ID: 964403826

View in Genome Browser
Species Human (GRCh38)
Location 3:156327987-156328009
Sequence GAGCATAATTCCATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964403826 Original CRISPR GAGCATAATTCCATGGAGTC AGG (reversed) Intronic
901626003 1:10625481-10625503 GACAATCTTTCCATGGAGTCTGG + Intronic
903018890 1:20379849-20379871 GAGCAGGATTACATGGAGCCTGG - Intergenic
905494910 1:38377384-38377406 CAGCATCATTCCTGGGAGTCTGG + Intergenic
906292457 1:44628100-44628122 GATCAGAATTCCCTGGGGTCTGG - Intronic
907014870 1:51002794-51002816 GAGCATGCTTCCATGATGTCTGG - Intergenic
908757709 1:67484344-67484366 GAACATAAGTCCAAGGAGTTGGG + Intergenic
911857793 1:102903628-102903650 GAGCATATTTCTATGCAGTAAGG - Intronic
912968273 1:114256445-114256467 GATGATAATGCCATTGAGTCAGG + Intergenic
916188852 1:162159759-162159781 GAGCATAAACCCATGAAATCTGG + Intronic
919450354 1:197765013-197765035 TAGTATAATCCCATGGAGTATGG - Intronic
1065164897 10:22966193-22966215 GGGGAGAACTCCATGGAGTCAGG - Intronic
1066474196 10:35728771-35728793 GAGCAGAATTCCAGGGTTTCTGG - Intergenic
1067686989 10:48471637-48471659 GAGGCTAACTCCATGGTGTCTGG - Intronic
1070240309 10:74673848-74673870 GAAGATAATCCCCTGGAGTCCGG + Intronic
1073149030 10:101299101-101299123 TAGCAGAATTCCATGGTGACTGG - Intergenic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078781126 11:14440546-14440568 GACCATAATTCCATGAAGGTAGG + Intergenic
1082661793 11:55920719-55920741 GAGCATACAAGCATGGAGTCTGG - Intergenic
1083589962 11:63888093-63888115 GAGCATAATTTCAGGGAGTTTGG - Intronic
1084617294 11:70245007-70245029 AAACAAAATTCCATGCAGTCTGG - Intergenic
1084961133 11:72717293-72717315 GAGCAGAATTCCAAGCTGTCAGG + Intronic
1086224778 11:84494583-84494605 GAGCAAAATTCCAAGGGGTCCGG + Intronic
1086502472 11:87467438-87467460 TAGCACAATTCCATGGAGCAGGG + Intergenic
1090317240 11:125803735-125803757 GAGCATAGGTCCATGGGGGCTGG + Intergenic
1090575307 11:128095712-128095734 GAGCATAATGTCATGGAAACAGG - Intergenic
1093144494 12:15548887-15548909 CAGCATTATTCCATGTTGTCAGG - Intronic
1095232701 12:39760523-39760545 GAGAATAATTCCCTCTAGTCAGG - Intronic
1096502996 12:52076698-52076720 GAGCATAATTCCCTGGGGTGTGG + Intronic
1098243342 12:68490063-68490085 GAGTATATTTGCATGGACTCGGG + Intergenic
1102428017 12:112859783-112859805 GAGAATAATTCTATGGGGTTGGG - Intronic
1102716740 12:114980339-114980361 GAGCATATATCCATGGTGCCTGG - Intergenic
1102790709 12:115643060-115643082 CAGCATGACTCCATGGAGCCAGG - Intergenic
1103194123 12:119027220-119027242 GATCACAATTCCCAGGAGTCTGG - Intronic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1110728552 13:78853448-78853470 GAGCCTGAGTCCATGGAGGCTGG - Intergenic
1118888683 14:69888530-69888552 GAGCAAAGTTCCATGAGGTCAGG + Intronic
1119965424 14:78910231-78910253 GAGTATAAATCCAAGCAGTCAGG - Intronic
1121960355 14:98253797-98253819 GAGCATCAAACCATGGGGTCCGG - Intergenic
1127386148 15:58468780-58468802 TAGCAGAGTTCCATGGAGTCTGG - Intronic
1131747900 15:95469641-95469663 GAGCCTAATGCCATTAAGTCAGG - Intergenic
1132019643 15:98349218-98349240 GAGCACAATTCCATGGGGTGGGG - Intergenic
1139177046 16:64701065-64701087 GAGCCTAAGTCCTTGGAGGCGGG - Intergenic
1144034037 17:11349447-11349469 TAGCAGAAGTCCATTGAGTCAGG + Intronic
1146275468 17:31513136-31513158 GAGCATACTTCCAAGTAGACTGG - Intronic
1149237772 17:54612970-54612992 GACCATAATTCAATGGGGTCAGG - Intergenic
1158767328 18:60469454-60469476 GAGCACAACTCCTTGAAGTCTGG - Intergenic
1159858260 18:73615182-73615204 AAGATTAATTCCATGGAGGCTGG - Intergenic
1164690164 19:30204943-30204965 GAGCATGATTCCTGGGAGACAGG + Intergenic
