ID: 964386786

View in Genome Browser
Species Human (GRCh38)
Location 3:156156055-156156077
Sequence CTCTGGCCCCTCTGGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964386781_964386786 18 Left 964386781 3:156156014-156156036 CCATGTAGACACGGCTGACTACC 0: 1
1: 0
2: 1
3: 5
4: 55
Right 964386786 3:156156055-156156077 CTCTGGCCCCTCTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 33
4: 337
964386782_964386786 -3 Left 964386782 3:156156035-156156057 CCTGTGTGTTTGACCTTAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 964386786 3:156156055-156156077 CTCTGGCCCCTCTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964386786 Original CRISPR CTCTGGCCCCTCTGGAGTTC AGG Intronic
900079480 1:844857-844879 CCCTGGCCCCTGTGGAGAGCCGG - Intergenic
900357192 1:2270670-2270692 CTCCAGCCCCTCTGGAGAGCAGG - Intronic
900605352 1:3521320-3521342 TTCTGGCCCCTGGGGAGTTTGGG - Intronic
901484147 1:9546765-9546787 CTGTGCTCCCTCTAGAGTTCAGG - Intronic
901698811 1:11032018-11032040 CCCTGGCCTCTCTTGAGTGCTGG - Intronic
903769309 1:25753970-25753992 CTCTTCCCCCGCTGGGGTTCCGG + Intronic
905634521 1:39540758-39540780 ATCTGGTCCCTCTTGAGTTGAGG - Intergenic
905657477 1:39694115-39694137 CTCTGGCCCCCTTGCAGTTCAGG - Intronic
906455580 1:45994200-45994222 CTCTAGCCCCTCTCCATTTCTGG + Intronic
907880824 1:58547889-58547911 GTCTGGCCCCTTTGGAAATCAGG - Intergenic
908238902 1:62172641-62172663 CTCTGGCCACACTGGAGGTCAGG - Intergenic
909264526 1:73539528-73539550 CTCTCCCCTCTCTGGAGTTGGGG - Intergenic
909713173 1:78674764-78674786 CTCTGTCCCCTCTGGAGACTGGG + Intergenic
909729396 1:78874227-78874249 TTCTGGCCCCTCTGGATCTAGGG - Intergenic
910655018 1:89610243-89610265 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
911663017 1:100524544-100524566 CTCTGGCCCATCTGGAACACTGG - Intergenic
911827744 1:102508746-102508768 CTATGGCCACACTGGAGGTCAGG + Intergenic
913073256 1:115319833-115319855 CTTTGACCCCTCAGGAATTCAGG - Intronic
913711496 1:121488470-121488492 CTCTGGCTCCTCTGGAATGAGGG + Intergenic
917410081 1:174750293-174750315 CTCTCCTCCCTTTGGAGTTCAGG - Intronic
919239152 1:194889413-194889435 CTCAGTCCCCTCTGGACTTTGGG + Intergenic
919263955 1:195237621-195237643 CTCAGCCCCCTCTGGACTTCAGG + Intergenic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
920874482 1:209821563-209821585 ATGTGGCACATCTGGAGTTCAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922141741 1:222894408-222894430 CTCAGTCCCCTCTGGACTTTGGG - Intronic
922246455 1:223803121-223803143 CTCTGGATTCTCTGGAGTTTGGG + Intronic
922516389 1:226211199-226211221 CTCTGCACCCTCAGGAGTTGGGG + Intergenic
923138532 1:231140374-231140396 CTCTGGCCCCCTTGAAGTTTGGG + Intergenic
923328101 1:232898452-232898474 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
924948761 1:248863776-248863798 CTCGGCCCCCTCTGGACTTTGGG + Intergenic
1062830430 10:601848-601870 CTGAGGCCCCTCTGGAGAACAGG - Intronic
1063028068 10:2202549-2202571 CCCTGCTCCCTCTGGAATTCAGG - Intergenic
1063181089 10:3600967-3600989 CTCTGGTCTCTCTGGAGGTCTGG - Intergenic
1064063913 10:12164137-12164159 GCCTGTTCCCTCTGGAGTTCAGG + Intronic
1065839100 10:29685750-29685772 CTCTCCTCCCTTTGGAGTTCAGG - Intronic
1067685960 10:48466217-48466239 CTGTGTCCCCTCCGTAGTTCGGG + Intronic
1070201238 10:74207984-74208006 CTCAGCCCCCTCTGGACTTTAGG - Intronic
1071274477 10:84040523-84040545 CTCTCCTCCCTTTGGAGTTCAGG - Intergenic
