ID: 964389556

View in Genome Browser
Species Human (GRCh38)
Location 3:156183269-156183291
Sequence GAGGTGAGGGCTTTGAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964389556 Original CRISPR GAGGTGAGGGCTTTGAGAAG GGG Intronic
900238427 1:1603466-1603488 GTCGTGAGGGCCATGAGAAGCGG - Intergenic
901075526 1:6552576-6552598 GAGGTCAGGAGTTTGAGATGTGG - Intronic
901477248 1:9498500-9498522 GAGGCGAGGAGTTTGAGAACAGG - Intergenic
902206711 1:14873649-14873671 CAGTGGTGGGCTTTGAGAAGAGG + Intronic
903179894 1:21599840-21599862 CAGGAGAGGGTTTTGAGCAGGGG - Intronic
903606780 1:24580670-24580692 GAGGTCAGGGGTTTGAGACCAGG - Intronic
903806490 1:26009381-26009403 GAGGCGAGGGCCTGGAGGAGAGG + Intergenic
904203785 1:28839288-28839310 GAGGAGAGGGCCGTGTGAAGAGG - Intronic
904407220 1:30300193-30300215 CAGCTGAGGGCTTTAGGAAGGGG + Intergenic
904606828 1:31702583-31702605 GTGATGAGGGCTTAAAGAAGAGG + Intronic
904688118 1:32275038-32275060 GAGATCTGGGCTTTGAGAAGGGG + Exonic
904688422 1:32276250-32276272 TAGATGGGGGCTTGGAGAAGTGG + Intronic
904942121 1:34171184-34171206 GAGCTGAGGGATTTGGGAATAGG - Intronic
905141471 1:35848586-35848608 GAGGTGATGCCTTGGAGAAAAGG - Intronic
905274755 1:36810028-36810050 GAGGAGATGGGGTTGAGAAGGGG - Intronic
905435210 1:37951103-37951125 GAGGTGGGGGCTCTGAGGAATGG + Intergenic
906209570 1:44004933-44004955 GTGGTGAGTGCCTTGAGAACAGG + Intronic
906225625 1:44119046-44119068 GAGGGGAGGCCTTGGAGGAGAGG + Intronic
906516033 1:46439375-46439397 GAGCTCAGGGCTTGGTGAAGTGG + Intergenic
906547040 1:46627147-46627169 GAGGTGAGGGTAGTGAGAAGAGG + Intergenic
906710443 1:47925865-47925887 GAGGAGAGGGATTAAAGAAGAGG + Intronic
907041941 1:51269187-51269209 AAGGTGAGGGCTTGGGGATGGGG + Intronic
907324179 1:53626149-53626171 GAGGTGTGGGCTTGTAGCAGAGG - Intronic
907462604 1:54614206-54614228 TATGTGAGGGCTGTGAGCAGCGG + Intronic
908319016 1:62963204-62963226 GAGGTGAGGGGCCTGAGAACAGG + Intergenic
909076091 1:71052399-71052421 GAGGTGACGCCTTTAAGAGGTGG + Intergenic
911669366 1:100591159-100591181 GAGGTGGGGCCTTTATGAAGTGG - Intergenic
913240753 1:116827282-116827304 GAGCTCAGGGCTTTGTGCAGGGG - Intergenic
913319449 1:117578107-117578129 TTGTTGAGGGCTTTGAGTAGAGG - Intergenic
914770906 1:150683981-150684003 GAAGATAGGGCTTTTAGAAGAGG + Intronic
915259258 1:154664570-154664592 GTGGAGAGGGCCCTGAGAAGAGG - Intergenic
915904208 1:159866125-159866147 GAGGGCAGGGCTTAGAGGAGTGG - Intronic
916142843 1:161714092-161714114 AAGGTGATGGCATTAAGAAGTGG + Exonic
916891047 1:169112741-169112763 GAGCTGAGGGATTGGGGAAGTGG + Intronic
916961952 1:169897350-169897372 GAGGTGAGGACACTGGGAAGAGG - Intergenic
917567175 1:176224865-176224887 GAGTTGAGTGCTTGGTGAAGTGG - Intergenic
917615870 1:176743580-176743602 GTGTTGATGGCTTTGGGAAGTGG + Intronic
918297094 1:183167219-183167241 GAGGTGGGTGCTTGGAGCAGGGG + Intergenic
918315949 1:183322842-183322864 GAGATTAGGGCTTGGAGGAGAGG - Intronic
918507542 1:185273189-185273211 GAGGTCAGGAGTTTGAGAACAGG + Intronic
919212028 1:194499103-194499125 GAGGTCAGGGGTTTGAGACCAGG - Intergenic
920261141 1:204688862-204688884 GTGGTGGGGGCTGTGAGGAGAGG + Intergenic
920422136 1:205842115-205842137 GAGGTGAGGGATGTGAAAAAAGG + Intronic
920649023 1:207823169-207823191 GGGGTGTGGGCTGGGAGAAGTGG - Intergenic
921049177 1:211499019-211499041 GAGTTGATGGCAGTGAGAAGTGG + Intergenic
921308988 1:213824409-213824431 CAGGTGAGGGGGTTGAGAACTGG - Intergenic
922116257 1:222617715-222617737 GAGGAGAAGGCTTCGAGGAGAGG + Intergenic
922321855 1:224495612-224495634 GCTGTGAGGGCTTAGAGGAGAGG + Intronic
922781601 1:228257031-228257053 GAAGTGAGGGCATGGAGAAGTGG - Intronic
923939756 1:238808930-238808952 GAGGTAAGGGTTTTGAAGAGAGG + Intergenic
924142409 1:241039291-241039313 GAGGTGTGGGTTGTGAGGAGAGG + Intronic
924154681 1:241163809-241163831 GAGGTGTGGGTTGTGAGGAGAGG - Intronic
1063315658 10:5002755-5002777 GAGGAGAGGGCTGTGAGACCCGG - Intronic
1063325630 10:5098877-5098899 GAGGTGAGTGCTTGGCGGAGAGG + Exonic
1065637389 10:27745400-27745422 GGGGTAAGTGATTTGAGAAGAGG - Intronic
1065783888 10:29195121-29195143 GAGGTGGGACCTTTAAGAAGTGG + Intergenic
1067116214 10:43437217-43437239 GAGGTGCGGGCTGTGAGAGGGGG + Exonic
1067913532 10:50371939-50371961 GAGGTGTGACCTTTAAGAAGTGG - Intronic
1067998925 10:51308876-51308898 GAGCTGAGACCTTTGAGGAGGGG + Intronic
1069030153 10:63587739-63587761 GAGGTGAGGCTTTTGAGAAGTGG - Intronic
1069384076 10:67868649-67868671 GAGGTGAGGAGTTTGAGACCAGG - Intergenic
1070439442 10:76428849-76428871 AAGGGGAAGGATTTGAGAAGGGG + Intronic
1070692331 10:78536472-78536494 GGGGTGTGGGCTCTGAGATGTGG + Intergenic
1071177247 10:82940813-82940835 GAGGTGGGGCTTTTGGGAAGTGG - Intronic
1072780386 10:98247230-98247252 GAGATGAGGGAGTTGAGGAGAGG + Intergenic
1072941204 10:99765667-99765689 GAGGTGAGAACCTGGAGAAGGGG - Intergenic
1073083928 10:100876575-100876597 GGGGTGGGGGCATGGAGAAGGGG - Intergenic
1073337318 10:102719440-102719462 GAGGTCAGGGGTTTGAGACCAGG - Intronic
1073835483 10:107436300-107436322 GAGGTACAGGCTTTCAGAAGAGG + Intergenic
1074254542 10:111787427-111787449 GATGTGAGGGTTTTGAAATGCGG - Intergenic
1074846725 10:117405283-117405305 GAAGTGACTGCTTTGAGAGGCGG - Intergenic
1076042835 10:127265987-127266009 GAGCTGAGGGCTTGGATCAGGGG + Intronic
1076560734 10:131361671-131361693 GAGGAGAAGGCTGTGAGAAGGGG - Intergenic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1077805465 11:5587643-5587665 GAGGTGGAGCCTTTGGGAAGTGG - Intronic
1077978855 11:7278319-7278341 GAGGTGGGGGCCTTTAAAAGAGG - Intronic
1078267000 11:9762504-9762526 GTGGTGAGGGCAGTGATAAGTGG + Intergenic
1078274997 11:9835103-9835125 GAGCTGAAGGCTCTGAGTAGTGG - Intronic
