ID: 964409702

View in Genome Browser
Species Human (GRCh38)
Location 3:156384887-156384909
Sequence GTGAAAAAGCATGGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 610}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964409694_964409702 3 Left 964409694 3:156384861-156384883 CCTGAAGGGGTAGGGGCACCTGG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG 0: 1
1: 0
2: 7
3: 42
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964409702 Original CRISPR GTGAAAAAGCATGGGAAGGA GGG Intronic
900568073 1:3345018-3345040 GGGAGAAACCATGGAAAGGAAGG - Intronic
900681670 1:3920116-3920138 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
902755672 1:18547803-18547825 GTGTAAATGGATGGGAAGGAGGG + Intergenic
903380066 1:22890458-22890480 GAGAAAAAGCTTGGGATGTAGGG - Intronic
904496362 1:30888995-30889017 GTGAGAAAGGGAGGGAAGGAGGG + Intronic
905819568 1:40979387-40979409 GTGAAAGACCATCGGATGGAAGG + Exonic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906649962 1:47505919-47505941 TTGAAAGGGCAGGGGAAGGAAGG + Intergenic
907088787 1:51704964-51704986 GTGAGAAAGGATGGGAAGCCAGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
908376459 1:63547041-63547063 GGGAAAAAGAATGGGGAGGTGGG - Intronic
908903668 1:68984235-68984257 GGGAAGAAGGATGGGAAGGAAGG - Intergenic
910317662 1:85905303-85905325 GTGAAAAACATTGGGAAGAATGG + Intronic
910591716 1:88933399-88933421 GGGAAAAAATAGGGGAAGGAGGG + Intergenic
910739650 1:90501004-90501026 GAGCAAATGCATGTGAAGGAAGG + Intergenic
910905533 1:92173609-92173631 GTTAAGAACAATGGGAAGGAAGG + Intronic
911086450 1:93981458-93981480 GTGAATATTCATGGGAATGAAGG + Intergenic
911529522 1:99028139-99028161 GTGAAGAATCTTGAGAAGGAAGG - Intergenic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912776922 1:112511229-112511251 GTGAAAGAGCTAGGGAGGGAGGG + Intronic
913397951 1:118393409-118393431 GTGAAGAGGAATAGGAAGGAGGG - Intergenic
913426211 1:118733209-118733231 GAAAGAAAGCATGGAAAGGAGGG + Intergenic
915833375 1:159152329-159152351 GTGAAAGAGATTGAGAAGGAGGG - Intergenic
915838519 1:159197249-159197271 GTGAAAAAACATTAGAAGGGTGG + Intronic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
917416897 1:174819903-174819925 GGGAATAGGCAAGGGAAGGATGG + Intronic
918373698 1:183887190-183887212 GAGAAGAAGGAGGGGAAGGAGGG - Intronic
918723845 1:187892249-187892271 GTGAGAAAGGAAGGGAATGAGGG - Intergenic
918781323 1:188703767-188703789 GTGAAACAGAATGGAAAGGCAGG - Intergenic
920042878 1:203114595-203114617 GTGAAACAGCAATGGAAAGAAGG - Intronic
920211706 1:204333180-204333202 GTGAGGAAGAAGGGGAAGGAAGG + Intronic
920321032 1:205122603-205122625 GTGAAAAAGAATTGGAATGAGGG + Intergenic
920796623 1:209143435-209143457 GGGAAAAAGAAAGGAAAGGAGGG + Intergenic
922304329 1:224330683-224330705 GTGAAAAAGAAAAGGAAGGACGG + Intergenic
922965010 1:229682232-229682254 GAGAAAAAGAAAGGGAAGAAAGG - Intergenic
