ID: 964403583

View in Genome Browser
Species Human (GRCh38)
Location 3:156325088-156325110
Sequence GTGAAATACCTTACACCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964403583 Original CRISPR GTGAAATACCTTACACCTAC TGG Intronic
903149441 1:21395368-21395390 ATGAAAAATCTTACAACTACTGG + Intergenic
906331683 1:44890318-44890340 ATGAAAAATCTTACAACTACTGG + Intronic
908284608 1:62581711-62581733 GTGGAATGCCTTACACTTACGGG + Intronic
908689414 1:66761126-66761148 GTAAAATACCTAAAAACTACAGG + Intronic
911278915 1:95899254-95899276 ATGAAAAATCTTACAACTACTGG - Intergenic
913360623 1:117976432-117976454 CAGAAATATCTTCCACCTACAGG - Intronic
916036062 1:160923542-160923564 ATGAAAAATCTTACAACTACTGG - Intergenic
917703830 1:177611610-177611632 GAGAAATATCTTTCCCCTACAGG - Intergenic
921059608 1:211573276-211573298 GTGAAATAACTCAAACCTAAAGG + Exonic
924098331 1:240577802-240577824 GTGAATTTCCATAAACCTACAGG - Intronic
1066644931 10:37596764-37596786 TTGAACTCCCTTAAACCTACTGG - Intergenic
1074784982 10:116831143-116831165 GTGAAAGCACTTACACTTACTGG + Intergenic
1075265030 10:120992861-120992883 ATGAAAAATCTTACAACTACTGG + Intergenic
1080209839 11:29772852-29772874 GTGAAATACATTTCACCCATTGG - Intergenic
1080288424 11:30642388-30642410 ATGAAAAATCTTACAACTACTGG + Intergenic
1080961277 11:37163495-37163517 GTGAAATACCTTCTATGTACAGG + Intergenic
1090124482 11:124071510-124071532 GTGAAATACCTAACATCGGCCGG + Intergenic
1090292421 11:125556774-125556796 ATGAAAACCCTTACAACTACTGG + Intergenic
1090455630 11:126846298-126846320 ATGAAAAATCTTACAACTACTGG + Intronic
1090513597 11:127400897-127400919 GTGAAATGCCTGTCACCTAACGG + Intergenic
1091082395 11:132682857-132682879 GTGAAAGACCTTCCACATGCAGG - Intronic
1092653304 12:10657308-10657330 ATGAAAAATCTTACAACTACTGG + Intronic
1096008532 12:48192838-48192860 ATGAAAAGCCTTACAACTACAGG - Intergenic
1098294100 12:68986410-68986432 ATGAAACATCTTACAACTACTGG + Intergenic
1101397390 12:104360324-104360346 GTGAATGACCTGACACCCACTGG + Intergenic
1102691916 12:114768074-114768096 GTGAAATACATTCCATCTAGAGG + Intergenic
1105425040 13:20286619-20286641 ATGAAACATCTTACAACTACTGG + Intergenic
1107311604 13:39083925-39083947 ATGAAAAATCTTACAACTACTGG + Intergenic
1107522827 13:41200564-41200586 GTGAAATACTTTACACATTACGG - Intergenic
1108721904 13:53140882-53140904 GTTAAATTGGTTACACCTACAGG + Intergenic
1109041814 13:57348051-57348073 GTGAAATACAATACAGCAACAGG + Intergenic
1109784236 13:67153619-67153641 GTGAAATGCCTTACACATTAAGG + Intronic
1110335586 13:74326701-74326723 GTGACATACATCACTCCTACAGG + Intergenic
1111284600 13:86072229-86072251 GACAAATACCTAACACATACGGG + Intergenic
1112904916 13:104405453-104405475 GTGAATTACTTTTCACCTTCTGG - Intergenic
1113236205 13:108277955-108277977 GTAAAATAACTGAGACCTACTGG - Intronic
1114790079 14:25648602-25648624 GTGATAAGCCTTACAACTACAGG - Intergenic
1115164451 14:30431808-30431830 TTCAAATACATTTCACCTACTGG + Intergenic
1118537866 14:66789463-66789485 GTGAAAAACCTTTTAACTACTGG - Intronic
