ID: 964405462

View in Genome Browser
Species Human (GRCh38)
Location 3:156343926-156343948
Sequence GCCAGGATCTTAACTGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964405462 Original CRISPR GCCAGGATCTTAACTGCTAA AGG (reversed) Intronic
903520261 1:23942062-23942084 GCCAGGGTCTTACCAGATAAGGG + Intergenic
905482433 1:38270824-38270846 GCCAGGATCTGACATGTTAATGG - Intergenic
906778663 1:48552766-48552788 GGCAGGATCTTGACTGGGAAGGG + Intronic
910567036 1:88655502-88655524 CCCATGATCTTAACTGCAGAGGG + Intergenic
911114787 1:94236531-94236553 GGCAGGATATTACCTGCTAATGG - Intronic
912594557 1:110860887-110860909 GCCAGTCTCTTAACTGCTTTGGG + Intergenic
914916163 1:151820440-151820462 GCCAGGAACTTACCATCTAAGGG + Intronic
918042314 1:180920785-180920807 CCCAGGACCTTAAAGGCTAAGGG + Intronic
919836767 1:201580160-201580182 GCCACCATCTAATCTGCTAAGGG - Intergenic
922038383 1:221872084-221872106 GCCAGGATCTTTACTAGCAATGG - Intergenic
923358898 1:233188360-233188382 GCCAGGTTATTAACTGCTGATGG - Intronic
923529911 1:234804755-234804777 TCCAGGAGCTTCACTTCTAATGG - Intergenic
1063463066 10:6226568-6226590 CCCAGGATCTTAACTTCGGAGGG - Intronic
1066075674 10:31873586-31873608 GTCATGTTCTTAACTCCTAAGGG - Intronic
1069927798 10:71863177-71863199 GACAGGATCATAACTTATAATGG - Intergenic
1070279457 10:75038065-75038087 ACCAGGATCTTACCTGCAGATGG + Exonic
1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG + Exonic
1085871855 11:80359330-80359352 CCCAACATCTTAACTACTAATGG + Intergenic
1087607755 11:100397188-100397210 AGCAGAATATTAACTGCTAAGGG + Intergenic
1090356697 11:126145439-126145461 CCCAGGATATAAACTGGTAAAGG + Intergenic
1093341083 12:17974660-17974682 ACCCGGATCTTAATTGCCAAAGG + Intergenic
1093842190 12:23917589-23917611 GCCATCATTTTGACTGCTAAAGG - Intronic
1101601678 12:106215313-106215335 GCCAGGAGCACACCTGCTAAAGG + Intergenic
1102714841 12:114961306-114961328 GTCAGGCTGTTAACTGCAAATGG + Intergenic
1102789240 12:115630530-115630552 GCCATGATCTTAGCTGCTATAGG - Intergenic
1103014472 12:117483005-117483027 ACCAGGAACTTAACTGCTGCTGG + Intronic
1103122540 12:118392896-118392918 GCCAGAATCTTAACTGGGACAGG + Intronic
1104444252 12:128821078-128821100 GCCAGCATCTGCACTGCTGAGGG - Intronic
1113177838 13:107586337-107586359 GCCAGGATCTTTATTAGTAAAGG - Intronic
1113185989 13:107686092-107686114 GCCAGCCTCTGAAATGCTAAGGG + Intronic
1113483916 13:110640978-110641000 GCCAGGATGTTAACTGCAGCGGG + Intergenic
1129779032 15:78257084-78257106 GCCAGGGTCTTAAAAGATAATGG - Intergenic
1131388262 15:92025854-92025876 TCCAGCATCTCCACTGCTAAAGG - Intronic
1140126737 16:72124376-72124398 GCCATGAACTTCACTGCTCAGGG + Intronic
1146504960 17:33396853-33396875 GCCAGGAAATGAACAGCTAATGG - Intronic
1155415129 18:25590034-25590056 GCCAGGATCTAAAATGATAAGGG - Intergenic
1156903625 18:42329462-42329484 TCCAGGAGCTTAACTTCTAATGG - Intergenic
927064108 2:19452961-19452983 GGAAAGATCTTAACTGATAATGG + Intergenic
927913007 2:26914835-26914857 GCCTGCATCTTAACCTCTAAGGG + Intronic
930572286 2:53102296-53102318 GCCAGAATATTAAATACTAACGG + Intergenic
931851248 2:66252499-66252521 GCCATGCTCTTAATTGCTAATGG + Intergenic
940317112 2:152336656-152336678 GCCAGGATCTGGACTGCTGTTGG + Intronic
1173534651 20:43800287-43800309 GCCAGGAGCTTTTCTGCTAGTGG + Intergenic