923084454 1:230692577-230692599 GAGCAAAAGAAAGGGAAGGAAGG + Intronic
923127742 1:231047231-231047253 GGGAAGGAGCAAGGGAAGGAAGG - Intergenic
923262321 1:232279086-232279108 GAGAGAAAGGAGGGGAAGGAGGG + Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923988873 1:239412205-239412227 GAGAAAAAGAGTGGGAAGGAGGG - Intronic
924206208 1:241713521-241713543 GAGAAAAAGCAAGGAAGGGAGGG + Intronic
924740908 1:246793936-246793958 GGCAAGAAGCATGGGAAGGGCGG + Intergenic
1063818351 10:9804545-9804567 GTGGAAAACCATCAGAAGGAAGG + Intergenic
1063914901 10:10871586-10871608 GGGAAAAAGAATGGAAAAGAGGG + Intergenic
1065258487 10:23899986-23900008 GGAAAAAAGAAAGGGAAGGAGGG - Intronic
1065809832 10:29431154-29431176 GGAAAAAAGGAAGGGAAGGAGGG - Intergenic
1065933554 10:30500207-30500229 GGGAGAAAGCAAGGGAAGGAGGG + Intergenic
1066479749 10:35784355-35784377 GGAAGAAAGGATGGGAAGGAAGG - Intergenic
1067807885 10:49405828-49405850 GGGAAAGAGGAAGGGAAGGAGGG - Intergenic
1068309667 10:55262042-55262064 GGGAAAAAGGAAGGGAGGGAGGG + Intronic
1068717147 10:60200909-60200931 GTGAAAAAGTAGGGGGAGGGTGG - Intronic
1069108707 10:64415951-64415973 GGGAAAAAGAGAGGGAAGGAAGG - Intergenic
1069208112 10:65718607-65718629 CTGAAAAAACATGGGAAACAAGG - Intergenic
1069264533 10:66441962-66441984 GTGAATAATTATGGAAAGGATGG - Intronic
1069367535 10:67710099-67710121 ATGAAAAAGGATAGGAAGAAAGG + Intergenic
1069700698 10:70422993-70423015 GAGAAAAAGGAAGGAAAGGAAGG - Exonic
1069777646 10:70936214-70936236 AGGAAAAAGCCTGGGAAGGGTGG - Intergenic
1070392041 10:75979717-75979739 GGGAAGAAACATGGGGAGGAGGG - Intronic
1070513646 10:77183557-77183579 GAGAAAAAACATGAGAAGCATGG + Intronic
1070539662 10:77406935-77406957 GTGAAAAAGGCTGGGAGGCAGGG + Intronic
1070889477 10:79931285-79931307 GAGCAAAAGCAAGGGAAGGATGG + Intergenic
1071137487 10:82468849-82468871 GAGAGAAAGAAAGGGAAGGAGGG + Intronic
1071705896 10:87998124-87998146 GTGAGAAATCATGGTATGGAAGG + Intergenic
1071771719 10:88736138-88736160 GGGAAAAAGGAAGGGAAGGAGGG + Intronic
1071882434 10:89913985-89914007 GTGAAACAGAAAGGGAAGGTTGG + Intergenic
1071928064 10:90434391-90434413 GTGAAAGAGAAAGAGAAGGAGGG - Intergenic
1072451022 10:95539816-95539838 TGGAAAGAGCATAGGAAGGAGGG - Intronic
1072554001 10:96500763-96500785 GTGACAAAGCAAGATAAGGAAGG + Intronic
1073999967 10:109361386-109361408 GTGAAAGAGGATGGGAAAGAGGG + Intergenic
1074006033 10:109424543-109424565 GGGAAGAAGAAAGGGAAGGAAGG + Intergenic
1074371328 10:112902989-112903011 GTGAGGAAGGAAGGGAAGGAGGG - Intergenic
1074585222 10:114761825-114761847 GTAAAAAAGAATAGGATGGAGGG - Intergenic
1074786550 10:116847270-116847292 GTGAGAGAGAATAGGAAGGAGGG - Intergenic
1075629236 10:123991224-123991246 GTGAACAAGCATGGGCTTGAGGG + Intergenic
1075923718 10:126234167-126234189 AAGAAAAAAGATGGGAAGGAAGG + Intronic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078108146 11:8371552-8371574 GGGAGAAAGCATGGGAGGAAGGG + Intergenic
