ID: 964402546

View in Genome Browser
Species Human (GRCh38)
Location 3:156314297-156314319
Sequence AACCCAATGCATGTTAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964402546 Original CRISPR AACCCAATGCATGTTAACAC TGG (reversed) Intronic
901914216 1:12485777-12485799 AGTCCAATTCATGTTAACACTGG + Intronic
906576802 1:46898530-46898552 AACCCACTGTATGTTCACAGTGG + Intergenic
907920510 1:58906878-58906900 AAACCAATGCATTTTAACACAGG - Intergenic
917236113 1:172893366-172893388 ATCACAGTGCATGTTAGCACTGG - Intergenic
923868246 1:237963262-237963284 AACCCCATGCATTTCACCACAGG + Intergenic
923890653 1:238211883-238211905 AACTCAATGCATCTTAAAAATGG + Intergenic
924925941 1:248680660-248680682 AACACATTGAATATTAACACAGG + Intergenic
1062864258 10:836937-836959 AACCCAATTTATGTAAAAACTGG - Intronic
1071116878 10:82232307-82232329 CATCCAATCCATGTTAAAACAGG - Intronic
1072299901 10:94050006-94050028 AACCAAATGACTGTTAACAGGGG - Intronic
1076434117 10:130427794-130427816 AACCCACTGCATAGAAACACAGG - Intergenic
1080592004 11:33732590-33732612 CACCAAATGGAAGTTAACACAGG - Intronic
1084643612 11:70441266-70441288 AACCCAAAGCATTTAAAAACGGG + Intergenic
1086041757 11:82487531-82487553 TACCCCAAGCATATTAACACAGG - Intergenic
1086558433 11:88139638-88139660 AACACAATGCATCTTAACCAGGG + Intronic
1087346567 11:96979069-96979091 AACACAATGCATAATTACACTGG + Intergenic
1088760500 11:112924655-112924677 AACCCAAAGCAGGTGAACGCGGG + Intergenic
1089328143 11:117671488-117671510 ACCCCAATGCCTCTTAACAGAGG + Intronic
1092128018 12:6088861-6088883 AACCCAATGCCTGTCTCCACTGG - Intronic
1092853984 12:12655936-12655958 AACACAAAGCATTTAAACACTGG - Intergenic
1093955176 12:25208705-25208727 TAACCAATGCATGACAACACTGG + Intronic
1098856588 12:75659525-75659547 AACACACTGCTTGATAACACAGG - Intergenic
1098874145 12:75849467-75849489 CAACCAATGCATGTCAAAACTGG - Intergenic
1104781731 12:131425809-131425831 AACCCCATGCATTTCACCACAGG - Intergenic
1106973649 13:35178087-35178109 AACAGAATGCAGATTAACACAGG + Intronic
1108199913 13:48032670-48032692 AACCTAATGACTGTTAACAAGGG + Intergenic
1111646067 13:91033460-91033482 AATCCAATCTATGTTTACACAGG + Intergenic
1112829627 13:103433103-103433125 AGCCCAATGCATGTGGACATTGG + Intergenic
1114142452 14:19929766-19929788 AAACAAATGCTTGTTGACACTGG + Intergenic
1114653635 14:24302776-24302798 CACCCAATGCATGAGACCACAGG - Intronic
1126754790 15:51915560-51915582 AAAGCAATGAATTTTAACACTGG + Exonic
1128767507 15:70260104-70260126 AGCACAATGCATGGTCACACAGG - Intergenic
1133431419 16:5740215-5740237 CACCTGATGAATGTTAACACCGG - Intergenic
1134413900 16:14027520-14027542 AAATGAATGCATGTAAACACTGG + Intergenic
1135519738 16:23166362-23166384 AAATGAATGCATGTTAAAACTGG - Intergenic
1143451731 17:7040796-7040818 GACCCAAGGCATTTTAACCCTGG + Intergenic
1149556775 17:57579057-57579079 AAACCAATGCATGTTGACAGCGG - Intronic
1151518011 17:74609230-74609252 AAACCAATGTATGTTAAAAACGG + Intergenic
1153482599 18:5562637-5562659 AACCCAATCAATGTTAACCATGG + Intronic
1157438257 18:47689592-47689614 CAGCCAATGCATTTTAACTCAGG + Intergenic
1158701142 18:59748404-59748426 AACCCCCTGCATTTTAACACTGG + Intergenic
1159400416 18:67925406-67925428 ATCCCATTGCTAGTTAACACTGG + Intergenic
1160414697 18:78700294-78700316 GCTCCCATGCATGTTAACACAGG - Intergenic
1163881607 19:19928045-19928067 TATCCAAAACATGTTAACACAGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
926818338 2:16823912-16823934 AACCCCATGCATTTTTACAAAGG + Intergenic
932606803 2:73170768-73170790 AATCCAATGAATGTTAACTAGGG - Intergenic
933925625 2:87089642-87089664 AATCCAATGAATGTTAACTAGGG + Intergenic
936560502 2:113534946-113534968 AACACATTGCATTTTAACATAGG - Intergenic
941485115 2:166070818-166070840 AAACTAATGCATGTTGACAAAGG - Intronic
942348101 2:175024404-175024426 AGCCCAATGCATTTTTACATGGG - Intergenic