1078640744 11:13093500-13093522 CAGGTGAGTCCTTTGAGAGGTGG + Intergenic
1079020040 11:16902475-16902497 CTGGTGAGGGCGTAGAGAAGTGG - Intronic
1080659188 11:34282186-34282208 GAAGTGAGACCTTTGGGAAGAGG - Intronic
1083991032 11:66245900-66245922 GAGGTGAAGGCTTGCAGGAGAGG + Intergenic
1084421392 11:69062430-69062452 GAGGGGAAGGCTTGGAGATGGGG + Intronic
1084568662 11:69945982-69946004 GAGCTGAGGACTTAGAGAAGAGG + Intergenic
1084568742 11:69946520-69946542 GAGCTTAGGACTTAGAGAAGAGG + Intergenic
1084709405 11:70834835-70834857 GGGGTGAGGGCACTGAGGAGCGG + Intronic
1084938165 11:72598332-72598354 GAGGTGTGAGCTTTGAACAGGGG + Intronic
1085260361 11:75200974-75200996 GGGGTGAGGGCTGGGATAAGAGG + Intronic
1086630609 11:89014526-89014548 GAAGTGGGGGCTCTGGGAAGTGG + Intronic
1087128791 11:94651446-94651468 GAGAAGAGGACTTTGAAAAGTGG - Intergenic
1088049170 11:105490328-105490350 GGGGTGAGGAATCTGAGAAGTGG + Intergenic
1088997159 11:115011045-115011067 GTGGTGAGGAGTTTGAGGAGGGG + Intergenic
1090012447 11:123057311-123057333 GAATTCAGAGCTTTGAGAAGGGG - Intergenic
1090053376 11:123400697-123400719 GAGGTGAGTCCTTTGGGAGGAGG - Intergenic
1090080530 11:123609439-123609461 GAGGTCATGGCTTAGAGGAGAGG + Intronic
1091386877 12:101453-101475 GAGGTGCGGGCTTTGAGGTTGGG + Intronic
1091641564 12:2241071-2241093 GAGGTGAGGGGGGTGGGAAGAGG + Intronic
1091716960 12:2784388-2784410 GAGGTGAGTGCTTTCAAAGGAGG + Intergenic
1092031883 12:5293369-5293391 GGGGAGAGGGGTTTAAGAAGAGG + Intergenic
1092085126 12:5750730-5750752 AGGGTGAGGGCTTTGGAAAGAGG + Intronic
1092847822 12:12600458-12600480 GCTGTGAGGTCTTTGAGATGAGG - Intergenic
1092927105 12:13281307-13281329 ATGGTGAGGGCTCTGAGATGGGG - Intergenic
1093661543 12:21763118-21763140 CAGAAGAGGGCTTTAAGAAGAGG + Intergenic
1094723138 12:33085709-33085731 GGGGTGTGGGCTTTTAGAAAAGG - Intergenic
1095498433 12:42810116-42810138 GCTGTGAGTGCTTTGAGAACAGG + Intergenic
1095585381 12:43843950-43843972 GAGGAGAGGGATTTGGGCAGAGG + Intronic
1095847117 12:46758360-46758382 GAGGTGAGGAATTTGGGAACTGG + Intergenic
1096022779 12:48336299-48336321 GAGGTAAGGGAATTGAGAAAAGG - Intergenic
1096155518 12:49339411-49339433 GAGGTGAGGGACTTAAAAAGGGG - Intergenic
1096490313 12:52009386-52009408 GGGGTGAGGGCTGTGTGAAGGGG + Intronic
1096595251 12:52691101-52691123 GAGGGGAGGAGTTTGAGGAGAGG + Exonic
1097056722 12:56254558-56254580 GAGGTCAGGGCTTTGAGCTCTGG - Exonic
1097159482 12:57036230-57036252 TGGGAGAGGGGTTTGAGAAGAGG - Intronic
1097182355 12:57178677-57178699 GAGGAGAGGGCAGTGAGAACAGG + Intronic
1097237522 12:57550190-57550212 GAGGAGAGGGCTCTCAGCAGAGG - Exonic
1098031658 12:66261012-66261034 GAGGTGAGGGTGGAGAGAAGAGG - Intergenic
1098039411 12:66339117-66339139 TTGGTGAGGACTTTGAGCAGTGG - Exonic
1099760169 12:86911354-86911376 GAGCTGATGGTTTTTAGAAGGGG + Intergenic
1099987664 12:89686368-89686390 GAGGAAAGGAATTTGAGAAGGGG - Intronic
1100359259 12:93861232-93861254 GACATGATGGCTTTGAGCAGAGG + Intronic
1100434637 12:94560656-94560678 GAGGTGCCGGCTCTCAGAAGAGG + Intergenic
1100602405 12:96123041-96123063 GCAGTGGGGGCTTGGAGAAGTGG - Intergenic
1102362463 12:112300099-112300121 GAGGTCAGGAGTTTGAGACGAGG + Intronic
1102513203 12:113429297-113429319 AAGGTAAGGGCTCTGGGAAGGGG + Exonic
1102772052 12:115486508-115486530 GAGGGGAGGCCATTGAGATGTGG + Intergenic
1102779688 12:115553389-115553411 GGGGTGAGGGCTTTGGGAGGTGG - Intergenic
1102877515 12:116459347-116459369 GAGGGGAGGGCTGTGCAAAGAGG - Intergenic
1103592680 12:122003564-122003586 GAGGGGAGGGGTTTGAGACAGGG - Intronic
1103913705 12:124365335-124365357 GAGGTGAGAGCTGTGACAACAGG + Intronic
1103918011 12:124385897-124385919 GAGAGGAGGGCAGTGAGAAGAGG + Intronic
1104656657 12:130578668-130578690 GAGGGGAAGTCTCTGAGAAGGGG - Intronic
1105340381 13:19517632-19517654 GAGGTGAGGTCTCTGAGCAAGGG - Intronic
1105555758 13:21447195-21447217 GAGGTGCGGGCTGTGAGAGAGGG + Intronic
1105885450 13:24637805-24637827 GAGGTGAGGGCTGAGGGACGAGG + Intergenic
1105929339 13:25037534-25037556 GAGATGAGGGCTTTGGCAGGTGG - Intergenic
1106127676 13:26913624-26913646 GAGGTGATGGTGTTGAGAGGTGG + Intergenic
1106404532 13:29462340-29462362 GAGGTGAGGGCTTTAAGCAAAGG + Intronic
1106924338 13:34598276-34598298 GAGGTGCAGGCATTGAGAACAGG - Intergenic
1106945557 13:34823895-34823917 GCTTTGAGGGCTTTGAGCAGAGG - Intergenic
1107021590 13:35757738-35757760 GTGGGTAGGGGTTTGAGAAGTGG - Intergenic
1107112715 13:36715260-36715282 GATGTGAGGTCCTAGAGAAGAGG + Intergenic
1107676626 13:42804479-42804501 AAGATGAGGGCTTTAAGAAAGGG - Intergenic
1107752206 13:43579985-43580007 GTGGTGAGGGCTGTGGAAAGGGG + Intronic
1107908500 13:45083665-45083687 GGGGTAAGGTCTCTGAGAAGAGG - Intergenic
1108091844 13:46857519-46857541 GAGGTGAGTCCTTTGAGAGGTGG - Intronic
1108319654 13:49276365-49276387 GAGATGAGGACTTGGAGATGTGG + Intronic
1108322682 13:49303211-49303233 GAGGAGAGGGCCTGGAGAAGAGG + Intergenic
1108325239 13:49324096-49324118 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1109498779 13:63211308-63211330 GGGATGAGTGCTTTGAGCAGAGG - Intergenic
1110299612 13:73910781-73910803 GAGGTAAGGGCTTTATGAAGTGG + Intronic
1110441259 13:75528592-75528614 GAGGTCAGGAGTTTCAGAAGTGG + Intronic
1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG + Intronic
1111926168 13:94465045-94465067 GAGATGATGGCTCTGAGAAGGGG - Intronic
1112101447 13:96194105-96194127 GAGACGAGGGCTTTGAGAATGGG - Intronic
1112718610 13:102215853-102215875 GAGAAGAGTGCTTTAAGAAGAGG - Intronic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113737211 13:112687617-112687639 GAGGTGGGGGCCTTGGGAGGTGG - Intergenic
1113967667 13:114163610-114163632 GGGGAGAGGACTTTGAGAAGAGG - Intergenic
1115366883 14:32567985-32568007 GAGGGGAGGGGCTGGAGAAGAGG + Intronic
