ID: 964404504

View in Genome Browser
Species Human (GRCh38)
Location 3:156334947-156334969
Sequence CTGGAGTCAAGGAAATGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964404504_964404512 25 Left 964404504 3:156334947-156334969 CCTGATCATTTCCTTGACTCCAG 0: 1
1: 0
2: 2
3: 15
4: 220
Right 964404512 3:156334995-156335017 GCTAGAGCCTGCTGCTAAATTGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964404504 Original CRISPR CTGGAGTCAAGGAAATGATC AGG (reversed) Intronic
902777504 1:18684175-18684197 CTGGAGTCCAGGAAGAGATGGGG + Intronic
907443644 1:54493535-54493557 CTGGAGTAAAGGGAATGAGAGGG - Intergenic
907849964 1:58247110-58247132 CTGGAGGCCAGGAGATGAGCTGG + Intronic
908818280 1:68056838-68056860 CTGGGGTCAAGGAAAGAGTCCGG - Intergenic
910434633 1:87192873-87192895 CTGAAGGCAAGGAAATGAAAAGG - Intergenic
911781299 1:101882807-101882829 GTGAAGTCCAGGAAATCATCTGG + Intronic
912220858 1:107673473-107673495 CTGGAATCCAGGATATGAGCAGG - Intronic
913320704 1:117586627-117586649 CTGAAGTCAAGGAGAGGATTGGG + Intergenic
913664685 1:121036567-121036589 CTGGAATCAAGGCAAGCATCAGG - Intergenic
914016077 1:143819842-143819864 CTGGAATCAAGGCAAGCATCAGG - Intergenic
914161705 1:145141166-145141188 CTGGAATCAAGGCAAGCATCAGG + Intergenic
914396633 1:147275840-147275862 CTGTAGCCAAGGAAAATATCTGG - Intronic
914654696 1:149728383-149728405 CTGGAATCAAGGCAAGCATCAGG - Intergenic
915265495 1:154713764-154713786 ATAGAGGCAGGGAAATGATCTGG - Intronic
915608903 1:156974610-156974632 TTGGAGTTACGGAAATGTTCTGG - Intronic
916745253 1:167680251-167680273 CTGAAGTCAAGGCAATGACCAGG + Intronic
923375009 1:233352783-233352805 CTGAAGTCAAGTGAATCATCTGG + Intronic
924014152 1:239701670-239701692 CTGGAGTCTATTAAAAGATCAGG - Intronic
1064228678 10:13509772-13509794 CTGGAGTTAAGGCAATGAATGGG + Intronic
1064931643 10:20635219-20635241 CTGGAATAAAGGAAATGAACAGG + Intergenic
1067933138 10:50583453-50583475 CTGGAGTGAAGCACATGATCTGG + Intronic
1069522759 10:69137962-69137984 CTGGAGTAATGAAAATGTTCTGG - Intronic
1069769683 10:70889703-70889725 CTGGATATAAGGACATGATCAGG + Intergenic
1071474052 10:86009945-86009967 CTGGAGTCAAGGAAGTGGAGAGG - Intronic
1073633511 10:105173582-105173604 GTGGATTCAAGGAAATGAGTTGG - Intronic
1075479609 10:122768543-122768565 TTGCAGTCAAGGAGATGGTCAGG - Intergenic
1075956731 10:126530627-126530649 CTGGAGACAAGAAAATGAAAGGG + Intronic
1077182016 11:1220968-1220990 CTGGAGTCCCGGAAGTGAGCGGG + Intergenic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1080335177 11:31187052-31187074 CTGGAGTTAAAGAAAATATCAGG - Intronic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1085762534 11:79254772-79254794 CTGGTGTACAGGAAAGGATCTGG + Intronic
1087108287 11:94433972-94433994 ATGCATTAAAGGAAATGATCTGG - Intronic
1088713708 11:112530225-112530247 CTGGGGTCCAGGAAATGGCCTGG - Intergenic
