGGG - Intergenic
1128666904 15:69544985-69545007 GTTACTTTCTGGACTGGACAAGG - Intergenic
1129042875 15:72705441-72705463 ATGACCTTCAGCACTGGATTTGG + Intronic
1130352237 15:83102933-83102955 AGTGGCTTCTGTACTGGACATGG - Intergenic
1131532045 15:93202058-93202080 ATTGTCTTTTGCACTGGACTTGG + Intergenic
1143357497 17:6341498-6341520 TTTCCCTTCTGCACTTAACAAGG + Intergenic
1157481182 18:48054841-48054863 ATCAGCTTCTGCAGTGGGCAAGG - Intronic
1163126525 19:15247192-15247214 ATTACCTCCTTCACTGGAGTGGG - Intronic
1167018033 19:46854457-46854479 ATTGCCTCCTGCATTGGACAGGG - Intergenic
1167023859 19:46900048-46900070 ATTACCTTATGCTCTTGAAAAGG + Intergenic
1167986609 19:53323899-53323921 AACAACTTCTGCACTGGGCATGG + Intergenic
1168244760 19:55106646-55106668 GGTCCCTTCTGCACAGGACATGG + Intronic
927201143 2:20578741-20578763 ACTGCCACCTGCACTGGACAGGG + Intronic
928372540 2:30751311-30751333 AGAACTCTCTGCACTGGACATGG - Intronic
928467270 2:31533680-31533702 ACTGCCTTCTGCACTGGAAATGG - Exonic
929172855 2:38948892-38948914 ATTCCCCTCTGATCTGGACAGGG + Intronic
934110697 2:88739442-88739464 TTTCCCTTCTGCAATGGGCACGG - Intronic
935173859 2:100630922-100630944 ACCAGCTTCTGCACTGGCCAGGG - Intergenic
943941593 2:194004585-194004607 ATTACCTTCAGCATTGTCCAAGG + Intergenic
946520488 2:220458995-220459017 ATACCCTTTTGCACTGGCCAAGG - Intergenic
947124842 2:226857321-226857343 ATTCCCTTCAGCACTGTACAGGG - Intronic
947825874 2:233105704-233105726 ATCACCTGCTGCCCTGGGCAGGG - Intronic
1169638193 20:7718831-7718853 ATTACCTTCTGTTCTGCACGTGG + Intergenic
1169936171 20:10885788-10885810 AGTACCTTCTCCAGTGGACTTGG - Intergenic
1171155154 20:22865135-22865157 TTTACCTTCCACTCTGGACATGG - Intergenic
1172930862 20:38585748-38585770 ATGACATACTGTACTGGACATGG - Intronic
1175453612 20:59092398-59092420 ATCACCTTCTGCACTCAAAATGG + Intergenic
1175543411 20:59762381-59762403 AGTGGCTACTGCACTGGACAGGG - Intronic
1175791007 20:61739697-61739719 TTTACCTTCTGAACTGGGCCTGG - Intronic
1175833732 20:61980738-61980760 ATCGCCGTCTGCACTGGACGAGG + Intronic
1177394779 21:20519135-20519157 AGTACGTACTGCATTGGACAAGG + Intergenic
1178145353 21:29733599-29733621 TTTAGCTTCAGCACTTGACATGG + Intronic
1179506020 21:41841417-41841439 TTAACCATCTGCACTGGAAACGG - Intronic
949743491 3:7263284-7263306 ATAACCTGCTGCGCTGGAGAGGG + Intronic
951301393 3:21001726-21001748 ATAACATTCTGCAATGGAAATGG + Intergenic
952304021 3:32129650-32129672 ATGACTTTCTGCTCTGGACTTGG + Intronic
960631208 3:119733004-119733026 ATTACATTTTGCTCTGGAGATGG - Intronic
961808535 3:129507016-129507038 ATGTTCTTCTCCACTGGACAAGG + Intronic
962036693 3:131659365-131659387 ATCCCCTTCTGCACTGAAAATGG - Intronic
962131066 3:132677214-132677236 ATTATATTCTGCACCGAACAAGG + Exonic
964384225 3:156130218-156130240 ATTACCTTCTGCACTGGACATGG + Intronic
964659946 3:159109219-159109241 AATACCTTCTTCACTGCAAAAGG - Intronic
968091386 3:195900345-195900367 ATTCCCTTCTCCACTGGAGTTGG - Intronic
968738370 4:2312403-2312425 ATTGACTTCTGCAATGAACAAGG + Intronic
969961655 4:10950608-10950630 ATTTTCTTGGGCACTGGACATGG + Intergenic
975781790 4:77848070-77848092 GTTGCCTTGTGCACTGGCCACGG + Intergenic
978653994 4:111044832-111044854 ATTCCCTTCTGCATTTCACAGGG - Intergenic
980568453 4:134577447-134577469 ATTACCTACTGTACTAGCCAGGG - Intergenic
981568798 4:146130647-146130669 ATTATCTTTTGCAATGGATATGG + Intergenic
983969866 4:173858296-173858318 GTTGACTTCTGCACTGGAGAGGG + Intergenic