1072753260 10:97999467-97999489 CTCTTCCCCCTCTGGACTTTGGG + Intronic
1073727844 10:106255211-106255233 CTGTGGCCTCTCTGGATTTCTGG - Intergenic
1073845021 10:107544924-107544946 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1075132145 10:119748995-119749017 CTCAGCCCCCTCTGGACTTCGGG - Intronic
1076534534 10:131168316-131168338 CTGGGGCCCCTCTGCAGCTCCGG + Intronic
1076749723 10:132536851-132536873 CTCTGGCCCCTCCGGCGGCCAGG + Intergenic
1077118360 11:895596-895618 CTCTGGTCCCTCCTGAGCTCTGG - Intronic
1077125374 11:932761-932783 GTCTGGCTCCTCTGAAGGTCAGG + Intronic
1077541064 11:3146724-3146746 CTGGGGCCCCTCTGGGGTTTGGG + Intronic
1077902149 11:6498092-6498114 CTCTGGCCCCTCTGCTGGGCTGG + Exonic
1078266387 11:9758708-9758730 CTCGGGCCCCTGAGGATTTCCGG + Intergenic
1078315238 11:10289065-10289087 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1079182905 11:18209326-18209348 CTCTGCTCCCTCCGGAGCTCAGG - Exonic
1079184173 11:18221408-18221430 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1079449326 11:20585865-20585887 TTCTGACCCCTCTGAAGTTCAGG + Intergenic
1080333883 11:31174378-31174400 CTTGGGCCCCTCTGGACTTTGGG + Intronic
1081013616 11:37847586-37847608 CTGTGGCCCCTTTGGCATTCTGG - Intergenic
1082866391 11:57903591-57903613 CTCTTCTCCCTTTGGAGTTCAGG - Intergenic
1082993898 11:59233691-59233713 CCCTGGCCTCACTGGAGTTCTGG - Intergenic
1083088512 11:60175700-60175722 ATCTGTCCCCTCAGGAGGTCTGG + Intronic
1083404852 11:62449471-62449493 CGCTGGCCCCTCTCCAGCTCAGG - Intronic
1083741574 11:64714075-64714097 CTCGGGACCCTCTGCAGGTCAGG - Intronic
1083993042 11:66258228-66258250 CCCTGGCCCCTCCGGCGATCCGG - Intronic
1084328309 11:68414606-68414628 CTATGGCCCCTCTGGAGTACAGG + Intronic
1084804594 11:71570102-71570124 ATCTGCCCCCTCTGGCGTTGTGG + Intergenic
1084805859 11:71578526-71578548 GTCTGCCCCCTCTGGCGTTGTGG - Intergenic
1084956649 11:72695190-72695212 CTCAGGCCCTTCTGGAGTCCTGG + Intronic
1085029862 11:73264507-73264529 CTCTGGCTCCTCTGGGTTCCAGG + Intronic
1085335216 11:75688180-75688202 CTCCTGCCACCCTGGAGTTCCGG + Intergenic
1085496814 11:76978008-76978030 CTCCGCCCCCTCTGGACTTTAGG + Intronic
1085570158 11:77551888-77551910 TTCTGGCCCCTCTGGATCTAGGG - Intronic
1086322680 11:85666939-85666961 CTCTGGCCTCCCTTGAGTACAGG + Intronic
1086508350 11:87528888-87528910 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1086897649 11:92332254-92332276 CTCTGCTCCATCTGGATTTCGGG + Intergenic
1088598626 11:111457307-111457329 CCTTGGCCCCTCTGGAGATGGGG + Intronic
1088859605 11:113787354-113787376 CTGTGGGCCCTATGCAGTTCAGG + Intergenic
1089610186 11:119664600-119664622 CCCTGGCCCCCCAGGAGTTCGGG + Exonic
1089616830 11:119699521-119699543 CTCTGGCCCCTCTGGCGGGCAGG + Intronic
1091906544 12:4194136-4194158 CTCTGGCCCTTTGGGAGCTCAGG - Intergenic
1096638294 12:52975111-52975133 ATCTGGCCCCTCTGCAACTCAGG - Intergenic
1096672924 12:53210946-53210968 CCCTGGCCCCTCTGTAGTGTAGG + Exonic
1097116617 12:56702031-56702053 CTCTCTTCCCTTTGGAGTTCTGG + Intergenic
1098378099 12:69838750-69838772 CTCTGGCCTTTCTGGAAGTCTGG - Intronic
1099682273 12:85844148-85844170 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1101963131 12:109264903-109264925 CTATGGCCAGTCTGGAGTCCTGG + Intronic
1102035911 12:109770305-109770327 TCCTGGCCCCTCTGGCGCTCTGG + Exonic
1103897993 12:124286534-124286556 CTCTGCCCTTTCTGGAGCTCCGG + Intronic