945193225 2:207212153-207212175 AATCCTAAGCAAGTTAACACAGG + Intergenic
1170639580 20:18139541-18139563 AACCCAGAGAATTTTAACACAGG + Intronic
1173414957 20:42847121-42847143 AATCCAAGGCAAGTTAACAAAGG + Intronic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1179049177 21:37874161-37874183 AGCCCAATGGATGTCATCACTGG + Intronic
1179852264 21:44144293-44144315 AACACCATGCATGTAACCACTGG - Intronic
1182126647 22:27820946-27820968 AACCCAATGCCTGGTCCCACAGG + Intergenic
951002524 3:17580453-17580475 AACCAAATGCTTTTTAACAATGG + Intronic
953234234 3:41092179-41092201 GACCCCATGCATGTCCACACTGG - Intergenic
953517364 3:43607905-43607927 AAACCATTGAATGATAACACAGG + Intronic
956154344 3:66279270-66279292 AACACAGTGAATATTAACACAGG - Intronic
960031513 3:113059147-113059169 AACCCAATGCATCTCAGCCCTGG - Intergenic
964402546 3:156314297-156314319 AACCCAATGCATGTTAACACTGG - Intronic
967001258 3:185337565-185337587 CACCCATTTTATGTTAACACAGG - Intronic
972334001 4:38089783-38089805 ATGCCAATGCATATTAACACAGG + Intronic
972905454 4:43741284-43741306 AACTCATTACATGTTAACATAGG - Intergenic
974769818 4:66397494-66397516 AAACCACTGCATGAAAACACTGG - Intergenic
976681184 4:87757913-87757935 AGCACAATGGATGTAAACACGGG + Intergenic
976802569 4:89009008-89009030 AACCTAATGGAAGTTAACAAAGG - Intronic
977484331 4:97623060-97623082 AGCCCTATGCAGGTTAAAACTGG + Intronic
980708606 4:136534108-136534130 AAACCTAAGCATATTAACACAGG + Intergenic
986962139 5:13226987-13227009 AACACAATGCTTTTTAAAACAGG + Intergenic
996855561 5:128002339-128002361 AACACATTGCTTGTTACCACTGG - Intergenic
996942237 5:129021977-129021999 AAAACAAAGCATGTTAAAACAGG + Intronic
1002587410 5:180258638-180258660 AACCCAATGAATGTCAAAAATGG + Intronic
1003408442 6:5841904-5841926 TACCCAATCCATTTGAACACAGG + Intergenic
1007206524 6:40156777-40156799 AACCCTAGGCCAGTTAACACAGG + Intergenic
1011109606 6:83822381-83822403 AACCCAATGGATGATAATATTGG + Intergenic
1014398727 6:120960257-120960279 CACCTAATGCATGTGGACACTGG - Intergenic
1017434401 6:154402404-154402426 AATCCAAAGCATATTAAAACTGG - Exonic
1017765707 6:157605481-157605503 AGCCCATTGCTTGGTAACACAGG - Intronic
1022962781 7:35445578-35445600 AACCCATAAGATGTTAACACTGG + Intergenic
1023942950 7:44781772-44781794 AACACAAGGCATCTAAACACAGG - Intergenic
1024205398 7:47155129-47155151 AACCTAATGCTTGATAACTCTGG - Intergenic
1024525147 7:50342177-50342199 AACCCAATTGATGTTAAAATTGG - Intronic
1028446983 7:90935627-90935649 AACAGAATGCATGTTATCATTGG - Intronic
1037462504 8:19126317-19126339 AACCCATTATATGTTAACATAGG + Intergenic
1044953902 8:97459969-97459991 TTCCCTATGCATGTAAACACAGG + Intergenic
1046024374 8:108704387-108704409 AACCCAATGCAGGTTAAGAGCGG + Intronic
1046217359 8:111165431-111165453 AACCGAATGAATGTTAACCACGG - Intergenic
1049892179 9:80399-80421 AACACATTGCATTTTAACATAGG + Intergenic
1050106132 9:2168625-2168647 AAACCAATGGATCTTTACACTGG + Intronic
1051608500 9:18939444-18939466 TACACAATGCATGATAAGACAGG + Intronic
1052566383 9:30158453-30158475 AACTCAATGAATGTTCACAAAGG + Intergenic
1053733600 9:41081487-41081509 AACACATTGCATTTTAACATAGG + Intergenic
1054694815 9:68350072-68350094 AACACATTGCATTTTAACATAGG - Intronic
1055472887 9:76631267-76631289 ATTCCAGTGAATGTTAACACTGG - Intronic
1060200070 9:121647117-121647139 AACCCAAGGCTTCTTAACAGAGG - Intronic
1203790218 EBV:147432-147454 AACCCAAGGCAGGTAAACATTGG - Intergenic
1190520532 X:51275129-51275151 ATCCCAATGTATGTTAAAATAGG - Intergenic
1194346661 X:92773638-92773660 AACCCTATGCATGCACACACTGG - Intergenic
1194353114 X:92846319-92846341 AACAAAATGCATTTTAATACAGG + Intergenic
1195307773 X:103602648-103602670 AACCTAATGAGTGTTAACAATGG + Intergenic
1200654995 Y:5890282-5890304 AACCCTATGCATGCACACACTGG - Intergenic
1200661470 Y:5963414-5963436 AACAAAATGCATTTTAATACAGG + Intergenic
1201528933 Y:14970256-14970278 AACCAACTGAATATTAACACAGG - Intergenic