1115501652 14:34055082-34055104 AAGCTGAGGGCATGGAGAAGTGG + Intronic
1116746529 14:48826733-48826755 GAGGTGAAGGCAATGTGAAGAGG + Intergenic
1118336815 14:64860439-64860461 GAGGGCAGGGCTCTGAGAAAAGG + Intronic
1118715538 14:68557018-68557040 GAGGTGAAGGCTCTGAGCTGAGG - Intronic
1118833350 14:69456481-69456503 GACGTGAGAGCTGGGAGAAGAGG - Intronic
1120762805 14:88301338-88301360 GAGGAGAGAGTTTTAAGAAGGGG - Intronic
1120821119 14:88912720-88912742 GATGTGAGGGTTCTGAGAAAAGG + Intergenic
1121779911 14:96615700-96615722 GATGTGAGGGTTTGGAGGAGAGG + Intergenic
1121846044 14:97173249-97173271 GAGGAGAGGCCTTTTTGAAGAGG + Intergenic
1122062425 14:99144956-99144978 GAGGTCAGGGGTTTGAGACCAGG - Intergenic
1122165277 14:99818524-99818546 GAGGTGAGGGGTGTGGGAAGAGG + Intronic
1122189003 14:100025154-100025176 GAGGTGGGTGGTTTGAGAACAGG - Intronic
1122908204 14:104812575-104812597 GAGGTCAGGGGTTTGAGATCAGG + Intergenic
1124027117 15:25976939-25976961 GAGGTCAGGGGTTTGAGACTAGG + Intergenic
1124137935 15:27051483-27051505 GAGGTGTGTCCTTTGGGAAGGGG + Intronic
1125643228 15:41248961-41248983 GAGGAGAGGGCTGAGAGAAGGGG - Intronic
1125862578 15:43013190-43013212 GTGTTGAGGGCTGTGAGCAGTGG - Intronic
1126281950 15:46963758-46963780 GAGGTGGGGGATATGAGAATAGG - Intergenic
1126337481 15:47602928-47602950 GAGGTGAAATCTTTGAGAAGTGG - Intronic
1126585498 15:50281927-50281949 GAGGTCAGGATTTTGAGATGAGG - Intronic
1127424213 15:58839180-58839202 GAGCTGTGGGCTTTGACAAGAGG + Intronic
1127483672 15:59400079-59400101 CAGGTGAGGGATTTGTGAACTGG + Intronic
1128244014 15:66120568-66120590 GAAGTGAGGGCTTTAAGGTGTGG - Intronic
1128550706 15:68596364-68596386 GGGGTGGGGGTTGTGAGAAGGGG + Intronic
1129046306 15:72737494-72737516 GAGATGGGGGCTTTGTGAACTGG - Exonic
1129068668 15:72932765-72932787 GGGGTGGGGGATTTGAGGAGAGG - Intergenic
1129254565 15:74326802-74326824 GAGGGGAGGGATTGGAGCAGGGG + Intronic
1129928427 15:79386346-79386368 GAGGAGAGTGCTCTGAAAAGTGG - Intronic
1130221673 15:82024730-82024752 GAGCTGAGCTCTTAGAGAAGTGG - Intergenic
1130237634 15:82151631-82151653 GCTCTGAGGCCTTTGAGAAGAGG - Exonic
1130254869 15:82321127-82321149 GAGGTGAGGGCATGGAGCTGGGG - Intergenic
1130415999 15:83695263-83695285 GTGGTGGGGTCTTTGAGAAGGGG + Intronic
1130600105 15:85268879-85268901 GAGGTGAGGGCATGGAGCTGGGG + Intergenic
1131080271 15:89528823-89528845 GAGGTGAGGGCTAGGAGATGGGG + Intergenic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1131840824 15:96435577-96435599 GAGGTGAGGAGTTTGAGACCAGG + Intergenic
1132062682 15:98705358-98705380 GAGGTGAGGGTGCTGAGAGGTGG + Intronic
1132087550 15:98920865-98920887 GAGCAGAGGGCTTTGGGAAAGGG - Intronic
1132394954 15:101465521-101465543 GGGATGAGGGCTATTAGAAGAGG + Intronic
1133473725 16:6099810-6099832 AGGGTGAGGTCTTTGAGAAAAGG - Intronic
1133516628 16:6515683-6515705 CAGGGGAGGGTTTTGAGAAATGG - Intronic
1134127939 16:11629346-11629368 GAAGTGAGGGTTCTCAGAAGAGG + Intronic
1134690966 16:16190888-16190910 GAGGGGAGGGGCTTGAGATGGGG + Intronic
1135513232 16:23106760-23106782 GGGATGGGGGCTTTGAGAATTGG - Intronic
1135649516 16:24193669-24193691 GGGGTGATGGCTTCCAGAAGAGG + Intronic
1135927974 16:26711875-26711897 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1136030143 16:27496775-27496797 GAGATGATGGCTGTGAGAGGAGG + Intronic
1136674519 16:31890828-31890850 GAGGTGGGATCTTTAAGAAGTGG - Intronic
1136907631 16:34115526-34115548 TTTGTGAGGGCTTTGAGATGAGG + Intergenic
1137274249 16:46923125-46923147 GAGGTGAGTGCAGAGAGAAGGGG - Intronic
1138104489 16:54280417-54280439 GAGGGGAGGGCTTAGGGAGGAGG + Intergenic
1138585840 16:57970035-57970057 GAGGTCAGGGCTGTAAGTAGAGG - Intronic
1139172262 16:64646375-64646397 CAGTGGAGGACTTTGAGAAGTGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139493235 16:67298562-67298584 GAAGGGAGGGTTTGGAGAAGGGG - Intronic
1139659177 16:68409277-68409299 GAGGTGAGGGATGTGGGGAGGGG + Intronic
1139816430 16:69677937-69677959 GAGGTCAGGGGTTTGAGATGAGG + Intronic
1139960758 16:70716113-70716135 CAGGTCAGGCCTGTGAGAAGGGG - Intronic
1140224484 16:73066893-73066915 GAGGTGAGAGCACTGAGATGGGG + Intergenic
1140645959 16:77030015-77030037 GAGGTGGGGACTTTAAGAGGTGG - Intergenic
1141000504 16:80303016-80303038 GATGTGATGGCTTTAAAAAGGGG + Intergenic
1141163490 16:81644823-81644845 GAGATGGGGGCTTGGAGAGGGGG + Intronic
1141784188 16:86187539-86187561 GTGGTGAGGGCCATGGGAAGGGG + Intergenic
1141888552 16:86910513-86910535 GGGGTGGGGGCCTGGAGAAGAGG - Intergenic
1141992891 16:87620518-87620540 GAGGGGTGGGCTGTGAGGAGAGG + Intronic
1142208954 16:88798562-88798584 GAGGTCAGGAGTTTGAGACGAGG + Intergenic
1142226244 16:88878991-88879013 GAGGTCACGGCCTTGGGAAGCGG - Intronic
1142850399 17:2701842-2701864 GAGGTGGGGGGCTGGAGAAGGGG - Intronic
1142997314 17:3768586-3768608 AAGGTGAGGGCTCTGGGAATAGG - Intronic
1143304163 17:5932879-5932901 CAGGTGAGGGCTTTGAGCCCGGG + Intronic
1143638745 17:8182847-8182869 GAGGTGAGGGGGTAGAGAGGAGG - Intergenic
1144271720 17:13624066-13624088 AAGGTGAGGCCTTTAAGAGGTGG - Intergenic
1145101551 17:20081523-20081545 GACTGGAGGGCTTTGAGCAGAGG + Intronic
1146710243 17:35034737-35034759 GAGGTCAGGAGTTTGAGATGAGG - Intronic
1147450704 17:40502173-40502195 GTCTGGAGGGCTTTGAGAAGGGG + Intergenic
1147879393 17:43644195-43644217 GTGGTGAGGTCTTAGAGCAGCGG - Intronic
1147973765 17:44235941-44235963 GAGGTGAGTCCTTCTAGAAGAGG - Intergenic
1148860253 17:50600897-50600919 GCTGTCAGGGATTTGAGAAGTGG + Intronic
1150681241 17:67286202-67286224 CTGGTGGAGGCTTTGAGAAGAGG - Intergenic
1151669900 17:75566261-75566283 GAGATGAGGGCCCTGAGCAGGGG + Intronic
1151998918 17:77632496-77632518 GAGATGGGGCCTTTGAGAGGCGG + Intergenic