1106379474 13:29222929-29222951 CTCGGCCCCCTCTGGACTTTGGG + Intronic
1107853398 13:44591937-44591959 CTCGGCCCCCTCTGGATTTTGGG + Intergenic
1108017065 13:46086823-46086845 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1108298870 13:49054073-49054095 CTCTCCTCCCTTTGGAGTTCAGG - Intronic
1108542482 13:51456708-51456730 CTCAGTCCCCTCTGGACTTTGGG - Intergenic
1109762261 13:66845287-66845309 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1111241170 13:85476629-85476651 CTGTGGACCCTTTGGAGTCCTGG + Intergenic
1111337293 13:86840424-86840446 CTCAGGCCCCTGTGGACTTTGGG - Intergenic
1112394221 13:99013803-99013825 CTCTGGACCTTCTGCAGCTCAGG - Intronic
1112533127 13:100224120-100224142 CTCTGGCCCCACAGGAGCCCAGG + Intronic
1113767665 13:112891061-112891083 GCCTGGCGCCTCTGCAGTTCTGG - Intergenic
1113916259 13:113875746-113875768 CTCTGGGCACTCTAGATTTCAGG - Intergenic
1116961602 14:50973255-50973277 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1117930834 14:60838938-60838960 CTCAGCCCCCTCTGGACTTTGGG + Intronic
1118235174 14:63996502-63996524 CTCCAGCCCCACTGGAGTTCTGG + Intronic
1119036121 14:71231586-71231608 CTCGGCCCCCTCTGGACTTTAGG + Intergenic
1119462204 14:74815890-74815912 TTCTGGCTCCTCTTGATTTCTGG + Intronic
1119657654 14:76428926-76428948 CTCTGCACGCTCTGGAGCTCAGG - Intronic
1121657017 14:95604657-95604679 CACTTGACCTTCTGGAGTTCAGG + Intergenic
1122965354 14:105121535-105121557 CTCTGGTCCCTCTGGACATTAGG + Intergenic
1123008667 14:105336625-105336647 CTCTGGCCCCGCTGGAGCATGGG - Intronic
1123108251 14:105852888-105852910 CTCTTGGCCCTTTGGAGTCCTGG - Intergenic
1123947555 15:25246130-25246152 CTCTGGACCCCCTCGTGTTCAGG - Intergenic
1125488219 15:40127078-40127100 CTCTGCCCCCTCTGGATATTAGG - Intergenic
1126344587 15:47679516-47679538 CTCTGGCCCCTCGGCAGCCCTGG + Intronic
1126849644 15:52789328-52789350 CTCTCGCCCCTCTCCAGCTCCGG - Exonic
1127919118 15:63479550-63479572 CTCTGACCCCTCCTGAGTGCAGG + Intergenic
1128336353 15:66788227-66788249 CTCTGGCCCATTTGGAGGTTTGG + Intergenic
1131568358 15:93506605-93506627 CTCAGTCCCCTCTGGACTTTGGG - Intergenic
1131605748 15:93900946-93900968 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1131698203 15:94903183-94903205 CTCTTCTCCCTCTGGATTTCAGG - Intergenic
1134234439 16:12454459-12454481 CTATGTCACCTCTAGAGTTCTGG - Intronic
1137569980 16:49558987-49559009 CTGTGGCCCCTAAGGAGCTCAGG - Intronic
1138262670 16:55636475-55636497 GTCTGGCCACTCTTGAGTTTTGG - Intergenic
1138584446 16:57960910-57960932 CACTGGCCCCTCTGCAGGCCTGG - Exonic
1138925157 16:61581595-61581617 CTCAGCCCCCTCTGGACTTTAGG - Intergenic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1139823933 16:69742277-69742299 GTCTGGCCGCCGTGGAGTTCCGG - Exonic
1141124649 16:81392542-81392564 CTCTGCCCACTCTGGAGTTGGGG + Intergenic
1141254060 16:82384446-82384468 CTCTGGGCTGTCTGTAGTTCTGG + Intergenic
1142425647 16:90000928-90000950 CTCTGGCCCCTGTGGTGCTGAGG + Intergenic
1142473593 17:177172-177194 CTCTGTCCCCCCTGCAGTGCCGG - Intronic
1142648232 17:1329100-1329122 CAGTGGGCCCTCTGGAGTACTGG - Intergenic
1143143056 17:4753797-4753819 CCCTGGCCACTGTGGACTTCTGG - Intergenic
1143164716 17:4892181-4892203 CTCCGGCCCCACTGGTGTTAAGG - Exonic
1143329338 17:6121948-6121970 CACTGGCCTCTGTGGAGGTCAGG + Exonic
1143733910 17:8897107-8897129 CTCCAGCCTCTCTGGAGTCCAGG - Intronic
1144107251 17:11997318-11997340 CGCTGGCCCCTCCGTAGCTCCGG + Exonic