1078267953 11:9769074-9769096 GTGAAAGAGAGAGGGAAGGAAGG - Intergenic
1078437516 11:11337748-11337770 GAGAAACAGCATGGCATGGACGG + Intronic
1078530365 11:12132155-12132177 ATTAAAAAGCATGGGAAACAGGG - Intronic
1078905931 11:15687869-15687891 GTAAAGAAACATGGCAAGGAGGG - Intergenic
1079035410 11:17015342-17015364 ATGAAATAGCGAGGGAAGGAGGG - Intergenic
1079754586 11:24240319-24240341 GGGAGCAAGCATGAGAAGGAGGG + Intergenic
1079875256 11:25848466-25848488 GTGAAAGAACAAGGGAATGAGGG - Intergenic
1080935125 11:36855133-36855155 GTGAAGTAGCATGTGAGGGACGG + Intergenic
1081208351 11:40301065-40301087 CTAAAGAAGCTTGGGAAGGAAGG + Intronic
1081355268 11:42105044-42105066 GTGAAAAAACAGGGAAAAGATGG + Intergenic
1081579724 11:44343951-44343973 GTGAAAACACATGGAAAGCAGGG + Intergenic
1081956733 11:47098986-47099008 GTGATAAACCATGGGACTGACGG + Intronic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1083041011 11:59687443-59687465 GAGAAAAAGAGTAGGAAGGAGGG + Intergenic
1083528767 11:63397608-63397630 GTGGAAAAGGGTGGGAAGAATGG - Intronic
1084513561 11:69622079-69622101 ATAAAAAAGAAAGGGAAGGAAGG + Intergenic
1084617543 11:70246471-70246493 GTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085132436 11:74052587-74052609 GAGAAAAAGCCTAGAAAGGAGGG + Intronic
1085157483 11:74309527-74309549 GAGAACAAGCATGGGTAGCAGGG + Intronic
1085485824 11:76861544-76861566 GTGAAAAGGGAAGGGAAAGACGG - Intronic
1085812553 11:79697832-79697854 GAGAAAAAGTATGGAAAGGAAGG + Intergenic
1086335797 11:85799623-85799645 GGGAAATAGCATGGCAAGCATGG - Intronic
1087022892 11:93621097-93621119 AGAAAACAGCATGGGAAGGATGG - Intergenic
1087408494 11:97760182-97760204 GTTAAAAAACATAGGAATGAAGG + Intergenic
1088071430 11:105790598-105790620 GTGAAAAAGTAATGGAAGAATGG - Intronic
1088190291 11:107220896-107220918 GTGAAGAAGCAGTGGAAAGAGGG - Intergenic
1088330853 11:108649755-108649777 GTCAAAAAGGATGAAAAGGATGG + Intergenic
1088546279 11:110962601-110962623 GGGGAAAAGAATGGGAAGAAGGG - Intergenic
1088751862 11:112849124-112849146 GAGAGAAAGGAAGGGAAGGAAGG - Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1088972628 11:114787190-114787212 GTGAAAAAGAAAGGGAAAGTGGG + Intergenic
1089003273 11:115069536-115069558 GGGAGAAAGCATGAGAAGGCTGG - Intergenic
1089306594 11:117530184-117530206 GTGAAAGAGGAGGGGAAGAAGGG + Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089666330 11:120022512-120022534 GTGAAAAAGTGAGGGAACGAAGG + Intergenic
1090470719 11:126978622-126978644 GTGCTAAAGCCTGGGAAGCATGG - Intronic
1090637662 11:128701210-128701232 GTGAAATCCCCTGGGAAGGAAGG - Intronic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091294557 11:134464492-134464514 GTGAAAAGGAATGGGGAGGCAGG - Intergenic
1091666939 12:2425777-2425799 GTGGAAAAGCATGGGAAGCCTGG + Intronic
1091675022 12:2482903-2482925 GTGAAAAGGCACAGGCAGGAGGG - Intronic
1092286306 12:7130836-7130858 CTGAGAACGGATGGGAAGGAGGG - Intronic
