ID: 964386044

View in Genome Browser
Species Human (GRCh38)
Location 3:156149127-156149149
Sequence AGGGAGATCTTCGGACACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964386044_964386052 18 Left 964386044 3:156149127-156149149 CCCCAGTGTCCGAAGATCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 964386052 3:156149168-156149190 CTCAGAGACTTCTGTTAAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 256
964386044_964386051 17 Left 964386044 3:156149127-156149149 CCCCAGTGTCCGAAGATCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 964386051 3:156149167-156149189 TCTCAGAGACTTCTGTTAAAAGG 0: 1
1: 0
2: 3
3: 18
4: 254
964386044_964386053 19 Left 964386044 3:156149127-156149149 CCCCAGTGTCCGAAGATCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 964386053 3:156149169-156149191 TCAGAGACTTCTGTTAAAAGGGG 0: 1
1: 0
2: 0
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964386044 Original CRISPR AGGGAGATCTTCGGACACTG GGG (reversed) Intronic
900839463 1:5036221-5036243 AGTGAGACCTTTGGAAACTGAGG + Intergenic
903063887 1:20687664-20687686 AGGGAAAGCCTCGGACACAGAGG + Exonic
904031449 1:27536012-27536034 ATGGAGATGGTCGCACACTGAGG - Intronic
909895244 1:81061080-81061102 AACGAGTTCTTGGGACACTGAGG - Intergenic
915784627 1:158596669-158596691 AGGGAGCTCCTGGGAGACTGTGG + Intergenic
921504255 1:215947529-215947551 AGGCAGATCTTTGAACAATGAGG - Intronic
922414025 1:225403882-225403904 AGGGGGATCTTGGGAAGCTGGGG - Intronic
922657786 1:227401344-227401366 AGGGAGATCTTCCGCCCCTGAGG + Intergenic
922860786 1:228814507-228814529 ATGGAAAGCTTCAGACACTGAGG - Intergenic
1063869446 10:10401940-10401962 AGGGAGAGCTTCTGGAACTGGGG - Intergenic
1067901031 10:50241856-50241878 AGGGAGAACATCACACACTGGGG + Intronic
1069217131 10:65835295-65835317 TGGTAGATTTTCAGACACTGAGG - Intergenic
1072542539 10:96409361-96409383 AGAGAGCTCTGGGGACACTGGGG + Intronic
1073546923 10:104357317-104357339 AGGGGCATTTTAGGACACTGTGG + Intronic
1075222688 10:120598741-120598763 AGGGACACCTTCCGACACTGGGG + Exonic
1075846539 10:125549482-125549504 ATGGAGATCTTAGGACACTCTGG - Intergenic
1077676101 11:4194044-4194066 AGGGAGGCCTTCGAACACAGTGG - Intergenic
1077991332 11:7414851-7414873 AGGGAAAGCTTTGGACATTGAGG + Intronic
1081774792 11:45669795-45669817 AGAGAGGCCTTGGGACACTGTGG - Intergenic
1083846931 11:65340842-65340864 AGGGAGAAATTCTGACAGTGAGG - Intronic
1083966689 11:66047921-66047943 AGGGTGCTGCTCGGACACTGTGG + Intronic
1083983755 11:66195847-66195869 AAGGAGATCTGCAGACCCTGAGG + Intronic
1085159792 11:74329427-74329449 AGGGAGATATACGGCCACTCAGG + Intergenic
1085968928 11:81563697-81563719 AGGGAGAACATCACACACTGGGG - Intergenic
1096700707 12:53380713-53380735 AGGGAAATCTACGGAAAGTGGGG - Intronic
1101761852 12:107665177-107665199 AAGGAGAACATCAGACACTGGGG + Intergenic
1104237828 12:126956498-126956520 AGGGCCATCTTCAAACACTGAGG - Intergenic
1106558076 13:30827261-30827283 AGGGAGACCCTCGGAGACAGAGG - Intergenic
1110114602 13:71796838-71796860 AAGGACATCTACGGACACTTAGG + Intronic
