ID: 964384569

View in Genome Browser
Species Human (GRCh38)
Location 3:156133660-156133682
Sequence GTGTGATATTAGAAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964384567_964384569 23 Left 964384567 3:156133614-156133636 CCTGGAGTCTGTTCAGGGAAGAC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG 0: 1
1: 0
2: 0
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964384569 Original CRISPR GTGTGATATTAGAAGTGTGA AGG Intronic
900861263 1:5234094-5234116 GTGTGAAAGGAGAAGTGTCAAGG - Intergenic
907107673 1:51898955-51898977 GTTTAATATTAGAAGTGTTTTGG - Intergenic
907190912 1:52647921-52647943 GTATCATATTAAAAGTGAGAAGG + Intronic
908920349 1:69183545-69183567 TTGTGATAGTAGGTGTGTGATGG + Intergenic
909265449 1:73551991-73552013 GTATGAGATTAGAAATGTTAAGG - Intergenic
909467449 1:75988833-75988855 GTTTAATATTAGAAGTGTTTTGG + Intergenic
910107800 1:83650375-83650397 GTCTGATATAAGAAGTGGGTGGG + Intergenic
911527894 1:99007349-99007371 GGGGGATATTAGAATTCTGAAGG - Intergenic
915224020 1:154398656-154398678 GTTTGATATTAGCAGTGTTTGGG - Intergenic
915617063 1:157046542-157046564 CGGTGGTATTAGAAGTGGGAAGG - Intergenic
916275525 1:162989467-162989489 GTAGGATATTAGAAGTGTTAAGG - Intergenic
916578484 1:166087782-166087804 GTGTGATGTTTGAAATGTGTAGG + Intronic
918494262 1:185115757-185115779 GTTTAATATTAGAAGTGTTTGGG + Intergenic
918586158 1:186191240-186191262 GTGTGATATTAAACTAGTGAAGG + Intergenic
918874298 1:190019698-190019720 GTCTAATATTAGAAGTGTTTTGG - Intergenic
919568245 1:199216478-199216500 GTGTGTCATTTGATGTGTGATGG + Intergenic
920682425 1:208083313-208083335 GTGTTATTTCTGAAGTGTGAAGG - Intronic
921364811 1:214363760-214363782 GTGGGACATTAGAAGTTTTAAGG - Intronic
921488623 1:215746648-215746670 GTTTAATATTAGAAGTGTTTTGG + Intronic
922043602 1:221921661-221921683 GTTTAATATTAGAAGTGTTTTGG - Intergenic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
1063575008 10:7253495-7253517 ATGTGATGTTAGAAGTGTTGTGG + Intronic
1065979147 10:30874020-30874042 GTGTGACATGAGAAGTTTGCTGG - Intronic
1066195175 10:33092162-33092184 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1067925761 10:50506612-50506634 GTGTGATCTTAGGAGTGAGTGGG - Intronic
1067939683 10:50643774-50643796 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1068329052 10:55537971-55537993 GTGTGATTTTATCATTGTGAAGG - Intronic
1068695113 10:59959216-59959238 GTCTGTTATCAGAAGTGTGGTGG + Exonic
1069867929 10:71515100-71515122 GTGTGAGGTTAGAAGTCTGGTGG + Intronic
1071752329 10:88494646-88494668 GAGTAATATTACCAGTGTGAAGG + Intronic
1072949048 10:99836342-99836364 GTTTGATATTAGCGGTGGGAGGG + Intronic
1073031233 10:100527677-100527699 GTGTGATATTAGAGATGAAAGGG + Intronic
1073299050 10:102459687-102459709 GGGTGACATGGGAAGTGTGAAGG + Intergenic
1073835594 10:107437514-107437536 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1075243520 10:120799651-120799673 CTGTGAGGTTAGAAGTGAGATGG - Intergenic