1092817392 12:12323248-12323270 GAGAGAAAGCAAGGGAAAGAAGG + Intergenic
1093057367 12:14568220-14568242 GTTAAACAGCCTGGGAATGAGGG - Exonic
1093441579 12:19203609-19203631 GAGAGAAAGCATTTGAAGGAAGG - Intronic
1093774426 12:23055949-23055971 GAAAATAAGCATGGCAAGGATGG + Intergenic
1094094620 12:26689467-26689489 GTGGGAAAGAAAGGGAAGGAAGG + Intronic
1095499142 12:42817390-42817412 GTGAAACAGAATGGGAAAGATGG - Intergenic
1095610136 12:44118378-44118400 TTTAGAAAGCAGGGGAAGGATGG + Intronic
1096410469 12:51373595-51373617 GTGAAAGAGCTTCCGAAGGATGG + Intronic
1097475005 12:60042657-60042679 GGAAAAAAGAAAGGGAAGGAAGG + Intergenic
1097521620 12:60677996-60678018 GAGAGAAAGAAAGGGAAGGAGGG - Intergenic
1097630678 12:62058596-62058618 GTGAGAAAACATGAAAAGGAGGG - Intronic
1099965050 12:89437196-89437218 GTGAAAAAGGAGGGGTTGGAGGG - Intronic
1100032924 12:90215021-90215043 GAGAAAAAGAAAGGGAAAGAAGG - Intergenic
1100550694 12:95644213-95644235 GAGAAGAAGGAGGGGAAGGAGGG - Intergenic
1101086644 12:101243007-101243029 GGGAAAAAGCAGGGGGTGGAGGG + Intergenic
1101225256 12:102681885-102681907 GAGAAAAAGAATGAGAGGGAAGG - Intergenic
1101626805 12:106451760-106451782 ATGAAAAAGCTTGGTAAGGAAGG - Intronic
1102443753 12:112985708-112985730 ATGAAAAAGCAAGGGAAACATGG - Intronic
1102563742 12:113780982-113781004 GTGCATATGCAGGGGAAGGAAGG - Intergenic
1103028870 12:117596028-117596050 GGGAAAAAGGAAGGGAGGGAGGG - Intronic
1103366995 12:120390690-120390712 GAAAAAAAGGATGGGAGGGAAGG + Intergenic
1103468737 12:121162875-121162897 GTGATCAAGGATAGGAAGGAAGG + Intronic
1103586661 12:121961286-121961308 GGGAAGAAGAAAGGGAAGGAAGG - Intronic
1104393651 12:128412821-128412843 GTGAAAAAGCATGGTGCAGAAGG - Intronic
1104551632 12:129762449-129762471 TTGAAACATCATGGGAATGATGG - Intronic
1104921456 12:132292760-132292782 GAGAAAAGGGAAGGGAAGGAGGG + Intronic
1105706995 13:22973827-22973849 GTGAAAGAGCATGAGAACAAAGG - Intergenic
1107048864 13:36025706-36025728 GTGAAAATTCATGGTAAGAATGG + Intronic
1107126629 13:36853696-36853718 ATGAAAGGGCATGTGAAGGAAGG - Intronic
1107335326 13:39348537-39348559 GTGGAAAAGCAAGGTAGGGAAGG - Intronic
1107519422 13:41164235-41164257 GAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1107523894 13:41211369-41211391 GTGAAAGAAGATAGGAAGGAAGG - Intergenic
1107746282 13:43513286-43513308 GTGATAGAGCAGGGGAAGAAAGG + Intronic
1108414805 13:50186540-50186562 GGAAAAAAGCATGGAAAAGAAGG - Intronic
1108650204 13:52470779-52470801 GTGAAGGAGCTTGAGAAGGAGGG + Intronic
1109055384 13:57540837-57540859 GTGAGAAAGCATGAGAGAGAAGG - Intergenic
1109960987 13:69630501-69630523 GAGTAAGAGAATGGGAAGGAAGG - Intergenic
1110004713 13:70251405-70251427 GGGAAGAATCATGGGAAAGAGGG + Intergenic
1110265499 13:73532429-73532451 GAGAAACAGTATGAGAAGGAGGG + Intergenic
1110309359 13:74029896-74029918 GTGAAAAAGTATGGAAAGGAAGG + Intronic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1111145400 13:84171481-84171503 ATGAAAAAGATTGTGAAGGAAGG + Intergenic
