ID: 964390146

View in Genome Browser
Species Human (GRCh38)
Location 3:156188164-156188186
Sequence ATAAACTTACCAAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964390146_964390150 1 Left 964390146 3:156188164-156188186 CCAGCTTCCCTTGGTAAGTTTAT 0: 1
1: 0
2: 1
3: 15
4: 179
Right 964390150 3:156188188-156188210 TTTTATGGCTTATCTCCCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 168
964390146_964390152 3 Left 964390146 3:156188164-156188186 CCAGCTTCCCTTGGTAAGTTTAT 0: 1
1: 0
2: 1
3: 15
4: 179
Right 964390152 3:156188190-156188212 TTATGGCTTATCTCCCTGTGGGG 0: 1
1: 0
2: 4
3: 13
4: 107
964390146_964390151 2 Left 964390146 3:156188164-156188186 CCAGCTTCCCTTGGTAAGTTTAT 0: 1
1: 0
2: 1
3: 15
4: 179
Right 964390151 3:156188189-156188211 TTTATGGCTTATCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964390146 Original CRISPR ATAAACTTACCAAGGGAAGC TGG (reversed) Intronic
900010197 1:99807-99829 ATACACTTTCCAATGAAAGCAGG - Intergenic
900026304 1:276370-276392 ATACACTTTCCAATGAAAGCAGG - Intergenic
900036089 1:410206-410228 ATACACTTTCCAATGAAAGCAGG - Intergenic
900057713 1:645958-645980 ATACACTTTCCAATGAAAGCAGG - Intergenic
900701116 1:4049185-4049207 ATGAATGTACCAAGGGAAGGAGG - Intergenic
903060862 1:20667684-20667706 GTTAGCATACCAAGGGAAGCAGG + Intronic
903088858 1:20890814-20890836 ATCAATATACCAAGGTAAGCTGG + Intronic
905073561 1:35249207-35249229 ATAAACTTAACCAAGGAGGCAGG - Intergenic
905508703 1:38501472-38501494 ATAAAGATACAAAGGGAAGTTGG - Intergenic
909855264 1:80521485-80521507 TTAAAATTACCAAGTGAGGCAGG - Intergenic
910291057 1:85600795-85600817 ATTAAGTTATCCAGGGAAGCTGG - Intergenic
911337401 1:96597299-96597321 ATAAGCTTGCAAAGGAAAGCTGG - Intergenic
913068820 1:115281803-115281825 ATAAACTTACCAAGAGCTGGGGG + Intergenic
913689244 1:121262858-121262880 ATGAAATTTCCAAGGGAATCAGG + Intronic
914148355 1:145017422-145017444 ATGAAATTTCCAAGGGAATCAGG - Intronic
915272860 1:154767507-154767529 ATAAACATACAAAGGTGAGCTGG + Intronic
915779466 1:158530419-158530441 ATAGACATACAAAGAGAAGCTGG + Intergenic
916174608 1:162027280-162027302 ATAAAATTAACCAGGGAAGAAGG - Intergenic
916819369 1:168383289-168383311 TTAAACTTAGCAAGTGAAGGAGG - Intergenic
920357383 1:205384287-205384309 ATAAGCCTTCCAAGGGAAGAAGG - Exonic
920476567 1:206281333-206281355 ATGAAATTTCCAAGGGAATCAGG + Intronic
921068893 1:211642837-211642859 GAAAACTAACCCAGGGAAGCAGG + Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
1063645238 10:7874477-7874499 TTATACTTACCAAGGGATGATGG + Intronic
1064083720 10:12329045-12329067 AGAAACTAACAAAGGGAAACAGG - Intergenic
1064156468 10:12907067-12907089 ATAAACTTGACAATGGAACCAGG - Intronic
1065340862 10:24703780-24703802 ATAAGCTTTCCAAGGGTATCCGG + Intronic
1065489114 10:26264994-26265016 ATTATCTTACCAAAGAAAGCAGG - Intronic
1067533183 10:47089202-47089224 ACAAACGTACCAAGAGAGGCTGG + Intergenic