1077657099 11:4029818-4029840 GTGTAATATTAGGAGTGTTTTGG + Intronic
1078459915 11:11506672-11506694 CTGTGTTATTAGAAAAGTGAAGG + Intronic
1078583721 11:12561483-12561505 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1079886073 11:25990785-25990807 GGTTGATATGAGTAGTGTGAAGG - Intergenic
1080309832 11:30877009-30877031 GTGTGATGTTAGAGATGTGAAGG - Intronic
1081445038 11:43123004-43123026 GTGTGATGATGGCAGTGTGATGG - Intergenic
1081953422 11:47066881-47066903 GTTTAATATTAGAGGTGTGTAGG + Intronic
1081997751 11:47376090-47376112 GTGTGGGATTATGAGTGTGAGGG - Intronic
1082715531 11:56607053-56607075 AAGTCATATTAGAAGTGTAAGGG - Intergenic
1082953423 11:58842955-58842977 GTTTTATATTAGAAGTGTTTGGG + Intronic
1085131028 11:74038749-74038771 GTGTGAAATGATGAGTGTGAAGG - Intronic
1085561641 11:77477370-77477392 GTTTGATATTAGAGGTGTTTTGG - Intergenic
1086650890 11:89288510-89288532 GAGTCATATTAGAAGCTTGAAGG + Intronic
1086677249 11:89623419-89623441 GTGTTATATGAGAAGTGCCAGGG + Intergenic
1087558071 11:99747828-99747850 GTGTGATATTAGATTTGGGCTGG + Intronic
1088123774 11:106399106-106399128 CTGCAATATTAGCAGTGTGATGG + Intergenic
1088152731 11:106765480-106765502 GTTAGGTATTAGAAATGTGAGGG - Intronic
1088289142 11:108217366-108217388 GTTTAATATTAGAAGTGTTTTGG + Intronic
1088427274 11:109717829-109717851 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1090486028 11:127112822-127112844 GTGTGATATGAGAAGATTAAAGG + Intergenic
1090645895 11:128766481-128766503 CTGAGATATTAGAAGTCAGACGG - Intronic
1095629835 12:44362633-44362655 GTGTTAGCTTAGAATTGTGATGG + Intronic
1095658269 12:44697148-44697170 GTTTAATATTAGAAGTGTTTTGG - Intronic
1096787295 12:54024548-54024570 GAGGGATATTTGAAGTGAGAGGG - Intronic
1097532988 12:60829206-60829228 TTGTGATGTTAGAAGGGCGAGGG - Intergenic
1098863581 12:75736766-75736788 GTGTAATATTAGAAGTGTTTGGG - Intergenic
1099187007 12:79526249-79526271 TTGTGATATTAGGAGTGTCCTGG - Intergenic
1099817047 12:87662778-87662800 GAGTGATATTAGAAATAAGATGG + Intergenic
1100416359 12:94380630-94380652 GTGCTATATTAGAGGTGTGATGG + Intronic
1101614294 12:106321015-106321037 GTTTAATATTAGAAGTGTTTGGG + Intronic
1103881519 12:124169745-124169767 GTGAGATATCAGAGGTGTGGAGG - Intronic
1107113145 13:36719307-36719329 GTGTGTTATTTTAAGTGAGATGG - Intergenic
1109189797 13:59310469-59310491 GTTTGATGTTGGAAGTGTGTTGG - Intergenic
1110360737 13:74621920-74621942 GTGTGGCATTAGAATTGAGAAGG - Intergenic
1110418722 13:75280433-75280455 GTTTGATATTAGAAGTGTTTGGG - Intergenic
1111286527 13:86100359-86100381 TTGTGATATTAAAAATGTTATGG + Intergenic
1112656671 13:101459036-101459058 CTGCGAGATCAGAAGTGTGATGG + Intronic
1115318389 14:32050966-32050988 GAATGATAATAGAAGTGTAATGG + Intergenic
1116022648 14:39480544-39480566 GTGAGAAATTTGAAGTGTGGGGG + Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1116739561 14:48736811-48736833 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1116832857 14:49739515-49739537 GTGTGACAATGGAAATGTGAAGG + Intronic