1144389926 17:14784183-14784205 CTCGGCCCCCTCTGTACTTCAGG + Intergenic
1145005195 17:19333657-19333679 CCCTGGCTCCTCTGCAGTGCTGG - Intronic
1145309092 17:21691783-21691805 CGCTGGGCCCTCTGGAGCCCAGG - Intergenic
1145750206 17:27349702-27349724 CTCGGGCCCCTCTGCACTTTTGG + Intergenic
1145905260 17:28512773-28512795 CCCTGGCTACTCTGGAGTCCAGG - Intronic
1147716733 17:42513711-42513733 TTCTGGCCCCTCCAGAGTTGAGG + Intronic
1148354973 17:46969484-46969506 CTCTGGCCCCTCTGCAGGGTGGG - Intronic
1148899542 17:50865947-50865969 CCCTGGGCCCTCGGGAGCTCGGG - Intronic
1149974529 17:61252501-61252523 CTCCGGCCCCTCTGGAGCCCTGG - Intronic
1150201582 17:63362606-63362628 CTCAGTCCCCTCTGGACTTTGGG - Intronic
1151189683 17:72389080-72389102 CTCTGGCCGCTCTGCACTCCTGG + Intergenic
1151991918 17:77580745-77580767 CTCCGGCTGCTCTGGAGTGCAGG + Intergenic
1152165461 17:78701988-78702010 CTGTAGCCCCACTGGAGTTGAGG - Intronic
1152225162 17:79089511-79089533 CCCTGTCCCCTCTGCTGTTCCGG - Intronic
1152901393 17:82943043-82943065 ATGTGGCCCCTCTGCAGTGCAGG + Intronic
1155182247 18:23358070-23358092 CTCTGGCCACTCTCTAGGTCTGG - Intronic
1155497955 18:26461090-26461112 CTCTAGCCCATCTGGACATCAGG - Intronic
1155841307 18:30646241-30646263 CTCTGGCTTCTCTGCAGATCTGG - Intergenic
1156384879 18:36595644-36595666 CTCTGGGCCAGCTGGAGTGCTGG - Intronic
1157297744 18:46458235-46458257 CTCTGCTCCCTTTGGGGTTCAGG - Exonic
1157506612 18:48230994-48231016 CTCGGCCCCCTCTGGACTTTGGG + Intronic
1158080118 18:53579915-53579937 TTCTGGCCTCTATGTAGTTCCGG + Intergenic
1158640311 18:59197981-59198003 TTCTGGCCCCTTCGAAGTTCAGG - Intergenic
1158787987 18:60739655-60739677 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1160686341 19:438667-438689 TCCTGGCCCCTCTGGGGGTCTGG + Intronic
1160779154 19:870185-870207 CTCTGGCCCCCCTGGATGTCAGG - Intronic
1160970483 19:1765738-1765760 CCCTGGCCTCTCTGGACATCAGG - Intronic
1160993904 19:1873115-1873137 CTGAGGGCCCTCTGGGGTTCTGG - Intergenic
1161029788 19:2052215-2052237 CTCCAGCCCCTCTTGAGCTCAGG - Intergenic
1161578225 19:5066523-5066545 ACGTGGCCCCTCTGGAGTTGGGG - Intronic
1161737835 19:6002512-6002534 CTCAGGGCCCTCTGGCGTCCAGG - Intronic
1161780118 19:6286287-6286309 CTCAGCCCCATCTGGACTTCGGG + Intergenic
1163065033 19:14786371-14786393 CTCAGGCCCCCCAGGAGTTTCGG - Intergenic
1165985950 19:39769011-39769033 CTCTTGCCTCCCTGGAGGTCGGG + Intergenic
924979854 2:209701-209723 CTCAGGCCACTCTGCAGTGCAGG - Intergenic
925894191 2:8458698-8458720 CTCTGGCCCATGTGGGGTGCGGG - Intergenic
926230978 2:11003574-11003596 CCCTGGTCCCTCTGAAGCTCTGG - Intergenic
926318695 2:11732363-11732385 CTGTGGACCCTTTGGACTTCTGG + Intronic
927226120 2:20767466-20767488 CTCAGTCCCCTCTGGACTTCGGG + Intronic
928723679 2:34147892-34147914 CTCTGTCCCCTCTGGACTTTGGG - Intergenic
931086922 2:58842622-58842644 CTCTGGAATCTCTGGATTTCAGG + Intergenic
932599140 2:73112253-73112275 CACTGGCCCGGCTGAAGTTCGGG + Intronic
933774544 2:85764265-85764287 CTCTGGCCCCTTCAGAATTCTGG - Intronic
934131222 2:88951034-88951056 CTCTCTTCCCTTTGGAGTTCAGG + Intergenic
935471097 2:103461949-103461971 CCCTGACCCCTCTGGAATTTTGG - Intergenic
935518814 2:104078532-104078554 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
937167739 2:119836849-119836871 CTCGGCCCCCTCTGGACTTTGGG + Intronic
937799147 2:126060941-126060963 CTCCTGCCTCACTGGAGTTCTGG + Intergenic
