ID: 964390051

View in Genome Browser
Species Human (GRCh38)
Location 3:156187204-156187226
Sequence CTGAGAAATACCAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964390051_964390055 -9 Left 964390051 3:156187204-156187226 CCCTCCACCTTGGTATTTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 274
Right 964390055 3:156187218-156187240 ATTTCTCAGAGATTCATGCTTGG 0: 1
1: 0
2: 0
3: 25
4: 228
964390051_964390056 -5 Left 964390051 3:156187204-156187226 CCCTCCACCTTGGTATTTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 274
Right 964390056 3:156187222-156187244 CTCAGAGATTCATGCTTGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964390051 Original CRISPR CTGAGAAATACCAAGGTGGA GGG (reversed) Intronic
900722777 1:4188404-4188426 CTGAGAACTCCAAAGGTGGGGGG - Intergenic
903368074 1:22817058-22817080 AAGATCAATACCAAGGTGGATGG + Intronic
903976496 1:27153833-27153855 CTGAGAAGGACCAAGGTGGCAGG + Intronic
904283187 1:29435722-29435744 CTTTGAGAGACCAAGGTGGATGG - Intergenic
906345590 1:45012536-45012558 CTGAGAAATACCCAGGCTGGGGG - Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907732386 1:57079681-57079703 CTGTAAAACACCAAGGTGGTGGG - Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908029367 1:59983591-59983613 TTGAGACTTACCAAGGAGGAAGG + Intergenic
908415789 1:63912041-63912063 CTTTGGAAGACCAAGGTGGAAGG + Intronic
909061330 1:70882243-70882265 CTGAGAAATACCCAGATGGTAGG - Intronic
910364909 1:86454385-86454407 CTAAAAAATAGCAATGTGGAAGG - Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912171682 1:107108139-107108161 CTGAGCCATACCAAGGAGTAAGG - Intergenic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
915200683 1:154225799-154225821 GAGAGAGATATCAAGGTGGAAGG - Intronic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917916193 1:179704828-179704850 CTGAGAACTACCATGCGGGAGGG + Intergenic
917962429 1:180155312-180155334 CTGAGAAACATGAAGGTGGTGGG - Intronic
919280751 1:195485617-195485639 CTGTGAAATACCAGGATGGAAGG + Intergenic
919644567 1:200081351-200081373 CTGGGAAATACCACAGAGGAAGG - Intronic
922374740 1:224951267-224951289 CTTTGGAAGACCAAGGTGGATGG - Intronic
1065599773 10:27356684-27356706 CTGAGGAATACCTGGGTGAAAGG + Intergenic
1065800825 10:29350492-29350514 CTGAAAATTACCCAGGTGCACGG + Intergenic
1066327273 10:34374929-34374951 TTGAGAAGCACCAAGATGGAAGG - Exonic
1066547704 10:36518805-36518827 CTGAGAACCACAAAGGTGGGTGG - Intergenic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1067286137 10:44908777-44908799 CTGAGAACTAACAAGGCCGAGGG - Intergenic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1067984957 10:51133051-51133073 CTGAGACATAGTTAGGTGGATGG + Intronic
1068273382 10:54759076-54759098 CTGAGAAGTAGTAAGATGGAGGG - Intronic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1071098202 10:82003798-82003820 CAGAGAAATAGCATGGTTGATGG + Intronic
1074383293 10:112997414-112997436 CTGAGAAACACCAGGCTGAATGG + Intronic
1075638476 10:124047013-124047035 CTGAGAAGTATCAAGGCAGAGGG - Intronic