1117076460 14:52109901-52109923 GCCTGATGTTAGAAGTGTGAGGG - Intergenic
1118065566 14:62186880-62186902 GTTGGCTATTAGAATTGTGATGG + Intergenic
1121582717 14:95043149-95043171 GAGTTATATAAGATGTGTGAAGG + Intergenic
1123982660 15:25618191-25618213 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1126392306 15:48171998-48172020 GTGTGATTTTAAAAGTATAATGG + Intronic
1127207602 15:56736557-56736579 GTATGATGTCAGAAGTTTGAAGG - Intronic
1127432424 15:58923518-58923540 GTGTGATATTACAAAAGTTAGGG - Intronic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1130006614 15:80105274-80105296 GTTTTTTATTAAAAGTGTGATGG - Intronic
1131902143 15:97099530-97099552 GTGTGTTAACAGAAGTGGGAGGG - Intergenic
1133674181 16:8054319-8054341 GTGTGATGTCAGAAGTTTGAGGG + Intergenic
1135300882 16:21326077-21326099 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1135626962 16:24003811-24003833 GTATGTTATAAGAAGAGTGAAGG + Intronic
1138953765 16:61946092-61946114 GTGGGATATTAGGAGTGGGCAGG - Intronic
1141291268 16:82720049-82720071 GTTTAATATTAGAAGTGTTTTGG - Intronic
1147246741 17:39126479-39126501 GTTTAATATTAGAAGTGTTTTGG - Intronic
1149185800 17:53995961-53995983 GTGTGAGATTTGAAGTGTAGAGG - Intergenic
1149459930 17:56820234-56820256 GTTTGATATTAGAAATGTTTTGG - Intronic
1149692183 17:58587095-58587117 GTTTAATATTAGAAGTGTCTTGG + Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1151457487 17:74234695-74234717 GTGAGAGAGTAGAACTGTGAGGG + Intronic
1154384744 18:13883054-13883076 GTTTGATATTAGAAGTGGCAGGG - Exonic
1155125978 18:22876052-22876074 GTTTAATATTAGAAGTGTTTTGG + Intronic
1155591396 18:27431360-27431382 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1156624179 18:38888618-38888640 GTCTTATATTAAAAGTGAGAAGG + Intergenic
1157723114 18:49941148-49941170 GTGAGAAATGAGGAGTGTGAGGG - Intronic
1158535165 18:58301925-58301947 GTGTGCACTTGGAAGTGTGATGG + Intronic
1158969951 18:62657070-62657092 GTTTAATATTAGAAGTGTTTGGG + Intergenic
1159667919 18:71185985-71186007 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1161093048 19:2372555-2372577 CTCTGAGATTAGCAGTGTGAAGG + Intergenic
1161336184 19:3714851-3714873 GTGTGATCTGAGCAGGGTGAGGG - Intronic
1162612845 19:11769456-11769478 GTATGATATTAGCAGACTGATGG - Intronic
1163362338 19:16854888-16854910 GTTTAATATTAGAAGTGTTTTGG + Intronic
1164887746 19:31797383-31797405 GTGTGAGACTAGAAGTGCTAGGG - Intergenic
926005773 2:9372577-9372599 GTTTAATATTAGAAGTGTTCTGG - Intronic
926197831 2:10774384-10774406 TTGTGATATTGGAAGTGAAATGG + Intronic
928761489 2:34588305-34588327 ATGTGATTTGAGAAGTGTTATGG - Intergenic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
930399359 2:50863482-50863504 GTTTGATTTTAGCAGAGTGAAGG + Intronic
931065530 2:58581833-58581855 GTTTAATATTAGAAGTGTTTTGG + Intergenic