1152036422 17:77875836-77875858 GAGGAGGGGGCTTCAAGAAGGGG + Intergenic
1153978035 18:10286687-10286709 CAGGTGACTCCTTTGAGAAGTGG - Intergenic
1154026149 18:10709214-10709236 GAGATGAGGGCTTTAGGCAGTGG - Intronic
1154470882 18:14699847-14699869 GAGGTCAGGAGTTTGAGAAAAGG - Intergenic
1154949908 18:21199892-21199914 GAGGTGAAGGTGTTGGGAAGGGG - Intergenic
1155328381 18:24689312-24689334 GAAATCAGGGCTATGAGAAGGGG + Intergenic
1155683037 18:28513212-28513234 GTTGAGAGGGCTTTAAGAAGGGG + Intergenic
1155693187 18:28652122-28652144 GAGGTGAGGGGGATGAGATGCGG - Intergenic
1155744348 18:29333552-29333574 AAGGTAAGGGATTTGAGAATGGG + Intergenic
1155843966 18:30682412-30682434 GAGTGGTGGGCTTTGAGTAGTGG - Intergenic
1156228473 18:35131597-35131619 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1157407181 18:47431785-47431807 ATGGTGAGTGCTTTGAGAAATGG + Intergenic
1157445147 18:47738854-47738876 GAGGTGGGGACTTTGGGAGGTGG - Intergenic
1157882390 18:51332970-51332992 GAGGTCAGGGGTTTGAGACCTGG + Intergenic
1158482890 18:57837407-57837429 GAGGTCAGGGGTTTGAGACCAGG + Intergenic
1158648001 18:59264680-59264702 GAGGGGCGGGCTTTGACCAGAGG - Intergenic
1158808808 18:61007286-61007308 GAGGTGAGACCTTTCAGGAGAGG + Intergenic
1158889116 18:61856658-61856680 GAGGTGAGGGGTTGGGGGAGGGG + Intronic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1161364282 19:3869115-3869137 AAGGTGAGGGCTTCGCGCAGGGG - Intergenic
1161414940 19:4140688-4140710 GAGTTGGGGGCTTGGAGGAGAGG + Intergenic
1161483035 19:4520161-4520183 GAGGTGAGGGATGTGGGAAAGGG - Intergenic
1161678735 19:5668042-5668064 GAGGGGAGGGCATTAGGAAGGGG + Intronic
1162013411 19:7830978-7831000 GAGCTGAGGGCTGTGGGCAGGGG - Intronic
1162059616 19:8086679-8086701 GAGGTTAGGAGTTTGAGAACAGG - Intronic
1162126124 19:8500318-8500340 GTGGTGAAGGCAGTGAGAAGTGG - Intronic
1162145751 19:8611291-8611313 GAGGTGGGGCCCTTGAGGAGGGG + Intergenic
1162845219 19:13387162-13387184 GAGGTCAGGAGTTTGAGAACAGG - Intronic
1162903053 19:13806733-13806755 GTGGGGAGGGCTTTGACTAGTGG + Intronic
1163504972 19:17700188-17700210 CACGGGAGGGCTTTGAGCAGAGG + Intergenic
1163649078 19:18506511-18506533 GAGGTCAGGGGTTTGAGACCAGG + Intronic
1163717321 19:18879808-18879830 GAGGTGGGGGCTTGGTGAGGTGG - Intronic
1164579373 19:29425114-29425136 AAGGTGATGGCTTTAGGAAGCGG - Intergenic
1164668185 19:30056238-30056260 GAGGTGGGGACATAGAGAAGGGG - Intergenic
1164944734 19:32283884-32283906 AAGCTGAGGGGTTGGAGAAGTGG - Intergenic
1165170313 19:33887642-33887664 GAGGTGGGAGCTGTGAGGAGGGG - Intergenic
1165342390 19:35222400-35222422 CACGTGAGGGTTTTGAGCAGTGG - Intergenic
1165393155 19:35549765-35549787 CAGGTGAGGGGTGTGAGGAGGGG + Intergenic
1165562959 19:36696731-36696753 GGGGTGAGCCCTTGGAGAAGTGG - Intronic
1165591525 19:36973408-36973430 GAGGTCAGGGCTGTGCGATGGGG + Intronic
1165874907 19:38999409-38999431 GAGGTCAGGGGTTTGAGACCAGG + Intronic
1166570846 19:43796147-43796169 GAGGTGGGGCCTTTGGGAGGTGG - Exonic
1166755635 19:45189231-45189253 GAGGTCAGGAGTTTGAGACGAGG - Intronic
1166840873 19:45696172-45696194 GAGGTGAGGGGTGGGAGATGAGG - Intronic
1167744577 19:51342972-51342994 CAGGGGAGGGCTGTGAGCAGGGG - Intergenic
1167835000 19:52061149-52061171 GAGAAGAGGACTTTGAAAAGTGG - Intronic
1167904574 19:52648177-52648199 GGGGTGAGGGATTTGCCAAGAGG - Intronic
1167972043 19:53193739-53193761 GAGGTGAGGCATGGGAGAAGGGG - Intergenic
1168135295 19:54347027-54347049 GGAGTGAGGGTTTGGAGAAGAGG + Intergenic
1168502706 19:56906836-56906858 GAGGAGAGAGCTTCGAGAAGAGG + Intergenic
925507492 2:4584310-4584332 GAGGTGGGGGAGTGGAGAAGTGG - Intergenic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
926246607 2:11126231-11126253 GAGGTCAGAGGTCTGAGAAGAGG - Intergenic
927079395 2:19612757-19612779 GAGGTCAGGGGTTTGAGATCAGG - Intergenic
927289782 2:21394058-21394080 GAGGTGAGGCCTTTGGGCCGTGG - Intergenic
927337581 2:21942888-21942910 CACGGGAGGGCTTTGGGAAGTGG + Intergenic
927450985 2:23209401-23209423 GAGATGAGGAGTTGGAGAAGGGG - Intergenic
927752595 2:25683019-25683041 TATGTGAGGGCTGGGAGAAGTGG + Intergenic
928306079 2:30171452-30171474 GAGGTGAGGCCTTTGAGAGGTGG - Intergenic
929818352 2:45254153-45254175 GAGGTGAGGTCTTGGACCAGGGG - Intergenic
929856516 2:45642703-45642725 GAGGTGAGGGTTGTGGGAAGTGG - Intergenic
929945456 2:46368277-46368299 GGTGTCAGGGCTTGGAGAAGAGG + Intronic
930462382 2:51698340-51698362 GATGTGACAGCTTTTAGAAGAGG - Intergenic
930627218 2:53711229-53711251 GAAGAGAGAGCTTGGAGAAGCGG - Intronic
930969097 2:57372325-57372347 GAAGTGACTGATTTGAGAAGTGG + Intergenic
931677114 2:64708375-64708397 GAGGTGAGGGTTTGGAGCTGAGG - Intronic
932462029 2:71888615-71888637 GAGGTCAGGGCTGAGAGGAGTGG + Intergenic
932839415 2:75067821-75067843 GGGGTGAGGGCCATGAGATGTGG + Intronic
933901500 2:86853591-86853613 GGGGTGAGGGCCTAGAGATGGGG + Intronic
934720768 2:96574630-96574652 GAGGAGAAGCCTATGAGAAGTGG - Intergenic
934739735 2:96711595-96711617 GAAGTGTGGGTATTGAGAAGAGG + Intronic
934937454 2:98475753-98475775 GGGGTGGGGGCTTTGGGAGGAGG + Intronic
935565009 2:104596951-104596973 GAGGTCAGGACTTTGAGACCAGG - Intergenic
936082836 2:109446623-109446645 GAGGTGAGGTCTATGGGCAGGGG + Intronic
937082896 2:119153199-119153221 GAGATGCTGGCTTTGAGAATGGG + Intergenic
937452177 2:122010733-122010755 TAGGTGAGGGCTTTCAGCAGCGG + Intergenic
938682249 2:133703622-133703644 GAGCTGAGGGCTTGGAGGTGGGG - Intergenic
939449587 2:142356117-142356139 GACGTGATGGCTTTAAAAAGAGG + Intergenic
939768684 2:146287711-146287733 GAGGTAAGGGCTGTCAGATGAGG - Intergenic
940424414 2:153514536-153514558 GAGTTGAGGGATGTGAGATGAGG + Intergenic
940876707 2:158904870-158904892 GAGGTGAGGACTGGGGGAAGAGG + Intergenic
941259928 2:163284914-163284936 GAGGTGATGGTTTTAAAAAGAGG - Intergenic