1068738491 10:60441839-60441861 ATAAACTAACCAAGAGAATTTGG + Intronic
1069769216 10:70887224-70887246 AAAAACTTCCTAAGGCAAGCAGG + Intronic
1069948228 10:72001843-72001865 ATGAACTAAGCAAGGGAGGCAGG + Intronic
1070897713 10:79999234-79999256 ATAATATTACAAATGGAAGCAGG + Intergenic
1079840607 11:25394565-25394587 ATAAACATATCAAGGAAAACAGG + Intergenic
1081237927 11:40668476-40668498 ATAAAGTTCGCAAGGGAAGAAGG + Intronic
1084798966 11:71528573-71528595 AAAAACTTCCCAAAGGAAGATGG - Exonic
1085251874 11:75149394-75149416 ATAAACTTAGCCAGACAAGCTGG + Intronic
1088801571 11:113312008-113312030 ATAAAATTAATCAGGGAAGCAGG - Intergenic
1091488295 12:910765-910787 ACTTACTTACTAAGGGAAGCAGG - Exonic
1093234622 12:16591500-16591522 ATAAACTCTACAAGGGGAGCAGG + Intronic
1095991735 12:48039409-48039431 AGAAAGTTACAAAGGGAAGGGGG - Intergenic
1098102668 12:67035071-67035093 CTAAACTTTCCAAGGAAATCAGG - Intergenic
1099285669 12:80711457-80711479 ATTAATTTCCCAAGGCAAGCTGG - Intergenic
1102867132 12:116383288-116383310 ATAAACTTTCCCAAGGAGGCTGG - Intergenic
1104178699 12:126357349-126357371 ATATATGTACCAAGGGAAGAGGG + Intergenic
1106435998 13:29723176-29723198 ATAGAGTTACCATGGGAAGTAGG - Intergenic
1108685167 13:52813218-52813240 ATAAGCTGACAGAGGGAAGCAGG - Intergenic
1109922711 13:69089903-69089925 ATATCATTCCCAAGGGAAGCAGG + Intergenic
1110578575 13:77091109-77091131 ATAATTTTACCAAGGGACACAGG - Intronic
1110788347 13:79560129-79560151 AAAACTTTGCCAAGGGAAGCAGG + Intergenic
1111921821 13:94420421-94420443 ATAAACATAACAAGGGAAGGAGG + Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1122055090 14:99091994-99092016 AAACACTAACCAAGAGAAGCTGG + Intergenic
1123900355 15:24870716-24870738 ATAACCTCACTAAAGGAAGCTGG - Intronic
1127911320 15:63418426-63418448 ATAAACTCAGGAACGGAAGCAGG - Intergenic
1130425908 15:83799066-83799088 ATAAGCATTCCAAGGGAAGTAGG - Intronic
1130930907 15:88426975-88426997 TTACTCTTACCTAGGGAAGCGGG - Intergenic
1136870666 16:33804631-33804653 ATAAACTTTACAGGTGAAGCTGG + Intergenic
1137368404 16:47881456-47881478 ATAAACATAGCAAGGGAATAGGG + Intergenic
1138836775 16:60447055-60447077 ATAAAGTTACCAGGGGATTCTGG - Intergenic
1140536949 16:75718605-75718627 ATAAAATTACAAATGAAAGCAGG + Intronic
1142454141 16:90207113-90207135 ATACACTTTCCAATGAAAGCAGG + Intergenic
1203101506 16_KI270728v1_random:1311427-1311449 ATAAACTTTACAGGTGAAGCTGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1155311049 18:24524132-24524154 ATAAAAATACCAAGGGAAAATGG - Intergenic
1156604653 18:38652029-38652051 ATAAACTCGCAAAGCGAAGCAGG - Intergenic
1156858626 18:41812133-41812155 ATAAGGTCACAAAGGGAAGCAGG + Intergenic
1157249681 18:46083681-46083703 AGAAACTTACAAAGAGCAGCCGG + Exonic
1157511833 18:48280818-48280840 AAAAAATTACCTAGGAAAGCTGG - Intronic
1158009559 18:52713221-52713243 ATAAACTAGCCAAGGGAAAAAGG + Intronic