984474442 4:180217719-180217741 ATTGCCTCCTGCTCTGGTCATGG - Intergenic
987300897 5:16597523-16597545 ATGGCATTCTGCACTGGGCAAGG + Intronic
987478929 5:18428580-18428602 TTTCCCTTCTGCACTGCCCAAGG - Intergenic
987741766 5:21917544-21917566 ATTACTTTCAGCACTAGACATGG + Intronic
989229703 5:39073428-39073450 TTTACCTTCTGCAGTGGAGATGG - Intronic
989483061 5:41955010-41955032 ATCACCTTCTACTCTGGAGAGGG - Intergenic
996471828 5:123870217-123870239 GTTAGCTTCTGCACTAGATATGG + Intergenic
998421920 5:141995352-141995374 ATTCCCTTGTGCTTTGGACACGG + Intronic
999511369 5:152256127-152256149 ATTGTCTTCTCCACTGGACTGGG + Intergenic
1000182601 5:158826414-158826436 ATTGCCTACTGCATTGGACACGG + Intronic
1000184644 5:158847073-158847095 TTTACCTTTTCCACTGGCCAAGG + Intronic
1002689403 5:181039875-181039897 ATAACCTTCTCCTCAGGACAAGG - Intergenic
1003335674 6:5169839-5169861 ATTCCCTCCTACACTGGTCATGG - Intronic
1005773074 6:29097168-29097190 ATTAACTTCTTTTCTGGACAAGG - Intergenic
1008000805 6:46357884-46357906 ATTTCTTCCTGCCCTGGACAAGG - Intronic
1008175526 6:48263791-48263813 ATTACCTTCTACACTATAAAAGG + Intergenic
1010233705 6:73557663-73557685 ATTTCCTTCTTCACTGAGCAGGG - Intergenic
1012097478 6:94981161-94981183 ATTACATTCTGCACTTGAAAAGG - Intergenic
1016544262 6:145202750-145202772 ATTACCATCAGCATTAGACAAGG - Intergenic
1017185603 6:151597623-151597645 GTGACCTTCTCCACTGGACTTGG - Intronic
1019460786 7:1157651-1157673 ATTACCTTCTGGAATGCAAACGG + Exonic
1020456375 7:8377838-8377860 CTAAGCTTCTGCACTGAACAAGG - Intergenic
1021999027 7:26207487-26207509 ATTACCTGTTACACTGCACATGG - Intronic
1022727362 7:32993091-32993113 ATTCCCTTTTGCCCTGGAGAAGG + Intronic
1031114982 7:117657886-117657908 ATAAGATTCTACACTGGACATGG - Intronic
1037022428 8:13989860-13989882 ATTACCTTCTGTATTAGTCAGGG - Intergenic
1037692986 8:21198343-21198365 CCTCACTTCTGCACTGGACAGGG + Intergenic
1037739966 8:21600921-21600943 ATGACCTTCTGCATTGCCCATGG + Intergenic
1038140135 8:24835698-24835720 ATTACCTTCTGCCCTCTACATGG + Intergenic
1038259498 8:25980697-25980719 TTTCCTTTCTGCACTGGACCTGG - Intronic
1039605774 8:38879123-38879145 TTAACCTGCTGCACTGAACATGG + Intergenic
1041410637 8:57550468-57550490 CTTACCATCTGCACAGGAGATGG - Intergenic
1043941507 8:86201105-86201127 ATCACTCTCTGCACTGGAGATGG - Intergenic
1044132907 8:88548747-88548769 GTTACCTTCTGGAGTGGAAATGG + Intergenic
1045309478 8:100988067-100988089 ATCACCATCTGCAAGGGACAGGG + Intergenic
1047525508 8:125630621-125630643 ATTCCCATCTTCAATGGACAAGG - Intergenic
1051599399 9:18857637-18857659 CTTAACTTCTGCAATGGAAAAGG - Intronic
1051721212 9:20039407-20039429 ATTTCCTCCTGCCCTGGACTGGG - Intergenic
1052612611 9:30795372-30795394 ATTATCTTCTACCCTGGAGATGG + Intergenic
1052772531 9:32702996-32703018 GGTACCCTCTGCCCTGGACATGG - Intergenic
1053529558 9:38866371-38866393 ATAACATGCTGCACTGAACATGG - Intergenic
1054201783 9:62090798-62090820 ATAACATGCTGCACTGAACATGG - Intergenic
1054636574 9:67497561-67497583 ATAACATGCTGCACTGAACATGG + Intergenic
1055341494 9:75288956-75288978 GTAACTTTTTGCACTGGACAAGG + Intergenic
1056929198 9:90860796-90860818 ATGGCCTTCAGAACTGGACATGG - Intronic
1058079031 9:100682008-100682030 TTGACCTTCTGCACTGGCTAGGG - Intergenic
1059770710 9:117421815-117421837 ATTACATTTTGAACTGGTCAAGG + Intergenic
1188922220 X:35990635-35990657 CTTTCCTTTTGCACTGCACATGG + Intergenic
1189933058 X:46035380-46035402 ATTACCTTTTGGATTGGACAAGG + Intergenic
1194342501 X:92722023-92722045 ATTACCTTCTGAACCTGAAAAGG - Intergenic