941531710 2:166678632-166678654 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
941673174 2:168316881-168316903 GAGGTGAGACCTTTGAGAGGTGG - Intergenic
941821974 2:169852627-169852649 GAGGTCAGGGATTTGAGACCAGG + Intronic
942219915 2:173759063-173759085 GATTGGAGGGATTTGAGAAGGGG - Intergenic
942267337 2:174241847-174241869 GAGGTCAGGAGTTTGAGAACAGG - Intronic
942523480 2:176829158-176829180 GATATGGGGGTTTTGAGAAGGGG - Intergenic
942629936 2:177944720-177944742 GAGGTGCGGGCTGTGAGAGAGGG + Intronic
942721529 2:178958499-178958521 GAGGTGAGTGCTTTTGGGAGGGG - Intronic
942802695 2:179893649-179893671 GAGGAGAGAGCTTCAAGAAGAGG - Intergenic
942928777 2:181464167-181464189 GAAGAGAGTGTTTTGAGAAGAGG + Intronic
943650530 2:190453280-190453302 GAGGTGTGGGCTCTGGGTAGGGG + Intronic
943849200 2:192694669-192694691 GAGGTAAGGACATTTAGAAGGGG + Intergenic
943987962 2:194647013-194647035 GAGGAAAGGGATCTGAGAAGAGG + Intergenic
945002075 2:205362656-205362678 AAGGTGACTGCTTTGACAAGTGG - Intronic
947385939 2:229590560-229590582 GAGGTGGGGCCTTTGAGAGGTGG + Intronic
947801451 2:232930704-232930726 GTGGTGGGGCCTTTGAGAGGTGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948604104 2:239123759-239123781 GAGGTCAGGGCTGCGGGAAGAGG + Intronic
948723887 2:239920092-239920114 GAGGTGGGGCCTTTGGGAGGTGG + Intronic
948775366 2:240285435-240285457 GAAGAGATGGCTTTGAGAACTGG + Intergenic
1168909617 20:1437146-1437168 GAGGTCAGGACTTTGAGACCAGG + Intergenic
1169084324 20:2817205-2817227 GGGCTGGGGGCTTTGAGAAGAGG + Intronic
1169301519 20:4445684-4445706 CAGGTGAGGGCTTTGGGTGGTGG + Intergenic
1169395045 20:5221640-5221662 GAGGTGGGGTCTTTAAGAGGTGG + Intergenic
1170451570 20:16489207-16489229 GAGCTGGGGCCTTGGAGAAGAGG + Intronic
1170555714 20:17513238-17513260 TAGTGGAGGGCTCTGAGAAGGGG - Intronic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1171139002 20:22724464-22724486 GAGGTGTGAGCTCTGAGAACTGG - Intergenic
1171353880 20:24528676-24528698 GAGGTGATGGCATTAAGAGGTGG - Intronic
1172308134 20:33896377-33896399 GAGGAGAAGCCTTTGAGAGGTGG + Intergenic
1172439794 20:34957227-34957249 GAGCTAAGGGCTTTAAGCAGGGG + Intergenic
1172573335 20:35987184-35987206 GAGGGGAGGGCCTTGGGAAAAGG + Intronic
1172597055 20:36156717-36156739 GAGGTCAGGGCTGAGAGAAAGGG + Intronic
1172800552 20:37573461-37573483 GAGGTGGGGGTATGGAGAAGAGG + Intergenic
1173182896 20:40818023-40818045 GAGGTGAAGGTTTTGTGAAGTGG + Intergenic
1173526506 20:43736998-43737020 GAGGTCATTGCTTTGAAAAGGGG - Intergenic
1174569879 20:51493925-51493947 GAGGTGAGGGCTCAGAGGTGTGG - Intronic
1175399876 20:58693920-58693942 GTGGTGAGTGCTTCGAGAGGAGG + Exonic
1175430876 20:58902180-58902202 GAGGTGAGGGCGTTGTCATGCGG - Intronic
1175605613 20:60310099-60310121 GAGCTGAGGGCTTTGACACACGG - Intergenic
1175880303 20:62254174-62254196 GATGTGGGGCCTTTGAGAGGTGG - Intronic
1175936624 20:62517237-62517259 GAGGAGTGGGTTTTGGGAAGTGG + Intergenic
1176385555 21:6137251-6137273 GAGGTGAGGGCCTTGGCAGGCGG + Intergenic
1176733829 21:10524154-10524176 GAGGTGAGGTCTCTGAGCAAGGG + Intronic
1176803601 21:13458082-13458104 GAGGTCAGGAGTTTGAGAAAAGG + Intergenic
1177029697 21:15967247-15967269 AAGGTGAGGCATTTGGGAAGGGG - Intergenic
1177403596 21:20637878-20637900 GAGGTGAGGCCTTTAGGAGGTGG - Intergenic
1177612229 21:23466534-23466556 GAGGTGAGTCCTCTAAGAAGTGG + Intergenic
1178199391 21:30386902-30386924 GAGGACAGGGCTTTGAGCATGGG - Intronic
1178679209 21:34658254-34658276 GTGGTCATGGGTTTGAGAAGTGG - Intergenic
1179023215 21:37657735-37657757 TAAGTGAGGTCTTAGAGAAGAGG + Intronic
1179041240 21:37803884-37803906 GAGGGGAGGGCTCACAGAAGGGG + Intronic
1179737918 21:43401001-43401023 GAGGTGAGGGCCTTGGCAGGCGG - Intergenic
1180561580 22:16619629-16619651 GAGGTGAGGTCTCTGAGCAAGGG + Intergenic
1181461850 22:23090371-23090393 CAGGTGAGGGCTGGGGGAAGTGG - Intronic
1181986266 22:26801887-26801909 GAGGTGGGGCCTATGAGTAGTGG + Intergenic
1181991780 22:26842414-26842436 GGGCTGAGGGCTGTGGGAAGGGG + Intergenic
1182728460 22:32467794-32467816 GAGGTGATGGCTCTGAGACCTGG - Intergenic
1182739960 22:32560571-32560593 GACGTGTGTGCTTGGAGAAGAGG + Intronic
1182888584 22:33797278-33797300 GAGCTAAGGGCTTGGTGAAGGGG - Intronic
1182990861 22:34766218-34766240 GAGGTGTGGCCTTTGGGAATAGG + Intergenic
1183269474 22:36851586-36851608 GAGGAGAGGGCTGTGGAAAGGGG + Intergenic
1183705177 22:39471493-39471515 GGGGTGAGGGCAGTGGGAAGGGG - Intronic
1183735020 22:39640173-39640195 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1184919934 22:47598946-47598968 CAGGCGAGGGCTTGGAGCAGCGG - Intergenic
1184940398 22:47760672-47760694 GAGATGAGGATTTTGAGCAGAGG + Intergenic
1185287004 22:50006085-50006107 GAGCTGAGGGCTTTGTGGGGAGG + Intronic
949256536 3:2053952-2053974 GAGGTGGGGCCTGTGGGAAGTGG + Intergenic
949744053 3:7268033-7268055 GTGCTGAGGGCATTGAGATGCGG - Intronic
951291759 3:20879267-20879289 GAGTTGAGGACTTGGGGAAGTGG + Intergenic
952236818 3:31488487-31488509 GAGGTGAGGCCTTTTGGAGGTGG + Intergenic
952409632 3:33035548-33035570 GTGGTAAGGACTTTGAGATGGGG + Intronic
952494647 3:33905067-33905089 TAGGTGAGGAGTTTGGGAAGGGG + Intergenic
952816945 3:37453859-37453881 TATGTGAGGGCTTTGAAAACTGG - Intronic
953761503 3:45690759-45690781 GAGGTGAGCACTTTGCAAAGGGG - Intronic
953874512 3:46658570-46658592 GAGGTCAGGGGTTTGAGACCAGG + Intergenic
954208855 3:49082153-49082175 GAGGTGAGGAGTTTGAGACCAGG - Intronic
954936651 3:54333066-54333088 CAGTTGAAGGCATTGAGAAGAGG + Intronic
955015381 3:55064522-55064544 GAGAGGAGGGCTGTGAGGAGGGG - Intronic
955443238 3:58979280-58979302 AAGGTGAGGAAATTGAGAAGAGG - Intronic
955748330 3:62162520-62162542 AAAGTGAGGGCTTTGGGAGGTGG + Intronic