1076321545 10:129585971-129585993 CTGATAGATACCAAGATAGATGG + Intronic
1076559884 10:131355146-131355168 CTGAGATAAACCAATTTGGAAGG - Intergenic
1077472486 11:2770526-2770548 CTGAGAAACACCACTGTGGGAGG - Intronic
1081714215 11:45237102-45237124 CTGAGAATCACCAAGCTGGAAGG - Intergenic
1084836804 11:71807799-71807821 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1085169021 11:74432239-74432261 TTGAGAAAGAACAAGGTAGAAGG + Intergenic
1085688123 11:78644225-78644247 ATGAAAAATACCAAGGGAGATGG - Intergenic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1089281591 11:117378737-117378759 CGGGGAAATACCCAGATGGACGG - Intronic
1090437436 11:126698432-126698454 ATGAGAACACCCAAGGTGGAGGG - Intronic
1090495285 11:127205837-127205859 CTGGGAAACACCAAGATGGCAGG + Intergenic
1090574417 11:128085849-128085871 CTGGGAAATACCCAGATGGCCGG - Intergenic
1091395782 12:153531-153553 CTGTGAAATCCCTAGCTGGAAGG - Intronic
1091397156 12:160982-161004 GTGAGAAAAACCAAGGAGAAAGG - Intronic
1092402434 12:8188307-8188329 CTGAGATATTCCAAGGAGGAGGG + Intronic
1092479227 12:8845208-8845230 CTGAGAACCACGCAGGTGGATGG - Intronic
1092535907 12:9386873-9386895 CTGACAAAGAACAAGGTGGGAGG - Intergenic
1093105580 12:15082249-15082271 CTGTGGCATAACAAGGTGGAAGG + Intergenic
1093462745 12:19421099-19421121 CTTTGGAAGACCAAGGTGGAAGG + Intronic
1093491412 12:19709313-19709335 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1095712328 12:45303813-45303835 CTGAGAACACCCAAGCTGGAAGG + Intronic
1096829230 12:54301349-54301371 CTGAGTCATATCAAGGTGGAAGG + Intronic
1097614062 12:61862674-61862696 ATTAGAAATAGCAAGGAGGATGG - Intronic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1098459085 12:70712074-70712096 CTCTGAAATTCCAAGGTGAAAGG - Intronic
1099188295 12:79539515-79539537 CTGATAAATACCAAGGAAGGTGG + Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1101976019 12:109359514-109359536 CTGAGAAACTCCAAGGAGGTGGG - Intronic
1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG + Intronic
1103526117 12:121569772-121569794 CACAGAAATACCAAGGGAGAGGG + Intronic
1105817294 13:24048169-24048191 CTGAGTGATACCCAGGTGGCAGG - Intronic
1107351395 13:39518670-39518692 CTGAGAAATACTATTGTAGAAGG - Intronic
1109230202 13:59747606-59747628 CTGAGAAATATCAAGCTGGAAGG + Intronic
1109741154 13:66557762-66557784 CTGATAAATACAAAGGTAGATGG + Intronic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1111742936 13:92227163-92227185 CACGGAAATACCAAAGTGGAGGG + Intronic
1114434112 14:22689422-22689444 CTGAGAGACAGCAAGTTGGAAGG - Intergenic
1114796770 14:25724703-25724725 CTTTGAGATGCCAAGGTGGAAGG - Intergenic
1116794803 14:49378572-49378594 CAGTGATATACCAAGGTGGCGGG - Intergenic
1117009794 14:51459000-51459022 CTGACAGATACGAAGGAGGAGGG - Intergenic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1117838660 14:59833925-59833947 TTAAGAAAAACCAAGTTGGAGGG + Intronic
1118628297 14:67679117-67679139 CTGTGTAATAACAAGATGGAAGG + Intronic