1089074187 11:115724878-115724900 CTCGAGTCAAAGAAATGCCCAGG - Intergenic
1091264392 11:134259265-134259287 CAAAAGTCAACGAAATGATCTGG - Intronic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1092842613 12:12557687-12557709 CGGTAGTAAAGGTAATGATCAGG - Intronic
1094165455 12:27438367-27438389 CTGGAGCTAAGGAGAAGATCAGG - Intergenic
1096455646 12:51783076-51783098 CTGGAGTCAATCAAATGAGGTGG - Intronic
1097942993 12:65332730-65332752 CAGCAGTCAAGTAAATGATGAGG - Intronic
1099526208 12:83721758-83721780 TTGGAGAAAGGGAAATGATCAGG + Intergenic
1099631182 12:85147372-85147394 CTGGAATCAAGTAACTGATTGGG - Intronic
1100199548 12:92283877-92283899 TTGGAGTCAACGAAATAATTAGG + Intergenic
1101453505 12:104805271-104805293 CTGGAGGAAAGGAAAGGACCCGG - Exonic
1101573843 12:105979722-105979744 CTGAAGACAAGGAACTGAACAGG - Intergenic
1102905410 12:116670889-116670911 CTGGAGTCATTGAAATGTTTTGG - Intergenic
1103142552 12:118562210-118562232 TTGGAGCAATGGAAATGATCTGG - Intergenic
1104329317 12:127829502-127829524 CTGGAGAAAAATAAATGATCAGG + Intergenic
1110068574 13:71143010-71143032 CTGGACTTAAGTAAATGTTCTGG + Intergenic
1110716890 13:78715899-78715921 CTGAAGTGAAGGATATGATGGGG + Intergenic
1112006433 13:95257761-95257783 CTGGGGTCAAAGAATTGCTCTGG + Intronic
1112313898 13:98344216-98344238 CTGGAGTCAAGAAAGCCATCAGG + Intronic
1113632038 13:111894346-111894368 CGGGAGCGAAGGGAATGATCTGG + Intergenic
1114653441 14:24301150-24301172 CTGGACTCAAGCAAAAGTTCAGG + Intronic
1115433152 14:33344514-33344536 TTGGTGTTAAGGAAATGATTAGG - Intronic
1117353001 14:54899736-54899758 TTGGAGTCATGAAAATGTTCTGG - Intronic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1119009911 14:70973920-70973942 CTGGAGTAATGAAAATGTTCTGG - Intronic
1119157063 14:72421234-72421256 CTGGAGTCAGAGCAGTGATCTGG + Intronic
1119596962 14:75943979-75944001 ATGGATTTAAAGAAATGATCTGG + Intronic
1119610702 14:76059418-76059440 CTGTAGCCCAGGAAATGTTCTGG - Intronic
1121078954 14:91091987-91092009 CTGGAGTCAAGGGTTTGATTTGG - Intronic
1136292448 16:29283883-29283905 CTGGAGCCAAGGAAGTGAGAGGG - Intergenic
1136452359 16:30360518-30360540 CTGGAGGCAGGGAGAGGATCTGG - Intronic
1139966305 16:70747359-70747381 CTGGGGTCATGAAAATGTTCTGG + Intronic
1141028951 16:80571376-80571398 CTGGAGTCAAGGACAGAAGCTGG - Intergenic
1142098342 16:88257902-88257924 CTGGAGCCAAGGAAGTGAGAGGG - Intergenic
1142254239 16:89006326-89006348 CTGGAGACGAGGAACTGACCTGG + Intergenic
1142254242 16:89006345-89006367 CTGGAGACGAGGAACTGACCTGG + Intergenic
1144000357 17:11048559-11048581 CAGGAGTCAAGGAGAAGAGCTGG + Intergenic
1144324871 17:14169254-14169276 ATGGAGACAAGGAAATTATTGGG - Intronic
1145002630 17:19315867-19315889 CTGGGGTGATGGAAATGTTCTGG - Intronic
1146184222 17:30714548-30714570 CAGGAGTAATGGAAATCATCTGG - Intergenic