955967201 3:64400765-64400787 GAGCAGAAGGTTTTGAGAAGGGG + Intronic
956516953 3:70060315-70060337 GCTGTGAGAGCTTGGAGAAGGGG + Intergenic
956683598 3:71804212-71804234 GAGGTCAGGAGTTTGAGACGAGG - Intergenic
956702018 3:71966869-71966891 GGACTGAGGGCTTTGAGAAGAGG - Intergenic
957561845 3:81832409-81832431 GAGGTGGGGCCTTTGAGAGGTGG + Intergenic
957856936 3:85891588-85891610 GAGACGAGGTCTTTAAGAAGGGG + Intronic
958265510 3:91433260-91433282 GAGGTGAGGGACTGGAGGAGGGG - Intergenic
958472618 3:94540417-94540439 GAGTGGAGGGATTTGTGAAGAGG - Intergenic
958863233 3:99469525-99469547 GATGTGAGCACTTTGAGAGGAGG - Intergenic
958884231 3:99708209-99708231 GCAGTGACGTCTTTGAGAAGTGG - Intronic
959877035 3:111395277-111395299 GAGGTGGGGTCTTTGGGAGGTGG + Intronic
960573659 3:119208752-119208774 GATGTGGGGGCTTGGAGCAGAGG - Intergenic
960958920 3:123055415-123055437 AAGGAGAGGGTTTTCAGAAGAGG + Intergenic
961614072 3:128164855-128164877 GAGGAGAGGACTGTGACAAGTGG + Intronic
961615119 3:128173167-128173189 GAGCTGAAGGCTTTCAAAAGAGG + Intronic
962068209 3:132005799-132005821 ACTGTGAGGGCTTTTAGAAGTGG - Intronic
963077955 3:141365547-141365569 GAGGTGGGGTCTTTCAGAGGTGG - Intronic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
964467571 3:157013193-157013215 GAGCTCAGGAGTTTGAGAAGAGG - Intronic
964772669 3:160240292-160240314 GATGTGAGTGCTCAGAGAAGAGG - Intronic
966148573 3:176840749-176840771 GAAGGGAGGGCTGTGAGGAGTGG - Intergenic
967464705 3:189790769-189790791 CAGGTGAGTGCTTGGAAAAGTGG + Intronic
967846231 3:194045288-194045310 GAGGTGTGGGCAGTGATAAGGGG - Intergenic
967984618 3:195085784-195085806 GAGGTGAGTGCTCAGAGCAGTGG - Intronic
968186124 3:196634556-196634578 GAAGTGGGGGCTAGGAGAAGTGG + Intergenic
968186180 3:196634739-196634761 GAAGTGGGGGCTGGGAGAAGTGG + Intergenic
968186195 3:196634786-196634808 GAAGTGGGGGCTGGGAGAAGTGG + Intergenic
968520446 4:1032582-1032604 CAGGTGAGGGCTGTGGGAGGAGG + Intergenic
968577127 4:1372697-1372719 GAGATGAGTGCTCTGAGATGCGG - Intronic
968577138 4:1372762-1372784 GAGGTGAGTGCCCTGAGACGCGG - Intronic
968577148 4:1372806-1372828 GAGGTGAGTGCCCTGAGACGCGG - Intronic
968577153 4:1372829-1372851 GAGGTGAGTGCCCTGAGACGCGG - Intronic
968577163 4:1372873-1372895 GAGGTGAGTGCCCTGAGACGCGG - Intronic
968594467 4:1475120-1475142 GAGGTGAGGGCAGTGTGATGTGG - Intergenic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
969080720 4:4615949-4615971 GAGGGGAAGGCTTTGGGGAGAGG - Intergenic
969324305 4:6432037-6432059 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
969676070 4:8615029-8615051 GAAGTGAGGGCTCTGGGCAGTGG + Intronic
969844137 4:9906157-9906179 GGGATGATGGCTTTTAGAAGTGG + Intronic
971258476 4:25034649-25034671 TAGCTGAGTGCTTTGAGATGAGG + Intergenic
971386305 4:26143358-26143380 GAGATGAGGGTTTTGAGCACAGG - Intergenic
971565607 4:28136714-28136736 GAGGTGAGGGGTTGGAGTCGAGG - Intergenic
972080081 4:35139598-35139620 AAGGTAAGGACTTTGAGATGAGG - Intergenic
972355866 4:38279201-38279223 TAGGTGAGGGCTTTCAAAATCGG + Intergenic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
972789702 4:42359093-42359115 GAGGAAAGGGCTTCCAGAAGGGG + Intergenic
973862107 4:55076207-55076229 GAGGTGAGAGCTGTGGGGAGGGG - Intergenic
974102915 4:57437307-57437329 GAGGTCAGGGGTTTGAGACCAGG + Intergenic
975372803 4:73607878-73607900 GAGGGGAGGGGTTGGAGGAGAGG - Intronic
975486602 4:74940551-74940573 GAGGTGGGGTCTTTAGGAAGTGG - Intronic
975798205 4:78031756-78031778 AAGGTCAGGGCCTTGAGATGGGG + Intergenic
976067098 4:81200360-81200382 GAGCTGAGGTCTGTGAGAAAAGG - Intronic
976721230 4:88170623-88170645 GAGGGCAGGGGTTTCAGAAGAGG - Intronic
977954675 4:103012932-103012954 GAGGTGAGGCCTTTAGGAAATGG - Intronic
978005758 4:103613863-103613885 GAGGAGAGGGAGTGGAGAAGGGG + Intronic
978898455 4:113919648-113919670 ATGGTGTGGGCTTTGGGAAGGGG + Intronic
979396168 4:120192053-120192075 GTGCTGTGGGCTCTGAGAAGAGG - Intergenic
979496724 4:121392328-121392350 CAGGTGAGTGCTATGAGGAGGGG + Intergenic
980070483 4:128238198-128238220 GACTAGAAGGCTTTGAGAAGGGG - Intergenic
980599198 4:134997583-134997605 GAAGTCCGGGTTTTGAGAAGTGG + Intergenic
980770380 4:137364453-137364475 CAGGTGAGGCCTTTAAGAGGTGG + Intergenic
981611999 4:146603434-146603456 ATGGTGAGTGCTCTGAGAAGTGG - Intergenic
981761106 4:148195936-148195958 GACTAGAGGGCTTTGAGCAGAGG + Intronic
982219754 4:153114428-153114450 GAGGAGAGGGGTCTAAGAAGAGG - Intergenic
982342665 4:154319258-154319280 GAGGGGAAAGCTTTGTGAAGTGG + Intronic
982433293 4:155349187-155349209 GTGGTGAGGGCTCTGAGAGTGGG + Intronic
982477197 4:155868138-155868160 GAGAAGAGGGCTGTGAGAAGAGG - Intronic
983413763 4:167429186-167429208 GAGGTGGGACCTTTAAGAAGTGG - Intergenic
983633411 4:169873206-169873228 GAGGTGAGGGTTTTCAGCAGAGG - Intergenic
983818669 4:172166241-172166263 GAGGTGAGGAGTTTGAGACATGG + Intronic
984091543 4:175381162-175381184 GAGGGTAGGGGCTTGAGAAGTGG - Intergenic
985090451 4:186357709-186357731 AAGGTAAAGGCTTTGAGATGGGG + Intergenic
985929390 5:3044817-3044839 GAGGTGACAGGTTTGAGAATAGG + Intergenic
985948314 5:3203611-3203633 CAGGAGAGGACTTTGAGAAATGG + Intergenic
987338809 5:16921359-16921381 GGGGTGAGGGGTCTGAGAACGGG + Intronic
988522460 5:31958839-31958861 GAGGTCAGGAGTTTGAGAAGAGG - Intronic
989606182 5:43246403-43246425 CCGGTGAGGCCCTTGAGAAGTGG + Intronic
989650819 5:43688181-43688203 AAGGTGAGGATTTTGAGATGGGG + Intronic
991051732 5:62279925-62279947 GGGGTCAGGGCTTAGAGAAAAGG + Intergenic
992664722 5:78996091-78996113 GAGCTGAGAGCTTTGGGAACTGG + Intergenic
996263740 5:121508238-121508260 GTGGTGAGGACTTAGAGAAAAGG - Intergenic
997675106 5:135707025-135707047 GATGAGTGGGCTTTGAGAGGGGG + Intergenic