1118632416 14:67717818-67717840 CTTTGAGAGACCAAGGTGGAAGG + Intronic
1118738633 14:68721850-68721872 ATGAGAACTACCAAGGTGATTGG + Intronic
1119202414 14:72766370-72766392 CTGAGAAACAACAGGGTGGGTGG + Intronic
1120742162 14:88119977-88119999 ATGATAAAGACCAAGGTGGTGGG - Intergenic
1121196182 14:92074368-92074390 CAGAGAACAACCAAAGTGGAGGG - Intronic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121307913 14:92918358-92918380 CTGTAAAATACCAGGGTGGGAGG - Intergenic
1121469391 14:94140187-94140209 CTGAGAATGTCCAGGGTGGAGGG + Intergenic
1121686008 14:95835740-95835762 GTGAGAGATGCCAAGCTGGAAGG + Intergenic
1123632077 15:22268458-22268480 CTGGGACATCCCATGGTGGAAGG - Intergenic
1124411900 15:29443704-29443726 CTGAGAAAGAGCAAGCAGGAGGG + Intronic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126430624 15:48580062-48580084 TTGAGAAATACCAAGAAGGGTGG - Intronic
1129701738 15:77772209-77772231 CTGAGAATGACCTGGGTGGATGG + Intronic
1129915290 15:79264817-79264839 GAGAGAAACACCAAGGTGGCAGG + Intergenic
1130342459 15:83011277-83011299 CTCAGAAATCACCAGGTGGACGG + Intronic
1131523016 15:93130747-93130769 CTGAGAAATATCAGGTTGGTGGG + Intergenic
1132844710 16:1994733-1994755 TTGAGAGACACCAAGGTGGGTGG - Intergenic
1134312182 16:13084922-13084944 TTGAGAAAGACCAGGGTGGCTGG + Intronic
1141267353 16:82508995-82509017 CTGAGAAATACCCAGCTGCCTGG - Intergenic
1141308987 16:82894880-82894902 CTGAGAAATGCCAAGAAGGAAGG + Intronic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG + Intronic
1144888929 17:18482896-18482918 CTCAGAGAGACCAAGGTGGGGGG + Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1145853730 17:28131687-28131709 ATGAGAAATACCAAGCTCAAAGG - Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1148338663 17:46860000-46860022 CTGAGAAAAACATAGTTGGAGGG + Intronic
1148519877 17:48262797-48262819 CAATGAAATACCAAGGAGGAGGG - Intronic
1148670152 17:49404246-49404268 CTGAGAGGGACCAAGGTGGGGGG + Exonic
1148983661 17:51601360-51601382 CTGACAAATAGAAATGTGGAAGG - Intergenic
1148998053 17:51729174-51729196 TTGAGGAATAGCAAGGTGTAGGG - Intronic
1153725985 18:7955595-7955617 CTGAGAAATACCAAGCCTGGAGG - Intronic
1155040918 18:22065093-22065115 CTTTGAGAGACCAAGGTGGAAGG + Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1156057058 18:33019258-33019280 CTGAGACAAAGAAAGGTGGAGGG + Intronic
1156283100 18:35661161-35661183 TTGAGAATTTCCATGGTGGAGGG - Intronic
1156306735 18:35884639-35884661 CTAAGAAATACCAAGGAGATAGG - Intergenic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1157095689 18:44683644-44683666 ATGAGAAATAGCTAGCTGGATGG + Intronic
1157195414 18:45616852-45616874 CTTTGAAAGACCAAGGTGGGCGG + Intronic
1158316660 18:56218535-56218557 CTGAGAAAGACCAGTGTGGCTGG + Intergenic
1158324743 18:56302033-56302055 CTGAGAAGTGCCAAGGCTGAGGG - Intergenic
1159038322 18:63298585-63298607 CAGAGAAGGACAAAGGTGGAAGG + Intronic
1161676255 19:5651706-5651728 CTGGGAAACACCAGGGAGGAAGG - Intronic