1159252999 18:65906277-65906299 ATAGACTTACCTATGGAAGCAGG + Intergenic
1159371532 18:67533090-67533112 GTATCCTTACCAAGGGACGCAGG - Intergenic
1160154227 18:76421272-76421294 ATAAACCTCCCAAGAGGAGCAGG + Intronic
1162719904 19:12656210-12656232 ATAAATTTTCCTGGGGAAGCGGG + Intronic
1166145259 19:40830128-40830150 ATCAACTTGGCAAGGGAAACTGG - Intronic
925724614 2:6860848-6860870 AATAACTTGCCAAGGTAAGCTGG - Intronic
926356837 2:12048431-12048453 GCAAACTTACCAGAGGAAGCAGG + Intergenic
926786900 2:16526894-16526916 ATAAACTTACCCAGTGTTGCTGG + Intergenic
926980723 2:18564422-18564444 ATAAACTATCCATGGTAAGCTGG + Intronic
927583314 2:24275140-24275162 ATAGATTTACCAAGGAAAGATGG + Intronic
929190150 2:39132215-39132237 ATAAACATTCCAAGAGAAGAAGG - Intergenic
929904013 2:46030363-46030385 TTAAACTTAGCTAGGGAAGCAGG - Intronic
930466134 2:51752128-51752150 TAAAACTTACCAAAGGAAGAAGG - Intergenic
930916667 2:56699550-56699572 ATAAAGTTAACAAGGGAGGCTGG - Intergenic
931269782 2:60691315-60691337 ATAAACTTTCCAACAGAAGGGGG - Intergenic
933054010 2:77638509-77638531 ATAAATTTAACAAAGGAAGTGGG - Intergenic
933457307 2:82532297-82532319 ACTAAATTACTAAGGGAAGCAGG + Intergenic
933699340 2:85243581-85243603 AGAAACTCAGCAAGGGAAGGGGG + Intronic
938094789 2:128454467-128454489 ATAAACTTACCTAGTCAAACTGG - Intergenic
938602626 2:132857821-132857843 GTAAACTTACAAAGGGAGCCAGG - Intronic
939062791 2:137444233-137444255 ATACATTCACCAAGGCAAGCTGG + Intronic
941017116 2:160370054-160370076 GGAAACTTAACAGGGGAAGCAGG - Intronic
943835935 2:192514060-192514082 ATAATATTATCATGGGAAGCTGG - Intergenic
949085594 2:242151775-242151797 ATACACTTTCCAATGAAAGCAGG + Intergenic
1172672334 20:36643007-36643029 GAAAACTTCCCAAGGGAGGCTGG - Intronic
1173085578 20:39912975-39912997 ATGAGCTTGCCTAGGGAAGCAGG + Intergenic
1173995893 20:47338399-47338421 CTAAACTTCCCAAGAAAAGCAGG + Intronic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1180606197 22:17060777-17060799 GTAAACTTTCCAAGGAAAGAAGG - Intergenic
1181382568 22:22518488-22518510 ATAAACATGCAAAAGGAAGCGGG + Intronic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949736425 3:7177488-7177510 ATAAACTTAAGAAGAGAAGAAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949991633 3:9584050-9584072 ATAAAATTAGCCAGGGAAGAAGG - Intergenic
950024978 3:9813960-9813982 CTTCACTTACCAAGGGCAGCGGG - Intronic
955067368 3:55544704-55544726 AGACCCTTACCAAGGGAGGCAGG + Intronic
955458932 3:59158177-59158199 ATAAATTTATCAAGAGAAACAGG + Intergenic
956518378 3:70076563-70076585 GTAAACTTGCCAATGGAATCAGG - Intergenic
956886093 3:73561441-73561463 ATATACTCACCAGGGAAAGCTGG + Intronic
961755885 3:129127194-129127216 ATAAACTGCCCAAGGGCAGATGG + Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
965193941 3:165569862-165569884 ATAAAATTATCAGGGGAAGAAGG + Intergenic
968224243 3:196963326-196963348 ATAAAGTTACCATAGGATGCAGG - Intronic