998726263 5:145018287-145018309 GAGGTGTGACCTTTGAGAAGAGG - Intergenic
999625157 5:153512828-153512850 GAGGTTAGGGCTTTAACAAACGG - Intronic
999632226 5:153583009-153583031 GAGGTCAGGAGTTTGAGATGAGG - Intronic
1001390157 5:171372210-171372232 GAGGTCAGGGGTTTGAGACCAGG - Intergenic
1001508918 5:172303757-172303779 GAGGTGATGGTATTAAGAAGTGG - Intergenic
1001762955 5:174222892-174222914 GAGGTGAAGGCTTTAAGAGAGGG - Intronic
1002273812 5:178090569-178090591 GAGGTCAGGGGTTTGAGACCAGG + Intergenic
1002846900 6:955237-955259 GAAGGGAGGGCTTTAAGGAGCGG - Intergenic
1003435455 6:6083938-6083960 GAGGTGGGGTCTTTGGGAGGTGG + Intergenic
1003455542 6:6278509-6278531 GAGGTGAGGTATCTGAGCAGGGG + Intronic
1003687627 6:8320267-8320289 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1004300709 6:14454731-14454753 CTGGTTAGGGGTTTGAGAAGTGG - Intergenic
1004361229 6:14973003-14973025 GAGGTGAGCCCTTTGGGAGGTGG - Intergenic
1004886230 6:20053911-20053933 CAGGTGGGGGCTTTAAGAAAAGG + Intergenic
1004919972 6:20367186-20367208 GTGATGAGGGCTTTCAGAAGAGG + Intergenic
1005194640 6:23268847-23268869 GAGGTGAGGACTTTAGGAGGTGG + Intergenic
1005844909 6:29769684-29769706 GAGGTCTAGGCATTGAGAAGGGG - Intergenic
1006618392 6:35345102-35345124 CAGGTGAGAGATTTGAGAACAGG + Intronic
1007231998 6:40354761-40354783 GTGGTGAGGGCTTTCACTAGAGG - Intergenic
1007252847 6:40508121-40508143 GAGGTGAGGGCTTGGAGGGGAGG - Intronic
1007321046 6:41028848-41028870 AAGATGAGGGCTTAGACAAGAGG + Intronic
1007510682 6:42372323-42372345 GAGCTGATGGGTTTGAGAACTGG - Intronic
1007599193 6:43071379-43071401 GTGGTGAGGGCCTGGGGAAGGGG + Intronic
1007952548 6:45885165-45885187 GAAGTGGGGCCTTTGAGAGGAGG + Intergenic
1008542378 6:52556493-52556515 GAGGTCAGGGGTTTGAGACCAGG - Intronic
1008989855 6:57589396-57589418 GAGGTGAGGGACTGGAGGAGGGG + Intronic
1009178438 6:60487940-60487962 GAGGTGAGGGACTGGAGGAGGGG + Intergenic
1009563560 6:65278973-65278995 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1009612414 6:65963536-65963558 GAGCTGAGGGCTTTCAAAACGGG - Intergenic
1011350497 6:86417883-86417905 ATGGTGGGGGCTTTGGGAAGGGG - Intergenic
1011706217 6:90003885-90003907 GGGGTGAAGTCTTTGGGAAGTGG - Intronic
1011980218 6:93365496-93365518 GAGGTCAGTTCTTTGAGCAGTGG - Intronic
1012443216 6:99281574-99281596 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1012560319 6:100572161-100572183 GAAGTGGGGGCTTTGGGGAGGGG + Intronic
1015065741 6:129024607-129024629 GAGGTCAGGGGTTTGAGACCAGG - Intronic
1015332455 6:131996802-131996824 TAGGTGAGGGCTCTGATAAGAGG - Intergenic
1015919189 6:138249609-138249631 GAGGTCAGGAGTTTGAGAATAGG + Intronic
1016016393 6:139190814-139190836 AAGGTGATGGCTTTTAGAGGTGG - Intergenic
1016206664 6:141475642-141475664 GATGTGAGTGTTTTGAGCAGTGG + Intergenic
1016330031 6:142945760-142945782 GAGGTGAGGGGGTGGAGAGGAGG - Intergenic
1016653277 6:146487518-146487540 GAGATGTGGGCATTGAGAAGAGG - Intergenic
1017527296 6:155252772-155252794 CATGTGAGGTCTTTGAGAACTGG + Intronic
1017607693 6:156150973-156150995 GAGGTGAGGCCTTTTGGAGGTGG - Intergenic
1017752615 6:157502531-157502553 GAGGTGAGTGGTGTGAGATGGGG - Intronic
1018442222 6:163823774-163823796 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
1018639757 6:165895579-165895601 GGAGTGAGGACTTTGTGAAGAGG - Intronic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1018767330 6:166944750-166944772 GAGTGGAGAGATTTGAGAAGAGG - Intronic
1018881149 6:167882424-167882446 GAGGTCAGGGGTTTGAGACAAGG + Intronic
1018891706 6:167987566-167987588 GATGTGGTGGCGTTGAGAAGCGG - Intergenic
1019332540 7:467534-467556 GAGGTGATGGTTGTGAGAGGAGG - Intergenic
1019332543 7:467553-467575 GAGGTGATGGTTTTGGGAGGAGG - Intergenic
1020437383 7:8179302-8179324 GTGGGGAAGGCTTTAAGAAGAGG + Intronic
1020559592 7:9714047-9714069 GAGGTGAGGACTGTGATGAGGGG + Intergenic
1020653900 7:10907797-10907819 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1020802528 7:12749191-12749213 GAGGTGAGGGCTGAGAGTTGGGG - Intergenic
1021366608 7:19787738-19787760 GATTAGAGGGTTTTGAGAAGAGG + Intergenic
1023459354 7:40378174-40378196 GAGGACAGGGGATTGAGAAGTGG - Intronic
1023645908 7:42314683-42314705 AAGGTAATGGCTCTGAGAAGTGG - Intergenic
1024042331 7:45565170-45565192 GATATCAGGGCTTGGAGAAGGGG - Intergenic
1025769423 7:64490239-64490261 GAGGTGAGGGTGGTGCGAAGGGG + Intergenic
1025796602 7:64743633-64743655 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1026638436 7:72104334-72104356 GAGGTGATGGCTAAGAGATGTGG + Intronic
1027370904 7:77508465-77508487 GAGGTGCGGGCTGTGAGAGAGGG + Intergenic
1028313343 7:89367527-89367549 GAGGTGAGTCCTTTAAGAAGGGG - Intergenic
1028504506 7:91556540-91556562 GAGCTGATGGATGTGAGAAGAGG + Intergenic
1028939554 7:96505797-96505819 GAGGTGAGGGTTTTGCGAGGTGG - Intronic
1029642271 7:101828798-101828820 GAAGTGAGGGCTGGGAGAGGAGG + Intronic
1029735639 7:102464557-102464579 GAGATGAGGGCTTTAAGGAGCGG - Intronic
1031562648 7:123256521-123256543 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1031941118 7:127790353-127790375 GAGCTGAGTGCTTGGAGGAGAGG + Intronic
1032271240 7:130408997-130409019 GGGGTGAGGGGTTAGAGAGGAGG + Intronic
1032700506 7:134374655-134374677 GGGGTGGGAGATTTGAGAAGGGG - Intergenic
1033014056 7:137653654-137653676 GAGGAGAGGGGTCAGAGAAGGGG - Intronic
1033243650 7:139701426-139701448 TAGGTGAGGGCTTTGGGAACAGG - Intronic
1034391847 7:150793375-150793397 GAGGAGAGGGATTTGAGGCGGGG - Intronic
1034454095 7:151156019-151156041 GGGGAGAGGGCTTTTACAAGTGG - Intronic
1035568658 8:658472-658494 GGGATGAGGGGTTTGGGAAGAGG - Intronic
1035962628 8:4154576-4154598 GAGGTGAGGTCTTTGGCAATAGG + Intronic
1036175487 8:6534023-6534045 GAGCTGGGAGCTTAGAGAAGTGG - Intronic