1162748121 19:12810904-12810926 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1164297658 19:23927723-23927745 CTTAGAGAGACCAAGGTGGGAGG - Intronic
1165865532 19:38934871-38934893 CTGAGAAATAGAGAAGTGGAGGG + Intronic
925892151 2:8443489-8443511 GCAAGAAATACCAAGGTGGGGGG + Intergenic
926360929 2:12086069-12086091 CTGTGAGAGGCCAAGGTGGATGG + Intergenic
926569083 2:14509750-14509772 CTGAGTATTACCAAGGAAGAAGG - Intergenic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
930920246 2:56744483-56744505 TTAAGAAATAGCAAGGTGAAAGG + Intergenic
931410126 2:62021479-62021501 CTGAGAGAGACAAAGTTGGAGGG + Intronic
931580084 2:63762564-63762586 CTGAGAAATCCCAGGTTGAAAGG + Intronic
933075398 2:77918750-77918772 ATAAGAAAAACCAAGGTCGATGG + Intergenic
934706442 2:96484859-96484881 TTGAGTTATCCCAAGGTGGAAGG - Intergenic
934944785 2:98532212-98532234 CTGAAAAATACAAAGAGGGAAGG - Intronic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
937996707 2:127699575-127699597 CTGAGAAATACCAAGAAGTGAGG - Intergenic
938582056 2:132655297-132655319 CTGAGAAAGTCTAAGTTGGAGGG - Intronic
938994831 2:136667303-136667325 TTGAGAACTACCTAGTTGGATGG - Intergenic
940137521 2:150455380-150455402 GTGATAAATACCAAGAAGGAAGG + Intergenic
940883920 2:158972283-158972305 CTGAGAGATACCAAGATCAAAGG - Intronic
942517224 2:176766924-176766946 CTGAGGAAAACCATGGTGGTGGG - Intergenic
943895843 2:193358722-193358744 CTGACTAAAACCAAGGAGGAAGG - Intergenic
943941163 2:193999678-193999700 CCCACAAATACCAAGGTAGAAGG + Intergenic
944162322 2:196677449-196677471 CTGATGAATACCAAGCTGCAGGG + Intronic
944230029 2:197383227-197383249 CTTTGGAAGACCAAGGTGGAAGG + Intergenic
944304252 2:198160774-198160796 AAGAGAAATACCAAGCTGTATGG + Intronic
944973605 2:205022589-205022611 CTTAGAATTGCCAAGGTAGATGG + Intronic
946708453 2:222482620-222482642 CTTTGAGATGCCAAGGTGGAAGG - Intronic
947204725 2:227649940-227649962 CTTTGAAAGACCAAGGTGGGAGG + Intergenic
947373764 2:229474789-229474811 CTGAGAAGGAGCAAGGTGGTGGG - Intronic
1169181086 20:3567761-3567783 CTGTGACATACCAAGGCGGCAGG + Intronic
1169484610 20:6017601-6017623 CTAAGAATGTCCAAGGTGGAAGG - Intronic
1169526399 20:6431011-6431033 ATGAGAAATATAAAGGTGTAAGG + Intergenic
1169864674 20:10187085-10187107 CTTTGAAAGACCAAGGTGGAAGG + Intergenic
1170838740 20:19907003-19907025 CTGGGAAGTCCCAAGGTTGAGGG + Intronic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1173002495 20:39114583-39114605 CCCAGAAAGAACAAGGTGGAAGG - Intergenic
1173230049 20:41187710-41187732 CTGAGAAAAAACAAAGTTGAAGG - Intronic
1175119593 20:56707847-56707869 CTGAGGAATGCCAGGATGGATGG - Intergenic
1175175294 20:57108211-57108233 GTGAGAAATGCCATGGTGGCTGG - Intergenic
1176378281 21:6097889-6097911 CTGCGGCATCCCAAGGTGGAAGG + Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177022802 21:15884156-15884178 CTGAGAACTACTAAAGTGTATGG - Intergenic
1179745191 21:43440358-43440380 CTGCGGCATCCCAAGGTGGAAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181933561 22:26423183-26423205 CTGAGCAGTACCATGGTGGTTGG - Intergenic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1184593317 22:45500058-45500080 CTGAGAAGTCCCAATGGGGATGG - Intergenic