971735072 4:30438012-30438034 ATGAAGTTACCAAGTGATGCTGG + Intergenic
974878628 4:67727081-67727103 ATAAAATTAGCCAGGGAAGAAGG + Intergenic
975571312 4:75821029-75821051 AGAGACCTACCAAGTGAAGCCGG + Intergenic
977518108 4:98047262-98047284 ATAAACTGACAAGGAGAAGCTGG + Intronic
979936188 4:126699140-126699162 ATAAAGATAGCAAAGGAAGCAGG + Intergenic
982697071 4:158614477-158614499 AGAAAATTACAAAGTGAAGCAGG - Intronic
983285798 4:165737450-165737472 ATACTCTTACCAAAGTAAGCTGG - Intergenic
984564158 4:181307607-181307629 AAAAACTTAGCCAGGGAAGGCGG + Intergenic
984837850 4:184039255-184039277 TTAAGCCTACCAAGGGAAGCAGG - Intergenic
986525735 5:8673076-8673098 ATAAACTTAACAAGGAAACCAGG + Intergenic
986559138 5:9043253-9043275 ATGAAGTTACCACGAGAAGCAGG + Intronic
987118586 5:14745750-14745772 TTAACCTTACAAAGGGAAGCAGG + Intronic
987615249 5:20265957-20265979 ATAAACCAAAAAAGGGAAGCAGG + Intronic
988019714 5:25607549-25607571 ACAAAGTTACCAAAGGAAGCTGG + Intergenic
989130770 5:38104705-38104727 ATAAACATATCAACAGAAGCAGG - Intergenic
989981711 5:50653770-50653792 AGAAAATTACCAAGAGAATCAGG - Intergenic
992485757 5:77192708-77192730 ATACACTTACCATGGAAAGGTGG - Intergenic
993263747 5:85694705-85694727 TTAAATTGACCAAGGGAAGTTGG - Intergenic
993687731 5:90960877-90960899 ATAAACTTAGCAAGAGAAAGTGG + Intronic
996338809 5:122413717-122413739 TTTAACTTAGCAAGGAAAGCAGG - Intronic
996410691 5:123155805-123155827 ATAAAGACACCAAGGGAAGTAGG + Intronic
996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG + Intergenic
996667585 5:126078043-126078065 ATACACTAACCAAGGAAAGCTGG + Intergenic
1001252109 5:170154390-170154412 GATACCTTACCAAGGGAAGCAGG - Intergenic
1001477718 5:172062718-172062740 ATAAAGTTACCAAGGGTTGGAGG + Intronic
1002737732 5:181408658-181408680 ATACACTTTCCAATGAAAGCAGG + Intergenic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1011367690 6:86600486-86600508 ATAAACTCACAAAAGGAACCCGG - Intergenic
1011507156 6:88058235-88058257 ATAAAGTCACCAAAAGAAGCAGG - Intronic
1014244498 6:119053152-119053174 ATACACTCAGCAAGGGAAGCTGG + Intronic
1014559716 6:122875121-122875143 AGAAACTTACCCAAGGTAGCCGG - Intergenic
1018303771 6:162431767-162431789 AAAAATTTACCAAGTCAAGCAGG + Intronic
1019242830 6:170684215-170684237 ATACACTTTCCAATGAAAGCAGG + Intergenic
1020526434 7:9265796-9265818 ATAAACATACCAAGGAAGTCAGG + Intergenic
1022455368 7:30553925-30553947 ATAAACTGATAAAGGGAAGAAGG - Intergenic
1023582215 7:41695275-41695297 TTAAACTTACCATGGGATGGGGG + Intronic
1024736250 7:52307921-52307943 ATTAACTTACCAATAGGAGCTGG - Intergenic
1026999439 7:74642110-74642132 ATAAAATTACCATGCGAGGCTGG + Intergenic
1028291268 7:89067676-89067698 AAAATTTTACAAAGGGAAGCAGG + Intronic
1028708757 7:93882883-93882905 ATAAACTTACATATGGAAGCAGG - Intronic
1030906028 7:115183847-115183869 ATAAACGTACGAGGCGAAGCAGG + Intergenic
1031252470 7:119404657-119404679 ATAAACTCACAAATGTAAGCTGG + Intergenic