1146278421 17:31529939-31529961 GGGGAGCCAAGGAAATGAGCTGG + Intronic
1147667372 17:42157039-42157061 CTGGGGTCAGGGAAAGGATAGGG + Exonic
1147874306 17:43610162-43610184 CTGGAGTCCAGGAAGTGCTATGG - Intergenic
1149779558 17:59386556-59386578 CTGGAGTGAAGGACATAATGGGG + Intronic
1150579101 17:66456190-66456212 CTGGAATCAAGGCATTGATGGGG - Intronic
1151231069 17:72685482-72685504 CTGGAGTCTAGTAAGTGATGGGG + Intronic
1152045968 17:77935860-77935882 CTGGGGTAAAGGAAATGCTCAGG + Intergenic
1153144877 18:2019952-2019974 CTGTAGTCAAGGAATGGAGCAGG - Intergenic
1153666276 18:7369990-7370012 CAAGACACAAGGAAATGATCAGG + Intergenic
1153866519 18:9274597-9274619 TTGGAGTGATGGAAATGTTCTGG + Intronic
1154017662 18:10633908-10633930 CTGGAGTGGAGGAAATGTGCAGG - Intergenic
1154187204 18:12195691-12195713 CTGGAGTGGAGGAAATGTGCAGG + Intergenic
1156247768 18:35318541-35318563 CTGGACTTAAGGAAAGCATCAGG + Intergenic
1159946202 18:74446532-74446554 CTGGAGGGAAGGAAATGAGAAGG - Intronic
1161612980 19:5253808-5253830 AAGGATTCAAGCAAATGATCTGG - Intronic
1161792549 19:6369027-6369049 CTGGAATATAGGATATGATCAGG - Intergenic
1167538086 19:50068224-50068246 CTGGAGATACAGAAATGATCTGG + Intergenic
925425931 2:3748602-3748624 GTGAAGTCAAGGAAGAGATCAGG + Intronic
925989884 2:9246104-9246126 CTGAAGTCAAGCAGCTGATCAGG - Intronic
926621715 2:15052278-15052300 CTAGAGTCAAGGAAAATATATGG - Intergenic
926657310 2:15422158-15422180 ATGGAGTCAGTGAAAAGATCAGG - Intronic
926704526 2:15827249-15827271 CTGGAGGCAAGGAGAGGAGCTGG - Intergenic
928410571 2:31051055-31051077 ATGGAGGCAATGAAATGAACAGG + Intronic
928703414 2:33922272-33922294 CTGGAGTCTAGGGAATCACCTGG + Intergenic
929249565 2:39738012-39738034 CTGGAGTAATGGAAAAGACCAGG + Intronic
930580338 2:53203581-53203603 CTGGGGACATGGAAATGAACAGG + Intergenic
930638294 2:53829562-53829584 ATGGAGTGAAGGGAAAGATCAGG + Intergenic
930780008 2:55215508-55215530 CTGGGGCCAACGAAATGTTCTGG - Intronic
931724737 2:65098639-65098661 CTGGAGTGAAGAAAATGTCCTGG - Intronic
932179896 2:69637292-69637314 CTGGAGTCATGTAAAAGAGCTGG - Intronic
933814813 2:86057842-86057864 TTGGAGTGATGGAAATGTTCTGG + Intronic
934987596 2:98899174-98899196 CTGGAGTCTGGGGAATGGTCTGG - Intronic
935222186 2:101024826-101024848 CTGGGGTCCAGGAAATGCACAGG + Intronic
935888765 2:107652711-107652733 CTGGGGGGAAGGAAAGGATCAGG - Intergenic
936917898 2:117659030-117659052 ATGGGGCCAAGGAAATCATCTGG - Intergenic
941659223 2:168178266-168178288 CAGGAGCCAAGGATATGTTCTGG - Intronic
942451161 2:176108554-176108576 CTGGAGTCAAGCAGATGCCCCGG + Intronic
942954630 2:181759673-181759695 GTGGAGTCAAGGAGAGCATCAGG - Intergenic
944325594 2:198400208-198400230 CTGGAGTCCATGAGATGATGAGG - Intronic
946164830 2:217857639-217857661 CTGAAGTCAAGGTCACGATCAGG - Intronic
947121416 2:226818983-226819005 ATGGTGTCAGGGAAATGATCTGG - Intergenic