1184647120 22:45902351-45902373 CTGTGAGATGCCAAGGTGGGAGG - Intergenic
949401589 3:3670300-3670322 CTAAGAAAAACCAAGATGGGTGG + Intergenic
950421714 3:12903457-12903479 CAGAGGAATCCCAAGCTGGAAGG - Intronic
951218619 3:20046722-20046744 CTGACAAATACAAAGGTGTTGGG - Intronic
951840054 3:27024508-27024530 ATGAGAAATTTCAAGGGGGAAGG + Intergenic
952491270 3:33875998-33876020 CTCACAAATACCAAAGTGCATGG + Intergenic
953105069 3:39869901-39869923 ATGAGATATGTCAAGGTGGAGGG + Intronic
956334801 3:68151549-68151571 CTGAGTCATACCATGGTGGAAGG + Intronic
958749058 3:98173820-98173842 CTGAGAAATCCCAATGTCCAAGG + Intronic
958880630 3:99665104-99665126 CTGAGAAATGGCAACATGGAAGG - Intronic
959426949 3:106202107-106202129 CTGAAAAATACCCAGGAAGAGGG - Intergenic
959526813 3:107386785-107386807 CTGAGAAAAACTGAGGTGGAAGG - Intergenic
963219240 3:142788693-142788715 TTGAGAAATCCCAAGATGGCTGG + Intronic
963332210 3:143927150-143927172 CTAAGAAATCCCACAGTGGAAGG - Intergenic
963927008 3:150961251-150961273 CTGAGAATGACTGAGGTGGATGG - Intronic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
965542943 3:169888766-169888788 CTTAGGAATACAAAGGAGGATGG - Intergenic
966071731 3:175886057-175886079 GTGAGAAAAAGCAAGGTAGAGGG - Intergenic
967470253 3:189852665-189852687 TTCAGAAATACAAAGGTGGTGGG - Intronic
968074753 3:195810183-195810205 CTGAAACATCCCGAGGTGGAAGG + Intronic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
968635190 4:1674871-1674893 CTCAGAACTGCCAAGGGGGAGGG - Intronic
969778203 4:9375293-9375315 CTGAGATATTCCAAGGAGGAGGG - Intergenic
970213249 4:13732682-13732704 CAGAAAAATACCCAGGGGGATGG + Intergenic
974297825 4:60025545-60025567 CTGTGGAAGACCAAAGTGGAAGG - Intergenic
974624933 4:64413425-64413447 CTGAAAAATACCTAGTTGTAAGG + Intergenic
975499833 4:75072564-75072586 CAAAGAAATACCAAGGTCTAGGG - Intergenic
975525780 4:75349318-75349340 CTGAGAGTTACCAAGGAGAATGG - Intergenic
975696448 4:77018692-77018714 CTGAAAAAGACCAAGGTAGATGG - Intronic
977247521 4:94650733-94650755 CTTACAAATACAAAGGTGAAAGG - Intronic
977265534 4:94849199-94849221 ATGAGAAAAAGCAAGGTGTAGGG + Intronic
977286019 4:95107984-95108006 CTGAGAAGTACCGATTTGGAGGG - Intronic
978725311 4:111962658-111962680 TAGAGGAATAACAAGGTGGAGGG - Intergenic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
980912780 4:139008578-139008600 CTTTGGGATACCAAGGTGGATGG + Intergenic
981788630 4:148509773-148509795 CTTTGAGATACCAAGGTGGGTGG + Intergenic
981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG + Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
982336415 4:154244019-154244041 CTTTGAAAAACCAAGGTGTAAGG - Intronic
983272627 4:165581027-165581049 ATGAGAAATACAAGTGTGGAAGG + Intergenic
984375903 4:178928532-178928554 CTTTGGAACACCAAGGTGGATGG - Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