940398765 2:153222681-153222703 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
940422874 2:153499653-153499675 CTCAGCCCCCTCTGGAATTTGGG - Intergenic
943396224 2:187338674-187338696 CTCTGCCCCTTCTGGACTTTGGG - Intergenic
944901876 2:204223720-204223742 CTCGGACCCCTCTGGACTTTAGG - Intergenic
945111335 2:206362928-206362950 CTCTCCTCCCTCTGGAATTCAGG + Intergenic
945770450 2:214035481-214035503 CTCAGCCCCCTCTGGACTTTGGG - Intronic
945891561 2:215436109-215436131 CTCCCGCCCCTCTGGAGGCCCGG + Exonic
946328184 2:218995736-218995758 CTCTCCCACCTCTGAAGTTCTGG + Intergenic
946872906 2:224100903-224100925 CTCTGAGCCCTTTGGAGATCTGG - Intergenic
947181297 2:227413690-227413712 CTCTGGCCCCTCAGCAGTGTTGG - Intergenic
947277643 2:228411596-228411618 CTCTGGCCCCACTGGCCTCCTGG + Intergenic
947711337 2:232318118-232318140 CTCTGGCCTCTGTGGAGGCCTGG - Intronic
947876750 2:233472730-233472752 CTCTGGCCATTCAGGACTTCAGG + Intergenic
948449148 2:238058180-238058202 TTCTGGGCCAGCTGGAGTTCCGG - Intronic
948803773 2:240444317-240444339 CTCTCGCCCCACAGAAGTTCAGG + Intronic
949036948 2:241820223-241820245 CACAGGCCTCTCTGGGGTTCTGG + Intergenic
1168983462 20:2027103-2027125 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1172082181 20:32350803-32350825 CTCCTGCCCCTCTGGACTGCTGG + Intergenic
1172346990 20:34209691-34209713 CTTGGGCCCCTCTGGATTTGGGG + Intronic
1173485756 20:43439768-43439790 CTCTGGCCCCTCTTGGACTCTGG - Intergenic
1174829625 20:53800696-53800718 GTTTGGACCCTCTGGAATTCTGG - Intergenic
1175222809 20:57426996-57427018 CTCTGGCCCCTGGGAAGGTCGGG + Intergenic
1175969128 20:62675087-62675109 CTCTGTCCTCTCTGCAGCTCGGG - Intronic
1176408346 21:6434079-6434101 CTCGGCCCCCTCTGGACTTTGGG + Intergenic
1179221655 21:39413180-39413202 CTCTGGCCCCTCTCTAGAGCTGG - Intronic
1179558410 21:42195237-42195259 CTCAGGCCCCTCAGGAGAGCTGG + Intergenic
1179622587 21:42627034-42627056 CTCTGGCCCCTCTGCATTGCTGG - Intergenic
1179622618 21:42627228-42627250 CTCTCTCCTCTGTGGAGTTCAGG + Intergenic
1179679130 21:43005651-43005673 GTCTGGCCCCTCTGGACCCCAGG + Intronic
1179683839 21:43042405-43042427 CTCGGCCCCCTCTGGACTTTGGG + Intergenic
1180035301 21:45245266-45245288 CACTGGCCCCTGTGCATTTCTGG + Intergenic
1180042761 21:45288393-45288415 CTCTCGCCCCTCTGGAGCTGGGG + Intergenic
1180148562 21:45935692-45935714 CCCTGGCCCCTCAGGAGGTTTGG + Intronic
1180657659 22:17436843-17436865 CTCTTGCGCCTCTGGCTTTCAGG + Intronic
1180669418 22:17541895-17541917 GTATGGCTCCTCTGGAGTCCCGG + Exonic
1181273216 22:21672970-21672992 TTCTGGCCCTTGTGGTGTTCTGG + Intronic
1183316853 22:37141731-37141753 CTCGGCCCCCTCTGGACTTTAGG + Intronic
1184036287 22:41919860-41919882 CTCTGCGCCCTCGGGAGTCCGGG - Intergenic
1184354369 22:43969170-43969192 CTCAGGCCCCCGTGGAGTCCAGG - Intronic
1184405922 22:44300790-44300812 TGCTGGCCCATCTGGGGTTCTGG - Intronic
1184648090 22:45906990-45907012 CGCCAGCCCCTCAGGAGTTCAGG + Intergenic
1185182183 22:49369835-49369857 CTCAGGCCCATCTCGAGTCCCGG - Intergenic
1185237270 22:49721469-49721491 CTCTGGGTCCCCTGGAGTTCAGG - Intergenic
951718523 3:25674083-25674105 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
952408483 3:33026349-33026371 CTCAGCCCCCTCTGGACTTTGGG + Intronic
952974083 3:38679343-38679365 CTCTGACCCCTATGGGGTTTGGG - Intergenic
954109980 3:48428542-48428564 CTATGGCCCCTCTGCAGGTGCGG - Intronic
954135006 3:48578452-48578474 CTCTGGTCCCCCTGGATTACCGG - Exonic