947527653 2:230889009-230889031 CTGGAGTCAAGCATGTGACCAGG + Intergenic
947882390 2:233529102-233529124 TTGGACCCAAGGAAATAATCTGG + Intronic
947897353 2:233688035-233688057 TTGGAGTGAGGAAAATGATCTGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174735712 20:52963962-52963984 CTGGGGTCAGGGAAAGGCTCTGG - Intergenic
1175665511 20:60855406-60855428 CTGGAGGCATGGGAATGATGAGG - Intergenic
1177586315 21:23101234-23101256 CTGGAGTCCACGACATGCTCCGG - Intergenic
1178574441 21:33772473-33772495 CTGGAGTGATGAAAATGTTCTGG - Intronic
1178887104 21:36493156-36493178 CTGGACTCAAGGAAATAAAAGGG + Intronic
1183913392 22:41096280-41096302 CTTGAGTGATGGAAATGATGAGG + Intronic
949422176 3:3877775-3877797 CTGGAGACAAGCAAATGATCAGG + Intronic
950172803 3:10851200-10851222 CTGGAGACCAGGAAATGAGGGGG - Intronic
950887223 3:16372948-16372970 CTGGAGACAAGGAGATGATGGGG - Intronic
951055507 3:18142361-18142383 CTGGAGTCAGAGAAATGAAAAGG - Intronic
951448916 3:22814425-22814447 CTCTAGTCAACGACATGATCAGG + Intergenic
951571248 3:24065464-24065486 CTGGAGGAAAGGAAATAATCAGG - Intergenic
952077475 3:29714482-29714504 CTGGAGACAAGGAAAAGGACAGG + Intronic
952212519 3:31242541-31242563 CTGGATAGAAGGAAATGTTCAGG - Intergenic
953530087 3:43732819-43732841 CTGGAGTCAAGGTGATGGCCAGG + Intronic
954530342 3:51313356-51313378 CTGGTGTCAAGTATCTGATCTGG - Intronic
954932314 3:54294940-54294962 GTGGAAGCAAGGCAATGATCTGG - Intronic
956586415 3:70869862-70869884 CTAGAGTCAAGGAGATGACAGGG - Intergenic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
960074096 3:113464102-113464124 CTGGAGTGAGGAAAATGTTCTGG + Intronic
961117701 3:124345872-124345894 CTGTAGTCAATGGAATGATTTGG + Intronic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961545790 3:127632055-127632077 CTGGAGCCATGGAAATGACAGGG + Intronic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
962265138 3:133939362-133939384 CTGGAGTCAAGTCACTCATCAGG - Intronic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
965071765 3:163923991-163924013 CTGGAGACAAGGATATAAGCCGG - Intergenic
965146376 3:164910935-164910957 CTAGAGTCAAGGAGATCAACTGG - Intergenic
965784146 3:172318621-172318643 CTGGAGTCAAGCAAATTCTCAGG - Intronic
967120515 3:186378590-186378612 GTGGAGGCAAGGAGATCATCTGG + Intergenic
969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG + Intronic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
970083738 4:12321265-12321287 CTGGAGACATGGAAATTAGCAGG + Intergenic
975097819 4:70477583-70477605 CTGGAGTCAAGGGAAGGAGAAGG - Intronic
975397813 4:73897617-73897639 CTTGAGTCAAGGATTTAATCTGG - Intergenic
975840014 4:78464025-78464047 CTTGAGTAAAGGAACTAATCTGG - Intronic
978215611 4:106198501-106198523 TTGGATTGATGGAAATGATCAGG - Intronic
978256513 4:106698750-106698772 CTGGAGATAAGAAAATGCTCAGG - Intergenic