931956296 2:67429348-67429370 GTTTAATATTAGAAGTGTTTTGG + Intergenic
932477361 2:72014631-72014653 GTGGGATTTTAGAAGAGTGGGGG - Intergenic
932682984 2:73842564-73842586 GTTTAATATTAGAAGTGTTTTGG + Intronic
932829634 2:74976722-74976744 ATCTGATATTAACAGTGTGAAGG + Intergenic
933363691 2:81321730-81321752 GTTTCATATTAGAAGTGTTTGGG - Intergenic
935329527 2:101966406-101966428 GTGGGATTCTAGACGTGTGAAGG + Intergenic
935424389 2:102904842-102904864 GTTTAATATTAGAAGTGTTTTGG - Intergenic
938585903 2:132690454-132690476 GTTTAATATTAGAAGTGTTCTGG + Intronic
938762819 2:134440943-134440965 GTTTAATATTAGAAGTGTTTTGG + Intronic
938978596 2:136504135-136504157 GTTTAATATTAGAAGTGTTTTGG + Intergenic
939448985 2:142348123-142348145 GTGTTATTGTAGAAATGTGATGG - Intergenic
939737936 2:145872737-145872759 GTCTAATATTAGAAGTGGGGAGG + Intergenic
941020607 2:160404848-160404870 TTCTGAGATTAGAAGGGTGATGG + Intronic
941978730 2:171432934-171432956 GTTTAATATTAGAAGTGTTTTGG - Intronic
942318057 2:174712409-174712431 GTTTAATATTAGAAGTGTTTTGG + Intergenic
942666257 2:178322080-178322102 GTGGTATATTTGAAGTGTGATGG - Intronic
944954323 2:204790498-204790520 GTGTGTTATAAGAAGTGTTCTGG + Intronic
947106622 2:226674559-226674581 GTGTGATATTCTATGTATGATGG - Intergenic
947411438 2:229844948-229844970 GTGTAATAGTAGAAATGTGTTGG - Intronic
947730024 2:232422748-232422770 GTGTGAATTTAGAAAGGTGAAGG - Intergenic
948568674 2:238902627-238902649 GTGTGATATGAGGTGTGTGATGG + Intronic
1169150010 20:3282141-3282163 GTGTGTTCTGAGAAGTGGGAAGG - Intronic
1169590997 20:7142190-7142212 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1170738541 20:19032161-19032183 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1175049593 20:56142351-56142373 GTGTGAGATTAGAAGTAAGATGG + Intergenic
1176423075 21:6531904-6531926 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1177171513 21:17660971-17660993 GTGTAAAATAAGAAGTGTGGGGG + Intergenic
1178294596 21:31398508-31398530 TTTAGATATTTGAAGTGTGATGG - Intronic
1179077080 21:38132604-38132626 GTGTGGTATTAGAGGTGTTAGGG - Intronic
1179698569 21:43140220-43140242 GTTTAATATTAGAAGTGTTTGGG - Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
953649591 3:44789886-44789908 GTTTAATATTAGAAGTGTGTTGG - Intronic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
956277568 3:67519405-67519427 GTGTAACATTAGAAGTGTGCTGG + Intronic
956716170 3:72081932-72081954 GTGTGATGGTAGGAGTGAGATGG - Intergenic
959104880 3:102054284-102054306 GTTTGATATTAGAAGTGTTTTGG - Intergenic
959570115 3:107874126-107874148 GTATGAGATTAAAAGTTTGATGG - Intergenic
960478725 3:118162320-118162342 GTCTAATATTAGAAGTGTTTTGG + Intergenic
962615184 3:137118811-137118833 GTGTTATTTAAGAAGGGTGAAGG - Intergenic
963223281 3:142834155-142834177 GTGTGGTTTTAAAAGAGTGATGG - Intronic
963579861 3:147111793-147111815 GTTTAATATTAGAAGTGTTTTGG - Intergenic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