951615328 3:24536708-24536730 GCCAGGATCTTTTCAGCTCAAGG + Intergenic
951706583 3:25550168-25550190 CCAAGTATCTTAACTGCAAAGGG - Intronic
953765786 3:45740789-45740811 CCCATGTTCTTAATTGCTAATGG + Intronic
957397477 3:79660858-79660880 GCCAGGACCTTAACTGGTCTTGG - Intronic
959766150 3:110031524-110031546 GCGAGGATCTTAAGTTCTAAAGG - Intergenic
961641455 3:128367251-128367273 GCCAGCATCCTAACTGTTACAGG - Intronic
963814860 3:149818244-149818266 GCATGGAGCTTATCTGCTAATGG + Intronic
964405462 3:156343926-156343948 GCCAGGATCTTAACTGCTAAAGG - Intronic
966324703 3:178741116-178741138 GCCAAGACCTCAACTGCAAATGG - Intronic
967721252 3:192819003-192819025 GCTAGAATCTGAACTGCCAATGG + Intronic
973261098 4:48164627-48164649 GCTAAGATCTTAACTGCTGCTGG - Intronic
975261413 4:72304065-72304087 GCCTGGTTCTTAATAGCTAAAGG + Exonic
976027598 4:80709542-80709564 TCCAGCATCTGAACTCCTAAGGG - Intronic
982637456 4:157914956-157914978 GCTAGGATGTAAACTGATAAGGG + Intergenic
985998767 5:3613732-3613754 ACCAGGATCTTCACTGTCAATGG - Intergenic
986851077 5:11815033-11815055 GCCAGAATCCTACTTGCTAAAGG + Intronic
988822333 5:34899589-34899611 GCCAGGATCCTAGTTTCTAATGG - Intergenic
991035409 5:62123133-62123155 GACAGGATCTGAAGTGCTGAGGG - Intergenic
991084857 5:62639448-62639470 GCCAGAATCTTGACTGCAACAGG + Intergenic
993424203 5:87742048-87742070 GCCAGGAAATTAACTGCTGTGGG - Intergenic
994180743 5:96763286-96763308 TCCAGGATTATAGCTGCTAATGG - Intronic
997446348 5:133943134-133943156 CCCAGGATCTGAACTCCTCACGG + Intergenic
1017452591 6:154567577-154567599 GCCAGGATCTTTATTCCTGAAGG - Intergenic
1019147274 6:169983418-169983440 GCCAGGATTCTTACTGCTAGGGG - Intergenic
1020781602 7:12523068-12523090 GACAGGATCTCAACTCCAAATGG + Intergenic
1020831474 7:13100979-13101001 GCTAGCTTATTAACTGCTAAGGG - Intergenic
1027997960 7:85450340-85450362 GTCAGGATCTTGCCTACTAAGGG + Intergenic
1028349734 7:89831168-89831190 GCCAGAATGTCAACTGCTGACGG - Intergenic
1029997564 7:105023148-105023170 GCCAGCAGCTTAATTTCTAAGGG + Intronic
1031565467 7:123291612-123291634 ACCAGGATTTTGACTGCTCAGGG - Intergenic
1031567495 7:123319039-123319061 GCTGGGATATTAAATGCTAAAGG + Intergenic
1032329251 7:130962452-130962474 GCCAGGCTCCTAGCTGCAAAGGG + Intergenic
1033538792 7:142336957-142336979 GCCCTGATCTTAACTCCTCAGGG + Intergenic
1039563413 8:38530982-38531004 GCCTGGAGCTTAATTGTTAATGG - Intergenic
1043237705 8:77889532-77889554 GCTAGGACCTTAACTGATCAGGG + Intergenic
1046059971 8:109127019-109127041 TCCAGGCTCTTATCTTCTAATGG + Intergenic
1050391640 9:5149166-5149188 TCTAGGATCTTAGCTGCTACAGG - Intronic
1050624838 9:7492282-7492304 GCCAGTATTTCAACTGCAAATGG - Intergenic
1053432848 9:38054583-38054605 GCCAGGACCCCAGCTGCTAAGGG - Intronic
1055668275 9:78573835-78573857 GCCAGGTTCTTCATTTCTAAAGG - Intergenic
1062611164 9:137374233-137374255 GGTAGAATCTTAACAGCTAAAGG + Intronic
1186144412 X:6610611-6610633 GCCATGATGATAACTGCTTATGG + Intergenic
1189122754 X:38412718-38412740 GCCAGGATCTTACTTGCAAACGG + Intronic
1189852151 X:45188451-45188473 GCCGGGAAGTTAACAGCTAATGG - Intronic
1195410320 X:104563397-104563419 GCCAGGGTCATATCTGCTTAGGG - Intergenic
1197265607 X:124366998-124367020 GAAAGGATCTTAAATGCTTAGGG + Intronic
1201636261 Y:16126424-16126446 GACTGGATCTTAGCAGCTAAAGG - Intergenic