979034325 4:115693778-115693800 GTGGAGTCAAGCACATGATCTGG + Intergenic
979646691 4:123077882-123077904 CTGGGGTGATGGAAATGTTCTGG - Intronic
980402026 4:132303043-132303065 ATGGAGTGAAGGAAATAATGTGG - Intergenic
981375854 4:144014666-144014688 CTGGAGTGATGAAAATGTTCTGG + Intronic
981599867 4:146474931-146474953 CTGGAGGGAAGGGAATGCTCTGG - Intronic
982041353 4:151399979-151400001 CTGGTGTCATGAAAATGCTCTGG - Intergenic
982275179 4:153630824-153630846 CTGGAATCAAGATACTGATCAGG - Intronic
983994167 4:174160556-174160578 CTGGAGTGAAAGGAAAGATCTGG + Intergenic
986470359 5:8067697-8067719 CTGGAGGCAGAGGAATGATCTGG + Intergenic
988924229 5:35973006-35973028 CTAAAGTCAAGGCAATGATCAGG + Intronic
990343977 5:54853287-54853309 TTGGATTCTAGGAAATGATTTGG - Intergenic
992270717 5:75060072-75060094 CTGGAGGCAAGGAAGTGGTAAGG - Intergenic
992861223 5:80912474-80912496 CTGGAGTCCTGGAGATGATATGG + Intergenic
993038039 5:82779163-82779185 CTGTAGTTAAGGAAAGGGTCTGG - Intergenic
995107058 5:108386916-108386938 CTGCTGTGAAGGAAATGAACAGG - Intergenic
995273317 5:110248324-110248346 CTGAAGTCCAGGAAAAGATGGGG + Intergenic
995900075 5:117055224-117055246 CTTGACTCAAGGAAATGACCAGG - Intergenic
997777307 5:136622152-136622174 CTGAAGACAAGAACATGATCAGG - Intergenic
998277513 5:140770823-140770845 CTGTAGTAATGGAAATGTTCTGG - Intergenic
1001736026 5:174002296-174002318 ATGGAGTCAAGAAAACGATTAGG + Intronic
1002285798 5:178161980-178162002 CTGGAATCTAGGAAGGGATCTGG + Intergenic
1002389556 5:178899045-178899067 CTGGAGTGAAGGGGAGGATCAGG + Intronic
1004134395 6:12952409-12952431 ATGGAGACAATGAAAAGATCGGG - Intronic
1004218571 6:13724892-13724914 ATGTAGTCATTGAAATGATCAGG - Intergenic
1004981630 6:21031077-21031099 CTGAAGTCAAGGTATTGGTCGGG + Intronic
1006316724 6:33295946-33295968 GTGGAAGCAAGGAAAGGATCTGG + Intronic
1008556281 6:52675907-52675929 CTAGAGTCAAGGAAATTAGGAGG + Intronic
1009490445 6:64284332-64284354 CTGGAGTCAAAGAGATCATTTGG - Intronic
1010128521 6:72463794-72463816 CTGATGTAAAGGGAATGATCAGG - Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1010584752 6:77643928-77643950 TCTGTGTCAAGGAAATGATCTGG - Intergenic
1011213398 6:84978393-84978415 CTGGAGTCTCTGAAATGATAGGG + Intergenic
1013488063 6:110617252-110617274 CTGGACATAAAGAAATGATCTGG + Intronic
1015721389 6:136246330-136246352 CTGGAGTGCAGGGCATGATCAGG + Intronic
1015976406 6:138795877-138795899 CTGGAGGCAGGGAAAGGAGCCGG + Intergenic
1016769745 6:147835806-147835828 CTGGAGACAAGGAGGTGATGCGG - Intergenic
1017381793 6:153839662-153839684 CTGGAGAAAAGGGAATCATCTGG - Intergenic
1017875713 6:158522690-158522712 CTGGTGGAAAGGAAATGGTCAGG + Intergenic
1018927277 6:168215127-168215149 CTGGAGCCATGGAAATGAGAGGG - Intergenic