1031281536 7:119807915-119807937 ATAAACATACCAAGGGTCACAGG - Intergenic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1035505290 8:123940-123962 ATACACTTTCCAATGAAAGCAGG - Intergenic
1036466674 8:9004021-9004043 ATGCAATTACCAAGGGAGGCAGG - Intronic
1037323691 8:17667776-17667798 AGTAACTTCCCAAGGGAAGCTGG - Intronic
1037750596 8:21679613-21679635 ATTGACTAACAAAGGGAAGCGGG - Intergenic
1039474372 8:37831766-37831788 ATAAACTTACCATCTGAGGCCGG + Intronic
1040377576 8:46841363-46841385 CTACAATTACCAAAGGAAGCAGG - Intergenic
1040379789 8:46861297-46861319 CTACAATTACCAAAGGAAGCAGG - Intergenic
1042663046 8:71176857-71176879 ATATACTTACCAATGAAAGAAGG - Intergenic
1044208162 8:89516672-89516694 ATAAAGATACTAAGAGAAGCTGG + Intergenic
1048274730 8:133057683-133057705 TTAAACCTACAAAAGGAAGCAGG - Intronic
1052412654 9:28142236-28142258 ATAAACTTACTAAGGAATTCTGG - Intronic
1054451648 9:65406535-65406557 ATAAAATTAACCAGGGAAGAAGG - Intergenic
1058482467 9:105410663-105410685 ATAGAATTACCATGGGATGCAGG + Intronic
1203603021 Un_KI270748v1:33439-33461 ATACACTTTCCAATGAAAGCAGG + Intergenic
1185537829 X:876265-876287 ATAAAATTAACCAGGGAAGAAGG + Intergenic
1185970386 X:4655697-4655719 ATGACCTTACGAAGTGAAGCAGG + Intergenic
1187258742 X:17665866-17665888 AAAAACTTAGCAAGGGACACAGG - Intronic
1187858836 X:23663163-23663185 ATAAACTTACCAAGGCCACAAGG + Intergenic
1188121114 X:26309131-26309153 ATAAACTTTCCTGGTGAAGCTGG - Intergenic
1188372311 X:29384169-29384191 AGAAACTTAACATGGGAAACAGG + Intronic
1189193897 X:39135647-39135669 ATTTACTTACCAAGAGATGCAGG + Intergenic
1189456248 X:41193282-41193304 ATAAACTTACAAAGTTAAGGTGG - Intronic
1196841723 X:119865476-119865498 AAAAACTTAGCAAGGGATGGTGG - Intergenic
1198304131 X:135364184-135364206 AAAAACTTACCAAGGGAAGGGGG - Intergenic
1199497417 X:148468412-148468434 ATAAACTTACCAAGGTTTCCTGG + Intergenic
1200844358 Y:7816200-7816222 ATGAAATTAGCAAAGGAAGCAGG + Intergenic
1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG + Intergenic
1200901951 Y:8441679-8441701 CTAGAATTACCAAAGGAAGCAGG + Intergenic
1201184407 Y:11385507-11385529 ATATACTTACCAAGAAAAGGTGG + Intergenic
1202246028 Y:22821209-22821231 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202252895 Y:22891372-22891394 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202255400 Y:22915347-22915369 CTACAATTACCAAAGGAAGCAGG - Intergenic
1202399016 Y:24454957-24454979 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202405884 Y:24525121-24525143 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202408391 Y:24549096-24549118 CTACAATTACCAAAGGAAGCAGG - Intergenic
1202462391 Y:25120984-25121006 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202464896 Y:25144961-25144983 CTACAATTACCAAAGGAAGCAGG - Intergenic
1202471764 Y:25215129-25215151 CTAAAATTACTAAAGGAAGCAGG + Intergenic