1036384731 8:8269357-8269379 TAGGAGAGAGCTGTGAGAAGGGG - Intergenic
1036501986 8:9322498-9322520 GAGGTGAAGCTTTTTAGAAGAGG + Intergenic
1036831192 8:12021193-12021215 GAGGAAAGGACTTTGAGAATAGG + Intergenic
1038001942 8:23399389-23399411 GAGGTGGGGCCTTTAAGAAGTGG + Intronic
1038421217 8:27435318-27435340 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1038680495 8:29662875-29662897 GAGGTGGGGCCTTTGAGAGGTGG - Intergenic
1039031688 8:33316505-33316527 GAGGTCAGGGGTTTGAGACCAGG + Intergenic
1039866492 8:41508829-41508851 GAGCTGAGATCTTAGAGAAGGGG + Intronic
1040430808 8:47340389-47340411 GAGGTCAGGAGTTTGAGATGAGG + Intronic
1041896951 8:62936240-62936262 GTGGTGTGGGCTGTGAGGAGTGG + Intronic
1042047685 8:64672426-64672448 GAGGAGAGGGAATTAAGAAGGGG - Intronic
1045338753 8:101233157-101233179 GTGGAGAGGGCCTGGAGAAGAGG + Intergenic
1045574727 8:103408198-103408220 GAGGTCAGGGGTTTGAGACCAGG - Intronic
1045827598 8:106417966-106417988 AAGCTGAGGGCTTTGTGGAGAGG + Intronic
1047243955 8:123121613-123121635 GAGGTGAGGGCCTCTGGAAGAGG - Intronic
1047586290 8:126277566-126277588 GTGGTGAGGCCTTTGAGGAAGGG - Intergenic
1048230303 8:132633564-132633586 GAGGTGAGGTATTTAGGAAGGGG + Intronic
1048576346 8:135693193-135693215 GACGTGTGGGCTATGAGTAGGGG + Intergenic
1048582357 8:135740310-135740332 GTGGTGGGGCCTTTGGGAAGTGG - Intergenic
1048899189 8:139021853-139021875 GTGGTGGGGTCTGTGAGAAGTGG + Intergenic
1049204639 8:141358052-141358074 CAGGCGAGGGCATGGAGAAGGGG - Intronic
1049442547 8:142615976-142615998 GAGCTGAGGGCTGTGAGTGGGGG - Intergenic
1049943270 9:569332-569354 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1049989187 9:976426-976448 GCGGAGAGGGCTTGGAGGAGGGG + Intergenic
1050627995 9:7526360-7526382 GAGGAGAGGCCTTTGGGAGGTGG - Intergenic
1050741221 9:8823102-8823124 GAGAAGAGGGCTTCAAGAAGAGG - Intronic
1051550986 9:18329064-18329086 GAGGTGGGGCCTTTGGGGAGTGG + Intergenic
1052484231 9:29075477-29075499 GTGGGGAGGGATTTGAGCAGAGG - Intergenic
1052670112 9:31546158-31546180 GAGGTCAGGAGTTTGAGAACTGG - Intergenic
1052833360 9:33233216-33233238 GAGGTGATGGATATGAGAGGTGG + Intronic
1053524903 9:38818674-38818696 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054197135 9:62043090-62043112 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054641273 9:67545604-67545626 GAGGTGAGGAGTTGGTGAAGTGG + Intergenic
1055336022 9:75234433-75234455 GAGGTGGGGCCTTTCAGAGGTGG + Intergenic
1055482244 9:76720481-76720503 GAGGTGAGGGTTTACAGATGAGG - Intronic
1056275826 9:84993198-84993220 GAGGAAATGGCTTTGGGAAGAGG - Intronic
1057236341 9:93364948-93364970 GAGGAGAGGGCCATGTGAAGAGG + Intergenic
1057495178 9:95554857-95554879 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1057871609 9:98722369-98722391 GAGTTGGGGGCTTAGTGAAGAGG + Intergenic
1058685016 9:107472288-107472310 GAGGTCAGGGGTTCGAGAACAGG + Intergenic
1059183521 9:112243325-112243347 GAGGTGAGGCATTTGAGACCAGG + Intronic
1059501382 9:114756903-114756925 GAGGGGAGGGTTGAGAGAAGAGG + Intergenic
1059843606 9:118246162-118246184 GTGGTGAAGGCTTTGAAAATTGG - Intergenic
1059870267 9:118565431-118565453 GAGGTATGCGTTTTGAGAAGTGG - Intergenic
1060632039 9:125167811-125167833 GAGGTCAGGAGTTTGAGATGGGG + Intronic
1060998266 9:127887029-127887051 GTGGTGAGGGCTGTGAGCACTGG + Intronic
1062030224 9:134358843-134358865 GTGGTGAGGGCTGTGGGCAGAGG + Intronic
1062523985 9:136970910-136970932 GGGGTGAAGGCTTTGGGGAGGGG - Intronic
1062541072 9:137041795-137041817 GTGGTGAGGGCTTTGCTCAGAGG - Intronic
1062709610 9:137967450-137967472 GAGGTTAGGGCTCTGAGAGCGGG - Intronic
1185849183 X:3469396-3469418 AAGGTGAAGCCTATGAGAAGGGG + Intergenic
1186020842 X:5253289-5253311 GAGTTATGGGTTTTGAGAAGAGG + Intergenic
1186138836 X:6549349-6549371 GAGTTAAGGACTTTGAGATGAGG + Intergenic
1186320224 X:8416242-8416264 AAGTTAAGGACTTTGAGAAGGGG - Intergenic
1186547730 X:10468215-10468237 AAGGTGAGGGAGTTGAGGAGAGG + Intronic
1186689013 X:11955201-11955223 GAGGTGAGGATTTTGGGAGGTGG - Intergenic
1188245480 X:27831771-27831793 GAGATGAGGGCTTTGAAGTGAGG + Intergenic
1188727245 X:33601235-33601257 GAGGTGGGAGCTTTAAGAGGTGG - Intergenic
1189486450 X:41436410-41436432 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1189797691 X:44661259-44661281 GAGGTGTGGGGCTTGAGAGGAGG - Intergenic
1190288704 X:48977536-48977558 GAGGTTAGGAGTTTGAGAACTGG - Intronic
1190369789 X:49729804-49729826 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1191846851 X:65553163-65553185 AAGGTGAGTGTTTGGAGAAGAGG - Intergenic
1194047404 X:89025148-89025170 GAGGAGAGAAATTTGAGAAGGGG + Intergenic
1194925354 X:99817439-99817461 GTGGTGATGGCTATGAGGAGAGG + Intergenic
1195116822 X:101707530-101707552 GAGATGAGGCCTTTAAGAAGTGG - Intergenic
1196799609 X:119530968-119530990 GAGGTCAGGAGTTTGAGAAGCGG - Intergenic
1196921233 X:120587207-120587229 GCTGTGAGAGCTGTGAGAAGTGG + Intergenic
1197826471 X:130595682-130595704 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1198832735 X:140767939-140767961 GAGGTGAGATCTTTAAGAGGTGG - Intergenic
1199482921 X:148317529-148317551 GATGAGAGGGATATGAGAAGAGG - Intergenic
1199634989 X:149805938-149805960 GAGGAGAGGGCTTTGGTATGAGG + Intergenic
1200373186 X:155749644-155749666 GAGGTGAGGGCAATAAGAATAGG + Intergenic
1200419647 Y:2951077-2951099 GAGGTGAGGTCTTGAAAAAGTGG - Intronic
1200962757 Y:9010186-9010208 GAGGTTAGTTCTTTGAGAACTGG - Intergenic
1202031316 Y:20577102-20577124 GAGCTGATGGCTTAGAGAACTGG - Intronic
1202148817 Y:21826478-21826500 GATTTGAGGGCTTTGATAACAGG + Intergenic
1202391341 Y:24373409-24373431 GAGCTGAGGACTTTCATAAGAGG - Intergenic
1202479444 Y:25296708-25296730 GAGCTGAGGACTTTCATAAGAGG + Intergenic