965523673 3:169694371-169694393 GTGTGATTTTAGAAGTCAGCTGG + Intergenic
966008780 3:175050501-175050523 GTTTAATATTAGAAGTGTTTTGG + Intronic
966089800 3:176119207-176119229 ATGGAATGTTAGAAGTGTGACGG + Intergenic
966529864 3:180964946-180964968 AGGTGATTTTAGAAGTTTGAGGG + Intronic
966556290 3:181264264-181264286 GTGTCATATTTAAAATGTGAGGG + Intergenic
966593625 3:181706990-181707012 GTCAGATTTTGGAAGTGTGAAGG - Intergenic
967607066 3:191459104-191459126 GTTTAATATTAGAAGTGTTTTGG + Intergenic
968203279 3:196775089-196775111 GTGGTATATTAGAATTGTGGCGG + Intronic
970317585 4:14844593-14844615 GTGAGATTTTACAACTGTGATGG - Intergenic
970676563 4:18456936-18456958 GTTTAATATTAGAAGTGTTTGGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972249041 4:37280220-37280242 GTTTAATATTAGAAGTGTTTTGG - Intronic
972748087 4:41960346-41960368 GTGTGAAATTGGAAGTATCAAGG + Exonic
973123391 4:46552635-46552657 GTTTGATATTAGAAGTGTTTGGG - Intergenic
973587271 4:52405879-52405901 GTGGGAGATAAGAAGGGTGAGGG + Intergenic
974601931 4:64094561-64094583 ATGTGATATTCTAAGTTTGAAGG - Intergenic
975073657 4:70177421-70177443 GTTTAATATTAGAAGTGTTTTGG + Intergenic
975544509 4:75547587-75547609 GTTTAATATTAGAAGTGTTTTGG - Intronic
975766929 4:77678331-77678353 GTTTGATATTAGAATTATAAAGG - Intergenic
976114471 4:81712162-81712184 GTTTAATATTAGAAGTGTTTTGG + Intronic
976624682 4:87167222-87167244 GTGTGACATAAGAGATGTGAAGG + Intronic
977250408 4:94682747-94682769 GTTTGATATTAAAATTCTGAAGG + Intergenic
978912765 4:114083790-114083812 GTGTCATTTGAGCAGTGTGAGGG - Intergenic
979557761 4:122069508-122069530 ATGTGATATCAGAAGAGAGAGGG - Intergenic
982584348 4:157219573-157219595 GTTAGATATTAAAAGTTTGAAGG - Intronic
982878605 4:160680517-160680539 TTGTGATATCAGAAGTGTGTTGG + Intergenic
983252426 4:165359983-165360005 GTTTAATATTAGAAGTGTTTGGG - Intergenic
984651334 4:182273792-182273814 GTGTAAATTGAGAAGTGTGAAGG + Intronic
987053931 5:14173083-14173105 GGGTAATATGAGAAATGTGACGG + Intronic
990107874 5:52287010-52287032 GTTTAATATTAGAAGTGTTTTGG - Intergenic
990956142 5:61341399-61341421 GTTTAATATTAGAAGTGTTGTGG + Intronic
991219433 5:64195665-64195687 GTTTAATATTAGAAGTGTTTTGG - Intronic
991230224 5:64324142-64324164 GTTTAATATTAGAAGTGTTTTGG - Intronic
992850987 5:80807354-80807376 GTTTAATATTAGAAGTGTGTTGG - Intronic
993729909 5:91410193-91410215 GTTTAATATTAGAAGTGTCTTGG - Intergenic
994977603 5:106829970-106829992 GTTTTATACTAGAAGTGTCAGGG - Intergenic
997053758 5:130414942-130414964 ATGTGACATTAGAATTGTGTTGG - Intergenic
997258203 5:132445386-132445408 GTGTGGTAGTAGCAGTGTGGAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997633983 5:135390939-135390961 GAGTGATGTTAGAAGAGTAAAGG + Intronic
998775709 5:145599199-145599221 GTGTGGTAATAGAACTGTCATGG - Intronic
1000120138 5:158189477-158189499 GTGTGACATAAGAGATGTGAAGG - Intergenic
1000934439 5:167291386-167291408 GTGAGAGATGATAAGTGTGAGGG - Intronic