954497972 3:50983127-50983149 CTCGGCCCCCTCTGGACTTTGGG + Intronic
954875993 3:53803581-53803603 CTCTGGCTCCTGTGGAGAGCGGG + Intronic
955186392 3:56718972-56718994 TTGTGGGCCCCCTGGAGTTCCGG + Intergenic
956127219 3:66022037-66022059 CTCTTTCCCCTCTGGAATTCAGG + Intronic
957136333 3:76294013-76294035 CTCGGCCCCCTCTGGACTTTGGG - Intronic
957278073 3:78114852-78114874 CTATGGCCTCTCTGGAGTAAAGG - Intergenic
957419702 3:79951693-79951715 TTCTGGGCCAGCTGGAGTTCCGG - Intergenic
957459436 3:80497632-80497654 CTCAGACCCCTCTGGACTTTAGG - Intergenic
957614000 3:82505564-82505586 CTCGGCCCCTTCTGGACTTCAGG + Intergenic
957923025 3:86771989-86772011 CTCGAGCCCCTCTGGACTTCGGG + Intergenic
958675630 3:97265406-97265428 CTCGGACCCCTCTGGATTTTGGG - Intronic
959037416 3:101383686-101383708 CTCAGCCCCCTCTGGACTTTGGG + Intronic
960092599 3:113656699-113656721 CTCTGGCCTGTGTGGAGTACAGG + Exonic
962641271 3:137389333-137389355 GTCTGGCTCTTCTGGAGTTGGGG - Intergenic
963805093 3:149714536-149714558 CTCTGCCCTCTCTGGACTTTGGG + Intronic
964222649 3:154364846-154364868 CTCTGGCAGTTCTAGAGTTCTGG + Intronic
964386786 3:156156055-156156077 CTCTGGCCCCTCTGGAGTTCAGG + Intronic
966293791 3:178393382-178393404 CTCTTCCCTCTCTGGAGTTATGG - Intergenic
966896282 3:184447640-184447662 CTCTGGCACCTCTGAAATCCAGG - Intronic
968086330 3:195875599-195875621 CTCAGTCCCCTCTGGACTGCTGG - Intronic
968512825 4:1002968-1002990 CTCTGGCCCCGCTGGGGCTCTGG + Intronic
968630499 4:1648447-1648469 CCCTGGCCCCTCAGGAGTCTTGG + Intronic
968731311 4:2270585-2270607 CTCTGGATGCTCTGGAGGTCTGG + Exonic
969025859 4:4171777-4171799 CTCTTGCCCCCCTGGATTTTAGG - Intergenic
969675430 4:8611803-8611825 GTCTGGCACTGCTGGAGTTCGGG - Intronic
971659546 4:29394418-29394440 CTCTTTCCTCTCTGGAGTTTGGG + Intergenic
971899000 4:32634308-32634330 CTCTTGCCCTTCTGCATTTCTGG - Intergenic
972740427 4:41881949-41881971 TTCTGGCCCTTCTGGGGGTCTGG - Intergenic
972954975 4:44377575-44377597 CTCTGGCCCTTCTTTAGTTCTGG - Intronic
973037071 4:45420201-45420223 CTGTGGGCCAGCTGGAGTTCCGG + Intergenic
974686875 4:65242321-65242343 CTCAGCCCCCTCTGGACTTCGGG - Intergenic
975498262 4:75057756-75057778 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
978149416 4:105415374-105415396 CTCGGCCCCCTCTGGACTTTTGG - Intronic
978184088 4:105836608-105836630 CTCAGCCCCCTCTGGACTTTGGG - Intronic
978248620 4:106604522-106604544 CTCGGCCCCCTCTGGACTTTGGG - Intergenic
979001936 4:115232496-115232518 GTCTGGCCCTTCTGCATTTCTGG + Intergenic
979458744 4:120955715-120955737 CTCTGGCCCCTTAGAATTTCTGG - Intergenic
979552521 4:122007187-122007209 CTCTGGCCCCTCTTAAGACCTGG + Intergenic
980282223 4:130736815-130736837 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
980502044 4:133668701-133668723 CTCTGGGTCATCTGGAGTCCTGG + Intergenic
980744916 4:137000934-137000956 CTCAGTCCCCTCTGGAATTTGGG + Intergenic
980866808 4:138561974-138561996 GTCTGGCCGCCGTGGAGTTCCGG + Intergenic
981274588 4:142883789-142883811 CTCAGGCCCCTCTGGAGTGAAGG + Intergenic
982109645 4:152041861-152041883 CTCTGGAACCTCGAGAGTTCTGG - Intergenic
982126427 4:152187846-152187868 CTCTGGCCACAGTGGAGTTGAGG - Intergenic
982318773 4:154058235-154058257 TTCTGGCCCCTCTGGGGCTAGGG - Intergenic
985228579 4:187789611-187789633 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
985629794 5:1008562-1008584 CTCAGGCTCCTCTGGAATTGGGG + Intergenic