1119305392 14:73604131-73604153 ATGAAAAATCTTACAACTACTGG - Intergenic
1123477945 15:20604376-20604398 ATGAAAAATCTTACAACTACTGG + Intergenic
1123640069 15:22396007-22396029 ATGAAAAATCTTACAACTACTGG - Intergenic
1124039407 15:26086473-26086495 ATGAAAAATCTTACAACTACTGG - Intergenic
1131995587 15:98129853-98129875 GTGAAATAACAGACATCTACTGG + Intergenic
1133419541 16:5634204-5634226 TTGATATACCTGACAGCTACTGG + Intergenic
1133573284 16:7063276-7063298 GGGGAATATCTTACTCCTACAGG - Intronic
1134609295 16:15595394-15595416 GTGGAAGACCTTACGCCAACAGG + Exonic
1140416844 16:74780264-74780286 GTGAAATTTCTTATACCTATGGG + Intergenic
1141199580 16:81886904-81886926 GTGCAATACCCTACACCAAGTGG + Intronic
1144715099 17:17428553-17428575 GTGAAAAATTTTACAACTACTGG + Intergenic
1150158188 17:62871623-62871645 GTGAAATGCCTGACCCCTATTGG + Intergenic
926487460 2:13479629-13479651 GTTAAATAACTTACAACTCCAGG + Intergenic
928382379 2:30829749-30829771 ATGAAAAACCTTACAACTACTGG + Intergenic
928459219 2:31455098-31455120 GTGAAAAATCTTACAACTACTGG - Intergenic
930498316 2:52176904-52176926 ATGAAAAATCTTACAACTACTGG + Intergenic
934861050 2:97763781-97763803 GTGAAACACATTCCACCCACAGG - Intronic
935377102 2:102410656-102410678 ATGAAAAATCTTACAACTACTGG + Intergenic
938700601 2:133875794-133875816 ATGAAAAATCTTACAACTACTGG - Intergenic
940014540 2:149089763-149089785 TTAAAATGCCTTACAGCTACAGG - Intronic
941828284 2:169924488-169924510 GTGAATTACCTTAAACCTTGCGG - Intronic
941829791 2:169942898-169942920 GTGAAATACCGTGGAACTACAGG + Intronic
943227381 2:185195473-185195495 GTAAAATATTTTACACCTATAGG - Intergenic
944519899 2:200555318-200555340 ATGAAAAATCTTACAACTACTGG - Intronic
1169926313 20:10788113-10788135 GAGAAATACCTTACTCCTTTGGG - Intergenic
1170927514 20:20738861-20738883 ATGAAAAACCTTACAACTACTGG + Intergenic
1171069631 20:22055577-22055599 GTGAAATAAATTAAACCGACAGG - Intergenic
1171442078 20:25173205-25173227 ATGAAAAACCCTACAACTACTGG - Intergenic
1178085667 21:29109409-29109431 GTGAAATACTTAACACCTCCTGG - Intronic
1178466854 21:32857027-32857049 ATGAAAAATCTTACAACTACTGG - Intergenic
1183325766 22:37192805-37192827 ATGAAAAATCTTACAACTACTGG - Intronic
953153686 3:40348338-40348360 ATGAAAAGCCTTACAACTACTGG + Intergenic
958968408 3:100585030-100585052 ATGAAAAATCTTACAACTACTGG - Intergenic
959593781 3:108106809-108106831 GACAAATACCTAACACATACAGG + Intergenic
963350991 3:144150756-144150778 GTGAAGTACCTGGCACATACTGG + Intergenic
963561865 3:146875987-146876009 CTGAAAAACCTTACTCCTATAGG - Intergenic
964403583 3:156325088-156325110 GTGAAATACCTTACACCTACTGG + Intronic
964855846 3:161144380-161144402 TGGAAAAACCTTACAACTACTGG + Intronic
965869221 3:173246846-173246868 ATGAAAAATCTTACAACTACTGG - Intergenic
970606828 4:17689048-17689070 GTGGAATACTATAAACCTACTGG - Intronic
980128601 4:128797632-128797654 GTGAGATACATAACACATACAGG - Intergenic
981233680 4:142389288-142389310 ATGAAAAATCTTACAACTACTGG + Intronic
981663293 4:147192490-147192512 TTGAAATACCTTGCTCCTTCTGG - Intergenic