1001068177 5:168557090-168557112 ATGTGATTTTAGAAATGTTAAGG - Exonic
1001207868 5:169780913-169780935 GTATAATATTAGAAGTGTTTTGG - Intronic
1002653080 5:180718232-180718254 GGGGGAAATGAGAAGTGTGAGGG + Intergenic
1003774325 6:9342940-9342962 GGGTGAGATTAGAAGAGAGAAGG + Intergenic
1004160270 6:13206559-13206581 GTTTAATATTAGAAGTGTTGTGG - Intronic
1004163606 6:13236043-13236065 GGGTGATATTTCAAGGGTGAAGG - Intronic
1004813869 6:19291283-19291305 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1004902423 6:20206531-20206553 ATGTAATATTAGGAGTGTGGGGG - Intronic
1005103556 6:22199417-22199439 GTGTCACATGAGAAGGGTGAGGG - Intergenic
1005189515 6:23204187-23204209 GTTTAATATTAGAAGTGTTCTGG - Intergenic
1005320057 6:24644378-24644400 GTTTAATATTAGAAGTGTTGTGG + Intronic
1007799907 6:44383601-44383623 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1008682355 6:53886312-53886334 GTTTGATACTAGAAGTGTTTTGG - Intronic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1008843323 6:55931180-55931202 ATGTAAAATAAGAAGTGTGAAGG - Intergenic
1008922314 6:56855340-56855362 GTTTAATATTAGAAGTGTTTTGG - Intronic
1010751619 6:79621815-79621837 GTGAGATATAAGAAGTCTGCTGG + Intergenic
1012248326 6:96952282-96952304 GTTTAATATTAGAAGTGTTTTGG + Intronic
1014195946 6:118558307-118558329 GTTTAATATTAGAAGTGTTTGGG + Intronic
1014623140 6:123694130-123694152 ATGTGATGTTACATGTGTGATGG + Intergenic
1015995461 6:138991770-138991792 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1016278648 6:142386383-142386405 GTTTAATATTAGAAGTGTTTCGG - Intronic
1017032122 6:150233447-150233469 GTTTAATATTAGAAGTGTTTGGG - Intronic
1017102960 6:150864988-150865010 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1017940923 6:159052249-159052271 GTTTAATATTTGAAGTGTTATGG - Intergenic
1018655363 6:166029023-166029045 GTGGTATTTTAGAAGTGGGAAGG - Intergenic
1019947624 7:4342543-4342565 GTGTGTGATTTGAAGTGTGTGGG - Intergenic
1020682239 7:11251697-11251719 GTGTGAAATTAAAAATGTCAGGG + Intergenic
1021136630 7:16972359-16972381 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1023603270 7:41902007-41902029 GTTTGCTATTAGAAGTGTTTGGG - Intergenic
1023980928 7:45069584-45069606 GGGTGGTATTGCAAGTGTGAGGG - Intronic
1024049757 7:45610981-45611003 GGGTGATAGTGGAAGTGTGGAGG + Intronic
1028033889 7:85954734-85954756 GTGTTATATTAGAGGTATCATGG + Intergenic
1028655427 7:93200482-93200504 GTTTGATATTAGAAGTGTTTGGG - Intronic
1029860703 7:103568667-103568689 GTGTGATATTGGATGTCTGAGGG + Intronic
1032315830 7:130837398-130837420 GAATAATATAAGAAGTGTGATGG - Intergenic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1034325988 7:150233693-150233715 GTGTAATGTAAGAAGAGTGATGG - Intergenic
1034720290 7:153285791-153285813 ATGTGATATTATAAGGGGGAGGG - Intergenic
1034767221 7:153735565-153735587 GTGTAATGTAAGAAGAGTGATGG + Intergenic
1035975612 8:4307399-4307421 GTGTGATACGAGAATTGTGGTGG - Intronic