987316934 5:16732545-16732567 CTGAGAAATACAAATTAGGAGGG + Intronic
988531436 5:32030819-32030841 ATGAGAAATACCAAGGGGGTGGG - Intronic
988718173 5:33848276-33848298 CTGAGACACTCCAAGGTGGCTGG - Intronic
993229596 5:85216583-85216605 CTGAGAATTATCAAGCTGTATGG - Intergenic
993762104 5:91808151-91808173 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
996267529 5:121559918-121559940 TTGAGAGATAACAAAGTGGAAGG + Intergenic
997179351 5:131812452-131812474 CTGGAAATTACAAAGGTGGAAGG - Intronic
997502506 5:134387620-134387642 CTGTGACATCCCATGGTGGAAGG + Intronic
998713784 5:144857294-144857316 TTGACAAATATCAAGGTGGTAGG - Intergenic
999902373 5:156098860-156098882 CCAAGAGATACCAAGGTGGGTGG - Intronic
1000292455 5:159883171-159883193 ATGATAAAAACCAAGTTGGAAGG - Intergenic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1003045393 6:2728890-2728912 CTGAGAATCTCCACGGTGGATGG + Intronic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1006240482 6:32673402-32673424 CTTTGAAAGACCAAGGTGGGCGG + Intergenic
1006971896 6:38054135-38054157 CTTTGAGATACCAAGGTGGGAGG + Intronic
1009996977 6:70906776-70906798 CTGAGAAACCCAGAGGTGGAAGG - Intronic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1012550327 6:100458989-100459011 CTGAGAAATACCTGGCGGGACGG + Intronic
1012958335 6:105594617-105594639 CTGTGAAATAGCAAAATGGAGGG + Intergenic
1014758707 6:125330469-125330491 GTGAGAAAAACCAAGATGGATGG - Intergenic
1017385218 6:153875173-153875195 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1017399109 6:154039317-154039339 CTGTGAACTACTAAGGTGGGAGG + Intronic
1019828944 7:3306621-3306643 CTGAGATAAAACAACGTGGAAGG + Intronic
1019914018 7:4120225-4120247 CCGAGAAATTCCAGGGTTGATGG + Intronic
1021149262 7:17129242-17129264 CTGAGAAATCCCAAGGTCAAGGG - Intergenic
1021562897 7:21986562-21986584 GTGAGAATTACCAGGGAGGAAGG - Intergenic
1022162092 7:27721331-27721353 CTGAAAAATAGCAAGGAGGATGG + Intergenic
1022588550 7:31639189-31639211 CTGAAAAATCCCAAAGAGGAGGG - Intronic
1023059938 7:36317058-36317080 TTGAGAAATACTGATGTGGAGGG + Intergenic
1024229626 7:47354378-47354400 CTCAGAAAAACCAAGGAGAAAGG + Intronic
1027519699 7:79190131-79190153 CTGATTAATACCAAGGAGCATGG + Intronic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1028025642 7:85834793-85834815 CTGAGAATTACCTAGGTGATTGG - Intergenic
1029357083 7:100060176-100060198 CTTAGAAAGATCAAGGTGGCAGG + Intronic
1029990250 7:104956710-104956732 CTTTGAGATACCAAGGTGGGAGG - Intergenic
1035173406 7:157033504-157033526 CTGAGAAATGACAATGTGGGTGG + Intergenic
1035695141 8:1590352-1590374 CTGATAATTACCAAGATAGAGGG - Intronic
1035938509 8:3869201-3869223 CAGAGAAACACCGAGGTGGAGGG - Intronic
1036275659 8:7349289-7349311 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1036345694 8:7961068-7961090 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036841020 8:12121822-12121844 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036862828 8:12368074-12368096 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1037890185 8:22619936-22619958 AGGAGAAATACCAAGGTTGAGGG - Exonic