1111052751 13:82906693-82906715 AGGCAGGTCTTCAGCCACTGAGG + Intergenic
1117028526 14:51646357-51646379 ATGGAGGTCTTGGGCCACTGAGG - Intronic
1117527130 14:56620107-56620129 AGGGAGAACAACAGACACTGGGG + Intronic
1123462448 15:20485591-20485613 AGGGAGCATTTCAGACACTGGGG + Intergenic
1123655612 15:22514813-22514835 AGGGAGCATTTCAGACACTGGGG - Intergenic
1124273137 15:28301561-28301583 AGGGAGCATTTCAGACACTGGGG + Intronic
1124309520 15:28610008-28610030 AGGGAGCATTTCAGACACTGGGG - Intergenic
1126787919 15:52193552-52193574 AGTGAGATCTGGGGACACAGTGG - Exonic
1130428794 15:83825681-83825703 AAGGTGATGTTTGGACACTGAGG + Intronic
1133224405 16:4333781-4333803 AGAGAGAGATTCGGACACAGAGG - Intronic
1133282015 16:4671964-4671986 AGGGAGATCTTGGCTCACTGTGG + Intronic
1133924055 16:10180247-10180269 AGCGCGAACTTCGAACACTGTGG - Exonic
1134757471 16:16680929-16680951 AGGGAGATCTCAAGACAATGTGG + Intergenic
1134988597 16:18678237-18678259 AGGGAGATCTCAAGACAATGTGG - Intergenic
1136692022 16:32039395-32039417 AGGGAGCGCTCAGGACACTGGGG + Intergenic
1136792569 16:32982837-32982859 AGGGAGCGCTCAGGACACTGGGG + Intergenic
1136877286 16:33871216-33871238 AGGGAGCGCTCAGGACACTGGGG - Intergenic
1138366551 16:56483359-56483381 AGGGAGGTCTTAGGGCAGTGGGG - Intronic
1138566231 16:57834969-57834991 AGGGAGATCCTTGGACATGGTGG + Intronic
1139594047 16:67947961-67947983 AGGGAGCTCTTGAAACACTGTGG - Intronic
1144038690 17:11389446-11389468 AGAGAGACTTTAGGACACTGAGG + Intronic
1146304806 17:31722731-31722753 AGGGAGAGCTTGGGGCACGGGGG + Intergenic
1148824644 17:50383475-50383497 AAGGAGAACTTAGGACCCTGAGG - Intronic
1150594766 17:66594202-66594224 AGGGAGATCCAAGGACACTGTGG + Intronic
1155621720 18:27786982-27787004 AGAGAGATCTTTGCACAATGGGG - Intergenic
1158428162 18:57358344-57358366 AGGGCTATGTTAGGACACTGAGG - Intronic
1160161833 18:76479459-76479481 AGGGACACCTTTGGACAATGGGG - Intronic
1161287998 19:3478710-3478732 TGGGAGACCTTCGGACTTTGAGG + Intronic
1162217277 19:9146975-9146997 AGGCAGATCTTCTAAAACTGAGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1166705557 19:44906135-44906157 ATGGAGATCTGAGGACACTGGGG - Intronic
925690078 2:6512706-6512728 ATGCAGATCTCCGCACACTGCGG + Intergenic
928183734 2:29090625-29090647 AGGAAGGTTTTGGGACACTGTGG - Intergenic
929319188 2:40520985-40521007 AGGGAGATCTGCGCAGCCTGAGG + Intronic
932818787 2:74882093-74882115 AGGGAGAAGTTAGGACACTGAGG - Intronic
933468378 2:82686510-82686532 AGAAAGATCTACCGACACTGGGG - Intergenic
941671949 2:168303553-168303575 AAGGGAATCTTCGTACACTGTGG - Intergenic
1172358202 20:34294229-34294251 AGGGAGAGCTTCGGGTAGTGGGG + Intronic
1172385277 20:34529857-34529879 TGGGAGCCCTTGGGACACTGTGG + Intronic
1172628030 20:36359845-36359867 TGGGAGTTCATCGGGCACTGGGG + Intronic
1175208584 20:57330788-57330810 AGGGAGAACTTGGGAGAGTGAGG + Intronic
1175321571 20:58091982-58092004 GGGGAGATGTTCCCACACTGGGG + Intergenic
1175539218 20:59737888-59737910 AGGGAGCACTTTGGCCACTGAGG - Intronic
1181575590 22:23792462-23792484 AGGGTGCTCTTCAGACACTCTGG + Intronic
1183347200 22:37314437-37314459 AGGGAGAGTTTCGTGCACTGTGG + Exonic