1036541121 8:9712511-9712533 TTGTGATATTAGGAATTTGAGGG - Intronic
1037187716 8:16084165-16084187 CTGTGATTTTAGAGATGTGATGG + Intergenic
1041118865 8:54566457-54566479 GTGTCATCTGAGAAGAGTGAAGG + Intergenic
1041125095 8:54628991-54629013 GTGTGATGTTAGTGCTGTGAGGG + Exonic
1041164321 8:55075657-55075679 GTTTAATATTAGAAGTGTTCTGG + Intergenic
1041520498 8:58750560-58750582 GTGTGAAATAAGAAATTTGATGG + Intergenic
1042470008 8:69176263-69176285 TTATGATATTAGAAATGTGGAGG - Intergenic
1042900605 8:73722894-73722916 GTTTAATATTAGAAGTGTTTTGG - Intronic
1043502136 8:80868822-80868844 GAGTGACATAAGAAGAGTGAGGG - Intronic
1043910256 8:85855724-85855746 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1044290336 8:90461310-90461332 GTGTGGTATTAAGAGTGTGATGG - Intergenic
1044375512 8:91465462-91465484 GTGTGTTACCAGAAGTGGGAAGG + Intergenic
1045158883 8:99513381-99513403 ATGTGATATTAGAGGTGAGAGGG + Intronic
1045192863 8:99900094-99900116 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1045327678 8:101128647-101128669 GTGTGATATAAGATGTGCGAAGG + Intergenic
1045768110 8:105700893-105700915 GTGTCATATTAGAACTGATAGGG - Intronic
1046279014 8:112000141-112000163 GTATGATATGAGAAATGTGAAGG + Intergenic
1046323432 8:112608883-112608905 GTTTTCTATTAGAAGTGTTAAGG - Intronic
1046621484 8:116533283-116533305 GTTTGATATTAGAAGTATTTTGG - Intergenic
1048046417 8:130777386-130777408 GTTTGATTTTAGAAATGTCAAGG - Intergenic
1049130534 8:140836128-140836150 GTTTAATATTAGAAGTGTTTTGG + Intronic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1055839632 9:80487334-80487356 CTGTGATATTTGAGGTGTGAAGG - Intergenic
1056827182 9:89884397-89884419 GTGTGGTTTTGGAAATGTGAGGG + Intergenic
1057108173 9:92441041-92441063 GTTTAATATTAGAAGTGTTTTGG - Intronic
1058247914 9:102653980-102654002 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1059827969 9:118053827-118053849 GTGGGATTTTAGGATTGTGAAGG - Intergenic
1060538792 9:124415271-124415293 GTGTGATACGAGAATTCTGAGGG - Intronic
1061059688 9:128244289-128244311 GTGTGAGATTGAAAGTGTGGGGG + Intronic
1186498143 X:10028800-10028822 GTTTAATATTAGAAGTGTTTAGG + Intronic
1186572383 X:10728883-10728905 TGGTGATATTAGAAGGGAGAAGG - Intronic
1188392845 X:29642304-29642326 GTGAGATTTCAGAAGTGAGAGGG + Intronic
1188526017 X:31088629-31088651 GTTTAATATTAGAAGTGTCTTGG + Intergenic
1190379123 X:49821368-49821390 CTGTGATATCAAAAGTGTGTAGG + Intergenic
1192293352 X:69821165-69821187 GTGTGTTCTTATAAGTGGGAGGG + Intronic
1193655188 X:84188874-84188896 GTGTGTTATCAATAGTGTGAAGG - Intergenic
1194718426 X:97312731-97312753 GTGGGATATGAGAGGAGTGAAGG + Intronic
1194726543 X:97404645-97404667 GTGTCATATTGGAAATGTTAGGG + Intronic
1195611916 X:106877255-106877277 GTGAGATAATAAATGTGTGATGG - Intronic
1195770556 X:108346734-108346756 GTTTAATATTAGAAGTGTTTTGG - Intronic
1195961736 X:110394211-110394233 GTTTAATATTAGAAGTGTTTGGG + Intronic