1111171297 13:84529174-84529196 GTGAAACAGCTTGGAAAAGAGGG - Intergenic
1111855145 13:93627526-93627548 GTGAAGCAGCAGTGGAAGGAGGG - Intronic
1112018528 13:95351620-95351642 GTGAAGTAGCCTGGGAAGAAAGG - Intergenic
1113754820 13:112803934-112803956 GAGGAAAAGGAGGGGAAGGAGGG - Intronic
1113754875 13:112804095-112804117 GAGGAAAAGGAGGGGAAGGAGGG - Intronic
1113754948 13:112804287-112804309 GAGGAAAAGGAGGGGAAGGAGGG - Intronic
1113754991 13:112804400-112804422 GAGGAAAAGGAGGGGAAGGAGGG - Intronic
1114327817 14:21607076-21607098 TTGAGAGAGCATGGTAAGGAAGG + Intergenic
1114861850 14:26532545-26532567 GTGAGGATGGATGGGAAGGATGG + Intronic
1115735199 14:36320393-36320415 GAGAAAAAGAATGGCGAGGAGGG + Intronic
1115849266 14:37575923-37575945 GAACAAAAGCATGGAAAGGATGG + Intergenic
1116027890 14:39536864-39536886 GTGAAAAAGCAAAGCAAAGATGG - Intergenic
1116879802 14:50154116-50154138 GGGAAAAGGAAAGGGAAGGAAGG + Intronic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117538831 14:56727165-56727187 GTGAATATGCATTGGCAGGAGGG - Intronic
1119551345 14:75516172-75516194 GTGCCAAAGGAGGGGAAGGAGGG - Intergenic
1119962598 14:78876914-78876936 GTGAAGAAGCAATGGAAGTATGG - Intronic
1121333330 14:93061503-93061525 GTGAGAAAGGAGGGGAGGGAGGG + Intronic
1121659462 14:95624213-95624235 GAGATAAAGAATGGGAAGGCAGG + Intergenic
1121659490 14:95624304-95624326 GGGAGAAAGAATGGGAAGGCAGG + Intergenic
1121867564 14:97377196-97377218 GAGCAAAAGCAGGGCAAGGACGG - Intergenic
1122481266 14:102049022-102049044 GTGGAAAAGCAGGGGCAGGCGGG + Intronic
1122850913 14:104530333-104530355 GTGAAAGAGCTTGCGAACGAAGG - Intronic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123963373 15:25430886-25430908 GGGAATAAGAATGGGAAGGTGGG + Intronic
1124192044 15:27587931-27587953 GTGAAAAGGAGTGGGAAGGCTGG + Intergenic
1124219719 15:27839203-27839225 GTGAAAAAGCATAAGAACAAAGG + Intronic
1125339524 15:38661075-38661097 GGGAAAAAGGAAGGGAGGGAGGG - Intergenic
1125383610 15:39113735-39113757 GAGAAGAAGCCTGAGAAGGAAGG + Intergenic
1125815365 15:42579556-42579578 GAGAAAAAGGAAGGAAAGGAAGG + Intronic
1125886585 15:43234243-43234265 GGGAGACAGCACGGGAAGGAAGG + Intronic
1126386252 15:48096439-48096461 GTGCCAAAGAATGGCAAGGAGGG - Intergenic
1126496381 15:49295156-49295178 GAGAAGAAGGAGGGGAAGGAGGG + Intronic
1126923906 15:53560492-53560514 GTGAAACTGCACAGGAAGGAAGG - Intronic
1127013407 15:54655465-54655487 GGGAGAAGGCAAGGGAAGGAAGG + Intergenic
1127390419 15:58500761-58500783 GTCAAAAAGGATGAGAAGGGGGG - Intronic
1127618273 15:60708664-60708686 CTGAAAAGGCTTGGGAGGGAGGG - Intronic
1127771918 15:62239171-62239193 GGGACAAAGCATGGAGAGGAGGG + Intergenic
1127984213 15:64056716-64056738 GGGAAAAAGCAATAGAAGGAAGG + Intronic
1128209390 15:65884196-65884218 ATGAAAAAGGATGGGATGGGAGG + Intronic