950129120 3:10529826-10529848 AAGGGGATCTTTGGACACAGAGG + Intronic
952860373 3:37807749-37807771 AGAGAGATCTAGGGACAGTGTGG + Intronic
954363229 3:50133349-50133371 CTGGGGATCTTGGGACACTGGGG + Intergenic
955589081 3:60514848-60514870 AAGGGTATCTTTGGACACTGAGG + Intronic
959948198 3:112149539-112149561 AGGGAGATCTCCAGACATTTGGG - Intronic
961465760 3:127080547-127080569 AGTGAGATCTTCGCAGACAGCGG - Intergenic
964386044 3:156149127-156149149 AGGGAGATCTTCGGACACTGGGG - Intronic
968537545 4:1144080-1144102 AGGGAGAGCTTAGAACACTGTGG + Intergenic
968537559 4:1144170-1144192 AGGGAGAGCTTAGGACACCATGG + Intergenic
968537988 4:1146769-1146791 GGGGAGAGCTTAGGACACTGTGG + Intergenic
968538117 4:1147669-1147691 AGGGAGAGTTTAGAACACTGTGG + Intergenic
978327640 4:107577038-107577060 ATGGAGATCTACGGGCAGTGGGG - Intergenic
981207009 4:142053979-142054001 AGGCAATTCTTAGGACACTGGGG + Intronic
985873847 5:2580262-2580284 AGAGAGATCTGCAGACACTCAGG - Intergenic
986027516 5:3864805-3864827 AGGCAGAGCTTCAGACACTAAGG - Intergenic
988116554 5:26899617-26899639 AGGGAGAACATCACACACTGGGG + Intronic
990180782 5:53157913-53157935 AGGGAGATCTTGGTAACCTGAGG - Intergenic
993689770 5:90985631-90985653 AAGCAGAGCTTCAGACACTGTGG - Intronic
995714619 5:115069803-115069825 AAGGAGATCTTCTGCCAATGAGG - Intergenic
1002945852 6:1760136-1760158 AGGGAGATGTGCAGACACAGAGG + Intronic
1005499987 6:26421397-26421419 AGGGAAATCTTGGGACACTGTGG + Intergenic
1006800883 6:36759018-36759040 AGGGAGAGATTGGGAAACTGAGG - Intronic
1008369555 6:50716501-50716523 AGGCAGGTATTCAGACACTGTGG + Intronic
1015150440 6:130031117-130031139 AGGGAGGTCTTAGGAGACAGGGG + Intronic
1015166787 6:130207794-130207816 TGGGAGATCTTGAGGCACTGAGG + Intronic
1017900994 6:158718466-158718488 AGGGAGCTCTGTGGACACAGAGG - Intronic
1019702244 7:2479660-2479682 AGGAAGCTCTGGGGACACTGAGG - Intergenic
1020280429 7:6647463-6647485 AGGGAGATCTTCTCTCACGGGGG - Intronic
1021769471 7:23984235-23984257 AGGCAGTTCTTTGGGCACTGGGG - Intergenic
1022232864 7:28430900-28430922 AGGGAGATCTTCCCCCACTGAGG - Intronic
1035091040 7:156310624-156310646 AAGGAAATCTTTGTACACTGTGG - Intergenic
1040347834 8:46526492-46526514 AGGGATATTTTGGGCCACTGAGG + Intergenic
1041021771 8:53645257-53645279 AGTGAGTTCTTCTCACACTGTGG + Intergenic
1043150102 8:76704837-76704859 AGGGACATCTTTGGACACACAGG - Exonic
1043292920 8:78626359-78626381 AGGGGAATCATCGTACACTGTGG - Intergenic
1045875433 8:106975902-106975924 ATGGAGATCTTCTGTCACTTAGG + Intergenic
1049494145 8:142921915-142921937 AGGGAGTTCATGGGACAGTGGGG - Intergenic
1052017697 9:23488449-23488471 AAGGAGAACTACAGACACTGGGG - Intergenic
1054783472 9:69187960-69187982 ATGGAGATCTTCTGAACCTGTGG + Intronic
1055213454 9:73828901-73828923 AGGGAAACCTTGGTACACTGTGG - Intergenic
1058813668 9:108664733-108664755 AAGGGGTTCTTAGGACACTGAGG - Intergenic
1192686443 X:73310814-73310836 GGGGAGAACTTCACACACTGGGG + Intergenic
1193472547 X:81925294-81925316 AGGAAGATCTTCTTCCACTGAGG + Intergenic
1198423562 X:136493139-136493161 AGGAAGAATTTCAGACACTGTGG - Exonic