1019893789 7:3967288-3967310 GAGGAGTAAATGAAATGATCAGG - Intronic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1021150428 7:17144220-17144242 CTGGTGTCAAAGGAATGATTTGG + Intergenic
1022322567 7:29300575-29300597 TTGGAGTCAACAAAATGATATGG + Intronic
1022947919 7:35306151-35306173 CTTGACTCAAGGAAGTGATCTGG - Intergenic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1028958725 7:96724394-96724416 TTGGAGTGATGGAAATGTTCTGG - Intergenic
1030392836 7:108948244-108948266 CTGGACTGAAGGAATTGCTCAGG + Intergenic
1030575390 7:111279869-111279891 ATGGAGTCAATGCAATGAACTGG - Intronic
1031810725 7:126364790-126364812 CTGGAGTGCAGTAAATGATCAGG + Intergenic
1034757329 7:153634862-153634884 TTTGTGTCAAGTAAATGATCTGG + Intergenic
1036162450 8:6402251-6402273 CTGGACTTATGTAAATGATCAGG + Intergenic
1037673322 8:21034149-21034171 CTGGACGCAAAGAAATTATCTGG - Intergenic
1038069884 8:24002105-24002127 CTGGATTCAGGGAAAAGCTCAGG - Intergenic
1039418601 8:37417364-37417386 CTGGAGGCAAAGGAAAGATCAGG - Intergenic
1040913253 8:52542592-52542614 TTGGAGCCCAGGAAATGGTCAGG - Intronic
1041953495 8:63531898-63531920 TTGGTGTCCAGGAAATGCTCTGG - Intergenic
1041977491 8:63816780-63816802 CATGTGTCAAGGAAAAGATCAGG - Intergenic
1043100451 8:76038760-76038782 CTGGAGGCAAGGAAATGACTAGG - Intergenic
1045111931 8:98944682-98944704 CAGGAGTCGCGGACATGATCTGG - Exonic
1045183082 8:99807357-99807379 CTAGAGTCTATGAAATGTTCAGG + Intronic
1045239399 8:100385842-100385864 TTGGAGTGAAGAAAATGTTCTGG + Intronic
1045398117 8:101782594-101782616 CTGGAGTCAAGAACATGGTTGGG - Intronic
1047145402 8:122193352-122193374 CTGGAGACATGGAAATAGTCAGG - Intergenic
1048962137 8:139589457-139589479 CTGGAATCTAAGAAATAATCTGG + Intergenic
1053122018 9:35554814-35554836 TTGGAGTCAAGAAAATGAAGAGG + Intronic
1056413414 9:86354297-86354319 CTGGAGTCCAGGAAACCAACTGG + Exonic
1056902694 9:90614487-90614509 CTGGAAACAAGGAAGAGATCGGG + Intronic
1056989986 9:91401837-91401859 CAGGAGTCAAGAAAAAGATCTGG - Intergenic
1058179386 9:101778670-101778692 CTGCAGTTAAGGAATTAATCCGG - Intergenic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1060316439 9:122515678-122515700 CTAAAGGGAAGGAAATGATCAGG - Intergenic
1061674869 9:132209938-132209960 CAGGAGCCGAGGAAGTGATCGGG + Intronic
1062136754 9:134933182-134933204 CTGGAGTCAGGGAGTTTATCTGG - Intergenic
1187095765 X:16146483-16146505 TTGATGTCAAGGAAAAGATCAGG - Intronic
1187727142 X:22215088-22215110 CTGGAGACTAGGAAATAGTCTGG + Intronic
1187973724 X:24684078-24684100 CTGCAGTCAGGGAAAGGAGCAGG + Intergenic
1188276131 X:28203562-28203584 CTGCATTCTAGGAAATGATTGGG + Intergenic
1192564659 X:72153721-72153743 CTTGAGGGATGGAAATGATCTGG - Intergenic
1198486484 X:137092566-137092588 CTGGAGTGCAGGGAATGATAGGG - Intergenic
1198504909 X:137291869-137291891 CTGGAGTGAGGGAAATGTTATGG + Intergenic
1200308536 X:155053758-155053780 CTTGAGTTCAAGAAATGATCAGG + Intronic