982606784 4:157525925-157525947 ATGAAAAATCTTACAACTACTGG - Intergenic
988348087 5:30066256-30066278 GAGAAATACATTACACCTAGAGG - Intergenic
988569030 5:32345439-32345461 ATGAAAAATCTTACAACTACTGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
992167056 5:74063968-74063990 ATGACATACCATACACCCACTGG + Intergenic
994562723 5:101396397-101396419 ATGAAATATCTTACAACTACTGG + Intergenic
995320400 5:110826873-110826895 ATGAAAAATCTTACAACTACTGG + Intergenic
999501805 5:152154415-152154437 GAGAAATACCTAATGCCTACGGG - Intergenic
1000583676 5:163066896-163066918 GTAAAATACTTTATACCTAGTGG - Intergenic
1001403399 5:171459864-171459886 GTGATGTGCCTTACACCTAGAGG + Intergenic
1009990379 6:70835857-70835879 ATGAAAAAACCTACACCTACTGG - Intronic
1010333549 6:74653705-74653727 GTGAAATACATTACACATTTTGG + Intergenic
1010810832 6:80297495-80297517 ATGAAAAATCTTACAACTACTGG - Intronic
1013546680 6:111165068-111165090 ATGAAAAATCTTACAACTACTGG - Intronic
1014094321 6:117443611-117443633 TTGAGATAGCTTACACTTACAGG - Intronic
1016486661 6:144547114-144547136 ATGAAATACCCTACATCCACAGG - Intronic
1016702338 6:147067674-147067696 GTGAAAAACCTGAAACCAACAGG + Intergenic
1017395547 6:153995195-153995217 GTGAAATGTCATACACTTACTGG - Intergenic
1020646999 7:10826423-10826445 ATGAAAAATCTTACAACTACTGG + Intergenic
1020848032 7:13311986-13312008 GTGAAAAATCTTACAACTACCGG + Intergenic
1020956220 7:14742274-14742296 ATGAAAAATCTTACAACTACTGG + Intronic
1021775243 7:24048070-24048092 GTGAAATCCCTTACATTGACGGG + Intergenic
1024997558 7:55284858-55284880 ATGAAAAATCTTACAACTACTGG - Intergenic
1037916346 8:22775568-22775590 TTGGAATTCCTCACACCTACAGG - Intronic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1043262081 8:78214363-78214385 GTGATATTCCTAACACCTTCAGG - Intergenic
1047270274 8:123351345-123351367 GTTAAACATCTTACACGTACAGG - Intronic
1049992583 9:1003782-1003804 GTGAAATATTTTGCCCCTACAGG + Intergenic
1050270388 9:3938229-3938251 GAGAAATACGGAACACCTACTGG + Intronic
1050401550 9:5261693-5261715 ATGAAAAATCTTACAACTACTGG - Intergenic
1053077279 9:35143512-35143534 ATGAAAAATCTTACAACTACTGG + Intergenic
1056728084 9:89140206-89140228 ATGAAAAATCTTACAACTACTGG - Intronic
1057223148 9:93268507-93268529 GTGAACTCCTTTACACCTATGGG - Intronic
1186397578 X:9225347-9225369 ATGAAAAATCTTACAACTACTGG - Intergenic
1190477961 X:50847071-50847093 ATGAAAAATCTTACAACTACTGG - Intergenic
1192714336 X:73623930-73623952 ATGAAAACCCTTACAACTACTGG - Intronic
1192864774 X:75118986-75119008 ATGAAGAACCTTACAGCTACAGG + Intronic
1192894914 X:75432232-75432254 GTAAAATACCTTTCATCTAAAGG - Intronic
1194379938 X:93179168-93179190 ATGAAAAATCTTACAACTACTGG + Intergenic
1194821529 X:98512595-98512617 GTGAAATACCTTACAGGGCCTGG + Intergenic
1197542600 X:127783956-127783978 GAGCAATACCTTACAAGTACTGG - Intergenic
1199289813 X:146093264-146093286 GGGAAGTACCTTCCACCTATTGG + Intergenic
1199359219 X:146898085-146898107 GTGAAACACATTACACCTCGGGG - Intergenic
1200973631 Y:9182715-9182737 TTTAAATGCCTTACATCTACTGG + Intergenic