1164944237 19:32279436-32279458 GAGAATAATTCCATGACCTCTGG + Intergenic
1165393713 19:35552564-35552586 GACCATAAGTCCAGGCAGTCTGG + Intronic
929946865 2:46378270-46378292 GAGCTTATTTCAATGGAGTTGGG - Intronic
930523099 2:52492723-52492745 AAGCATATTTCCATGGTCTCTGG + Intergenic
935008842 2:99111721-99111743 GAACATAATTACATAGAGTTTGG + Intronic
941839175 2:170061339-170061361 AAGCATTTTTCCATGGATTCAGG - Exonic
947194730 2:227550435-227550457 CTGCATTATTCCATGGAGTTTGG + Intronic
948611984 2:239175909-239175931 GAAGATAAATCCATGGACTCTGG + Intronic
1178859128 21:36274550-36274572 GAGCATAGAGCCTTGGAGTCTGG + Intronic
951377557 3:21939272-21939294 GAACATAATTGCATTTAGTCAGG + Intronic
953414317 3:42706958-42706980 GAGCATTAGGTCATGGAGTCTGG - Intronic
953507170 3:43497630-43497652 GAGCCTAAGTCCCTGGAGTGAGG + Intronic
953886248 3:46715819-46715841 CAGCATCATTCCATGGTGACAGG - Intronic
954688240 3:52382218-52382240 GAGCAGAATTCCAGGTGGTCAGG + Intronic
954832215 3:53431467-53431489 GAGTATAATTCCATGTGGGCAGG - Intergenic
958856493 3:99392320-99392342 GAGCAGATTACCATGGACTCGGG - Intergenic
964343352 3:155731200-155731222 GAGCCTAAGTCCATGGGGGCTGG - Intronic
964403826 3:156327987-156328009 GAGCATAATTCCATGGAGTCAGG - Intronic
978773878 4:112486270-112486292 GAGAATAATTCCATGTATCCAGG - Intergenic
980669477 4:135986027-135986049 CAACATCATTCCATGGAGGCAGG + Intergenic
986870229 5:12036751-12036773 GAACATAATTCCATTGACTTGGG + Intergenic
995659594 5:114465907-114465929 AAGCAGATTCCCATGGAGTCAGG + Intronic
996666209 5:126063271-126063293 GAACATACTTCCATGGAGTAGGG + Intergenic
996988742 5:129601990-129602012 GAGGTTACTTCCAAGGAGTCAGG + Intronic
999044356 5:148451189-148451211 AAGCATGATTCCAGGGATTCTGG + Intronic
1008403012 6:51085981-51086003 GAGCATAACTCCAAGCCGTCAGG + Intergenic
1009806690 6:68608473-68608495 GAACATAATTTCATGGAAACAGG - Intergenic
1010342779 6:74775827-74775849 GTCCATAATTCCAAGGAGTTTGG + Intergenic
1012203773 6:96436774-96436796 GAACATAATTCCATTGACTTGGG + Intergenic
1012947531 6:105483814-105483836 GAGCAGAATTTCATGGAGTCTGG + Intergenic
1014125872 6:117776474-117776496 GAGGTTGATTCCATGGAGTCAGG - Intergenic
1014725724 6:124969714-124969736 GCATATAATTCCATGAAGTCAGG - Intronic
1016086154 6:139917952-139917974 GAGCATAACTTCATGGAGGAGGG - Intergenic
1019837332 7:3401277-3401299 GAGCATAATATCATGGAGGCAGG + Intronic
1023313292 7:38909330-38909352 AAGCAGAATTCCATTGAGTTTGG - Intronic
1031739483 7:125411618-125411640 GAGAATCATTGCATGGAGACAGG + Intergenic
1035030045 7:155850955-155850977 GAGCAAAGTCCCATGGAGACAGG + Intergenic
1037516855 8:19640397-19640419 CAGCTGAATTCCAAGGAGTCTGG - Intronic
1037778620 8:21852149-21852171 GAGCACAGTTCCAGTGAGTCGGG + Intergenic
1043242894 8:77958318-77958340 AAGCATATTTCCTTGGAGACTGG - Intergenic
1045102872 8:98862974-98862996 TAACATATTTCCAAGGAGTCTGG - Intronic
1046345062 8:112913201-112913223 GATAATTATTCCATGGACTCGGG + Intronic
1048280875 8:133104813-133104835 GAGCATCATTCAGTGGAGACAGG - Intronic
1050685300 9:8162080-8162102 CAACATAGTTCCATAGAGTCAGG + Intergenic
1050910782 9:11066897-11066919 GAGTATAATTTCTTAGAGTCTGG - Intergenic
1052361201 9:27561139-27561161 CAGCATTAATCCAGGGAGTCTGG + Intronic
1057796735 9:98163096-98163118 GAGCCTAATCCCATGGCATCAGG - Intronic
1057971397 9:99561630-99561652 GTGGATGATTTCATGGAGTCAGG + Intergenic
1060051951 9:120384108-120384130 GAGCTTAATTACATGGTTTCAGG - Intergenic
1062226454 9:135455177-135455199 GAGCTCAGTTCCAAGGAGTCTGG - Intergenic
1188530883 X:31139672-31139694 GAGAATGATACCATGGACTCTGG + Intronic
1195097164 X:101514197-101514219 GAGCATAAGATCATGGAGGCAGG + Intronic