1129141989 15:73607193-73607215 GTGTTAAAGCATGGTAAGAAAGG - Intronic
1129538074 15:76330316-76330338 ATGACAAAGAAAGGGAAGGAAGG - Intergenic
1129983866 15:79898569-79898591 TGCAGAAAGCATGGGAAGGAAGG + Intronic
1130768224 15:86895091-86895113 GGAAAAAAGAAAGGGAAGGAGGG - Intronic
1131048150 15:89329125-89329147 GAGAAAAGGGAAGGGAAGGAGGG + Intronic
1132421176 15:101671134-101671156 TTGAAAAAGCAGGGGAAAAAAGG - Intronic
1132946625 16:2535224-2535246 GTTACAAAGCCAGGGAAGGAAGG - Intergenic
1132969079 16:2676387-2676409 GTTACAAAGCCAGGGAAGGAAGG + Intergenic
1133404411 16:5511535-5511557 GGGAGAAAGAAGGGGAAGGAGGG - Intergenic
1133820543 16:9232373-9232395 GAGAAAAAGGAAGGGAGGGAGGG - Intergenic
1133839553 16:9394929-9394951 GAGACAAAGAAAGGGAAGGAGGG - Intergenic
1133848941 16:9483659-9483681 GAGAAGCAGCATGGGAAGGGTGG + Intergenic
1134449234 16:14353774-14353796 GGGAAAAGGCATGGCAGGGAAGG + Intergenic
1134851102 16:17479704-17479726 GTCCAAAAGAATGGGAATGATGG - Intergenic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135088087 16:19490754-19490776 GAAAAAAAGGAAGGGAAGGAAGG - Intronic
1135106936 16:19658030-19658052 GTGTCAAGGCCTGGGAAGGATGG + Intronic
1135192779 16:20368339-20368361 GTCAAAAAGCATGGGATCCAAGG + Intronic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1136495131 16:30638428-30638450 AGGGAAAAGCATGGAAAGGAAGG - Intergenic
1138431810 16:56973568-56973590 GTGCACACGCATGGGGAGGAGGG + Intronic
1138584007 16:57958792-57958814 GAGAAAAAAGAAGGGAAGGAGGG - Intronic
1138705604 16:58912133-58912155 GAGAAAGAGCAAGAGAAGGAGGG - Intergenic
1138712413 16:58984535-58984557 ATCAGAAAACATGGGAAGGAAGG + Intergenic
1138974225 16:62184285-62184307 GTCCAATAGCATGGGAAGGTTGG + Intergenic
1138978856 16:62242073-62242095 GTATAAAAAGATGGGAAGGAAGG + Intergenic
1139095315 16:63698200-63698222 GTGAAAAATCAGGTGAAGGCCGG + Intergenic
1139278939 16:65753078-65753100 GTGACAAAGCATCGGACGGCTGG - Intergenic
1139449677 16:67019481-67019503 GTGAGTCAGCATGTGAAGGAAGG + Intergenic
1139708467 16:68758658-68758680 GTGAAAAAGCATGGGGCGGGGGG + Intronic
1140134884 16:72197313-72197335 GTAAAAAAGCATGAGAAGCCAGG + Intergenic
1140638423 16:76943776-76943798 GGGAAGAAGAAAGGGAAGGAAGG - Intergenic
1140670455 16:77272565-77272587 GAAAAAAAGAAAGGGAAGGAGGG - Intronic
1141334705 16:83143778-83143800 GTGAGAAAGCCTGGAAACGAAGG - Intronic
1141581860 16:85004713-85004735 GTGAATAAGTAAGGGAAGGAGGG + Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1143210225 17:5180833-5180855 GAAAAAAACCATGGGAAGGTGGG - Exonic
1144465522 17:15493747-15493769 GTGAGAAAGGAAGGGAGGGAGGG - Intronic
1144670547 17:17130391-17130413 GAGGAAGAGCATGGGGAGGAGGG - Intronic
1146651441 17:34609293-34609315 GAGAAAAAGGATGAGATGGACGG + Intronic
1147754177 17:42757346-42757368 GGGAAAAAGGAAGGAAAGGAGGG - Intergenic
1147942327 17:44057886-44057908 GAGATAAGGCAGGGGAAGGAGGG - Intronic
1148206140 17:45781449-45781471 GTGAGAAGGCAAGGGAGGGATGG + Intergenic