987182648 5:15384432-15384454 CTCTGGCCCCTGGGGATCTCTGG + Intergenic
990923532 5:60994080-60994102 CTCAGCCCCCTCTGGATTTTGGG - Intronic
991036262 5:62130913-62130935 CTCTTCCCTATCTGGAGTTCAGG - Intergenic
994908409 5:105869342-105869364 CTCTGTCCCTGCTGGAGTTATGG + Intergenic
994916158 5:105982627-105982649 CTCGGGCCCCTTTGGACTTTGGG + Intergenic
998367838 5:141642337-141642359 CTTTGCCCCCTTTGGAGTCCTGG - Intronic
998449831 5:142225735-142225757 CTCTGGCCCCACTGAGGTCCAGG + Intergenic
1000143735 5:158432634-158432656 GTCTGTCTCCTCTGCAGTTCAGG + Intergenic
1001827397 5:174756538-174756560 TTCCTGTCCCTCTGGAGTTCAGG + Intergenic
1002177551 5:177409796-177409818 CTCTGGGTCCTGTGGAGATCAGG + Intronic
1002465724 5:179407517-179407539 CTCTGGGTTCTCTGGTGTTCAGG - Intergenic
1002560088 5:180075492-180075514 CTCGGGCCCCACTGGAGTTCTGG - Intergenic
1002652644 5:180712732-180712754 CTCTCCTCCCTTTGGAGTTCAGG + Intergenic
1003847079 6:10184557-10184579 CTCTGGTCCCTCAGAAGTTTAGG + Intronic
1004156845 6:13176987-13177009 TTCAGGACCCTCTGGAGTTTAGG - Intronic
1006155578 6:32011270-32011292 CCTTGACCCCTCTGCAGTTCTGG - Intergenic
1006161910 6:32044124-32044146 CCTTGACCCCTCTGCAGTTCTGG - Exonic
1008330707 6:50240960-50240982 CTCGGCCCCCTCTGGATTTTGGG - Intergenic
1008494436 6:52118355-52118377 ATCTGTCCCCTATGCAGTTCAGG - Intergenic
1008940592 6:57041388-57041410 CTCTAGACCCACTGGAGCTCAGG + Intergenic
1009534358 6:64861226-64861248 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1009684246 6:66936132-66936154 CTCTGGCCTCTCTGCACTCCTGG + Intergenic
1010240899 6:73614606-73614628 CTCTCCCCTCTCTGGAGTTTGGG - Intronic
1010639640 6:78308399-78308421 CTCTGGACCCACTGGGGGTCTGG - Intergenic
1012052338 6:94361564-94361586 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
1013462562 6:110389244-110389266 CACTGGCTCCTCTGGGTTTCGGG + Intergenic
1018909824 6:168095559-168095581 CAAAGGCCCCTCTGGGGTTCTGG - Intergenic
1019206483 6:170365953-170365975 CTCTGTCCCCTTTGCATTTCTGG - Intronic
1019831547 7:3335937-3335959 CTGTGGCCACTCTAGAGTCCTGG + Intronic
1022104057 7:27185798-27185820 CTCTGGCCCCGAAGGGGTTCCGG - Intergenic
1023608228 7:41948630-41948652 GTCTGTCCCCTGTGGAGCTCAGG + Intergenic
1023824161 7:43997633-43997655 CTGTGGCCCCTCTGGGAGTCTGG - Intergenic
1023964616 7:44956552-44956574 CTCTGACCCTTCTGGGGCTCAGG + Intergenic
1024594694 7:50922287-50922309 CCCTGGCCACCCTGGAGTTGAGG + Intergenic
1027327937 7:77062800-77062822 CTCTGGCCCCTCTGGGAGTCTGG + Intergenic
1028676480 7:93469205-93469227 CTCTGGACCCTCTGTAGGTCAGG - Intronic
1029752426 7:102550962-102550984 CTGTGGCCCCTCTGGGAGTCTGG - Intronic
1029770378 7:102650055-102650077 CTGTGGCCCCTCTGGGAGTCTGG - Intronic
1029960772 7:104687447-104687469 CTCTCTCCCCTCTGGAGGTAGGG + Intronic
1029973828 7:104814732-104814754 ATCTGCCCCCTCTGGAATTTGGG - Intronic
1030727729 7:112945632-112945654 CTCTGATCCTTCTGGAGATCTGG + Intergenic
1031859042 7:126957662-126957684 CTCAGCCCCCTCTGGACTTTGGG + Intronic
1032177859 7:129647279-129647301 CTCTGGCCTCTCGGGATTACGGG + Intronic
1032591249 7:133194116-133194138 CTTGGCCCCCTCTGGAGTTTGGG - Intergenic
1032858170 7:135854230-135854252 CCCTGGCCCTTCAGGAGCTCAGG - Intergenic
1033643698 7:143285568-143285590 CACTGGCATCTCTGGAATTCAGG - Intronic
1034267665 7:149789087-149789109 TTCTGGTCCCTCTGGGGTTCAGG + Intergenic
1035057300 7:156044081-156044103 CTCTGGCTCCTCCTGAGTTTCGG + Intergenic