1039352137 8:36774517-36774539 CTCAGAAATACCAATAAGGAAGG + Intergenic
1042345371 8:67721314-67721336 CAGAGAAAGACCAAGTTGAAAGG - Intronic
1042420613 8:68584295-68584317 CTGAGAAAAAAAAAGTTGGATGG + Intronic
1043096937 8:75987379-75987401 CTTAGAAACACCAAGTTTGAAGG + Intergenic
1043207361 8:77462964-77462986 CTCAGGAATTCCAAGGTGGCTGG + Intergenic
1044913932 8:97091829-97091851 GTGAGAGATACAAAGATGGATGG + Intronic
1045432811 8:102128979-102129001 CAGGGAAGTCCCAAGGTGGAAGG + Intergenic
1047221489 8:122922176-122922198 CTAAGAAAGACCCAGGAGGAGGG - Intronic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1050045853 9:1544550-1544572 AAGAGAAATCGCAAGGTGGATGG - Intergenic
1050494338 9:6224966-6224988 CTGAGAAATACACAGGGGAAAGG - Intronic
1051322659 9:15925390-15925412 CTGAGAAAGACCAGTGTGGCTGG + Intronic
1052196197 9:25717891-25717913 GTAAGAAATACCAAAGTGGTTGG + Intergenic
1052656725 9:31372878-31372900 CTGAAAAATATCAAGATGGCTGG - Intergenic
1055189220 9:73497354-73497376 GGAAGAAATACCAGGGTGGATGG + Intergenic
1055632667 9:78239274-78239296 CTGAGAAAAACCAAGCTCAACGG - Intronic
1056105680 9:83344031-83344053 CAGAAAAATAGCAAGGTGGGAGG + Intronic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056508703 9:87282315-87282337 CTGAAAAAAACCAGGGGGGAGGG + Intergenic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1058398934 9:104590885-104590907 CTGAGGAATACAGAGGTGCATGG + Intergenic
1058537425 9:105976665-105976687 CTGTAATTTACCAAGGTGGAGGG + Intergenic
1060839013 9:126779716-126779738 CTAAGACAAACCAAGGTGCATGG + Intergenic
1186116512 X:6309831-6309853 CTGACTAATACAAATGTGGAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186669019 X:11750284-11750306 CTGCGACATACCAACGTGTATGG + Intergenic
1187094677 X:16134865-16134887 CAGAGAAATACCAAGGTAATAGG - Intronic
1187669196 X:21651640-21651662 ATGAGAATTTCCCAGGTGGAAGG - Intronic
1187943189 X:24401554-24401576 GTTAGAAATGTCAAGGTGGAAGG - Intergenic
1189212486 X:39295660-39295682 GGTAGAAAGACCAAGGTGGAAGG + Intergenic
1189675735 X:43458703-43458725 ATGAGAAACATCGAGGTGGATGG - Intergenic
1191644782 X:63468164-63468186 CTCAGAAATAACAAGAGGGATGG - Intergenic
1191665325 X:63696600-63696622 CTGAGAAATAACAAGGACCATGG - Intronic
1194046638 X:89014376-89014398 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1195323533 X:103740156-103740178 CTTAGAAATTCCAAGCTGGCTGG + Intergenic
1196717452 X:118824722-118824744 CTGAGAAATAACAAGGGGGACGG + Intronic
1198324463 X:135554571-135554593 CTGAGAACTAGCAAGGTAAATGG + Intronic
1198480041 X:137032972-137032994 CAGAGAAAAACCAAGGTGAGGGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199617406 X:149668475-149668497 CTTTGGGATACCAAGGTGGAAGG + Intergenic
1199625237 X:149734774-149734796 CTTTGGGATACCAAGGTGGAAGG - Intergenic
1201340163 Y:12925088-12925110 CTTAGAAAGACCAGGCTGGAGGG - Intergenic
1201604925 Y:15773750-15773772 CTGAGATATACCCTGATGGAAGG - Intergenic