1035105695 7:156440275-156440297 CTCTGGCCCCGCCAGAGTTAGGG + Intergenic
1035252453 7:157606084-157606106 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1036503145 8:9331779-9331801 GTCTGGCCCCTTTGGGGTTTTGG + Intergenic
1036915508 8:12799932-12799954 CTCGGCCCCCTCTGGACTTTGGG - Intergenic
1037031326 8:14109114-14109136 CTTTGACCTCTCTGGAGTTAGGG + Intronic
1037150187 8:15626779-15626801 CTCAGTCCCCTCTGGACTTTCGG + Intronic
1037434827 8:18851452-18851474 CTCTGTCTCCTCAGGACTTCAGG + Intronic
1038820551 8:30948131-30948153 CTCTCCCCTCTCTGGAGGTCGGG - Intergenic
1039258871 8:35749022-35749044 CTGTGGCCTCTGTGGAGTTAGGG + Intronic
1039830635 8:41211133-41211155 CTTTGGACCCTCAGGAGGTCAGG + Intergenic
1041435212 8:57831795-57831817 CCCTGACACCTCTGGAATTCAGG - Intergenic
1043109584 8:76162930-76162952 TTCTGGCCCCTCTGTAGCTTGGG - Intergenic
1043395504 8:79831909-79831931 CCCTGGCCCATTTGCAGTTCAGG - Intergenic
1044409485 8:91867972-91867994 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1044525017 8:93241830-93241852 CTTGGCCCCCTCTGGACTTCGGG - Intergenic
1045371312 8:101525927-101525949 CTCTTGCCCAGCTGGAGTGCAGG - Intronic
1045873319 8:106950146-106950168 CTCGGTCCCCTCTGAACTTCGGG + Intergenic
1045887994 8:107122801-107122823 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1046503806 8:115111721-115111743 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1048655771 8:136534186-136534208 CTCTCTTCCCTTTGGAGTTCAGG + Intergenic
1048693114 8:136989745-136989767 CTCGGCCCCCTCTGGACTTTGGG - Intergenic
1052691396 9:31820777-31820799 CTCAAGCCCCTCTGGACTTTGGG + Intergenic
1053516823 9:38737501-38737523 CTCAGGCCCCTCTGGAGCTGAGG + Intergenic
1055300454 9:74877379-74877401 CTCAGGGCCCACTGGAGTCCAGG - Intronic
1055665131 9:78545556-78545578 TTCTGGGCCCTCTAGAGTTGGGG + Intergenic
1057702898 9:97376436-97376458 CTGTGGCCTCTCGGGAGCTCAGG - Intronic
1062691535 9:137844695-137844717 CTCTGGCCCCTCTGGGTCTAGGG - Intronic
1186741829 X:12526341-12526363 CTCTGGCTGCTCTAGATTTCAGG - Intronic
1188061119 X:25603272-25603294 CTCTCCTCCCTTTGGAGTTCAGG + Intergenic
1189200799 X:39194131-39194153 CTCTGGGACCTCTGGAGCTGGGG + Intergenic
1190127858 X:47722266-47722288 CTCTGGCCCCTGGTGAGTCCAGG + Intergenic
1190621053 X:52287572-52287594 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
1191184198 X:57592421-57592443 CTCTCGCCCCCCTGGAGCCCCGG - Exonic
1192244378 X:69360579-69360601 CTCTTGCCCCTCTGCAATCCAGG - Intergenic
1193554095 X:82932361-82932383 CTTGGTCCCCTCTGGAGTTTGGG + Intergenic
1194142527 X:90222799-90222821 CTCTGGCCACTCTGGCCTCCAGG - Intergenic
1195564368 X:106323873-106323895 CTCTGGACCCTCTGGGGCCCAGG - Intergenic
1197941636 X:131795942-131795964 CCCTGGCCCCTGTCGAGTGCAGG - Intergenic
1198189430 X:134287876-134287898 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1199565433 X:149210927-149210949 CCCTGGCCCCTTTGGTGGTCTGG - Intergenic
1199721313 X:150544559-150544581 CCCTGGCCCCTCTGGACTCCAGG + Intergenic
1200465364 Y:3509416-3509438 CTCTGGACCCACTCGAGGTCTGG + Intergenic
1200488282 Y:3791900-3791922 CTCTGGCCACTCTGGCCTCCAGG - Intergenic
1200752148 Y:6956307-6956329 CACTGTCCCCTCTGGAGTCATGG + Intronic
1201296922 Y:12471643-12471665 CACTGTCCCCTCTGGAGTCATGG - Intergenic
1202330420 Y:23746223-23746245 CTCTGGCCAGGCTGGAGTGCAGG - Intergenic
1202540349 Y:25923838-25923860 CTCTGGCCAGGCTGGAGTGCAGG + Intergenic