1148233148 17:45949802-45949824 GTTAGAAGGAATGGGAAGGATGG + Intronic
1149983495 17:61330195-61330217 GAGAAAAGGGAAGGGAAGGAAGG - Intronic
1150509614 17:65736601-65736623 GGGAACAAGAATGGGAAAGAGGG + Intronic
1151358818 17:73576260-73576282 GGGAAAGAGCATGCCAAGGATGG + Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152943233 17:83183695-83183717 GAGGAAGAGCAGGGGAAGGAGGG - Intergenic
1153320788 18:3772146-3772168 GAGAGAAAGAAAGGGAAGGAAGG - Intronic
1153501975 18:5759144-5759166 GTTCAAAACAATGGGAAGGATGG - Intergenic
1153800137 18:8661400-8661422 GGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1153842014 18:9015847-9015869 GTGAGAAAGGATGCGAAGGGAGG - Intergenic
1154091635 18:11369425-11369447 GAGAAACAGCATGTGCAGGAAGG + Intergenic
1154414871 18:14171319-14171341 GGGAAAAAGCATGGCCAGGGAGG + Intergenic
1157442516 18:47721610-47721632 GAGAAAAAGGAAGGGAGGGAGGG + Intergenic
1157537510 18:48470877-48470899 GTGAAGCAGCATGGCATGGAAGG + Intergenic
1157587398 18:48813248-48813270 GTGAATAGGCATTCGAAGGAAGG - Intronic
1157956201 18:52100243-52100265 ATGAAGAAAGATGGGAAGGAAGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1160313352 18:77818619-77818641 AGGAAAAAGGAAGGGAAGGAAGG - Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1161860245 19:6792507-6792529 TTGATCAAGCAAGGGAAGGAAGG + Intronic
1161933701 19:7357848-7357870 ATGAAAAAGCATGAGCAGAATGG - Intronic
1162058857 19:8082481-8082503 GAGAGAAAGAAAGGGAAGGAAGG - Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162204675 19:9046886-9046908 GAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1164441912 19:28285172-28285194 GGGAAAGAGGATGGGAGGGAAGG + Intergenic
1164546959 19:29173865-29173887 GTGGAAAAGGAAGGGAAGGACGG + Intergenic
1164846504 19:31437416-31437438 GTGAAAAAACACGGGTAGGTGGG - Intergenic
1165238088 19:34439834-34439856 GAAAAAAAGAATGAGAAGGAAGG + Intronic
1165708601 19:37993706-37993728 CTGAAAAAGTGTGTGAAGGAGGG + Intronic
1166687644 19:44805511-44805533 GTGAAAAATAATGGGAAAAAAGG + Intergenic
1167197646 19:48041729-48041751 GGGAAAAGGAATGGGAGGGATGG - Intronic
1168086962 19:54055156-54055178 GTGGAAAAGTATGGGAGGCACGG - Intronic
925095357 2:1194225-1194247 GGGAAGAAGCATGGTCAGGATGG + Intronic
926339787 2:11895444-11895466 CTGAAAAAGGATGGGTAAGAGGG + Intergenic
926462420 2:13148154-13148176 GAGAAAAAGCATAGTGAGGATGG - Intergenic
926719748 2:15951017-15951039 GAGAGAAAGAATGGGAAAGAGGG - Intergenic
927132650 2:20073501-20073523 TTGAAAAATGATGGGAGGGATGG - Intergenic
927157529 2:20229865-20229887 GAGAAAAAGAGAGGGAAGGAAGG + Intergenic
927158558 2:20236496-20236518 GGGAAGAAGGGTGGGAAGGAAGG - Intergenic
927661892 2:25000557-25000579 GAGAAAAAGCAAGGGAAGAAAGG - Intergenic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
928356029 2:30615390-30615412 GTGAAATAGGATGAGAATGAAGG + Intronic
928392186 2:30918594-30918616 TTGACAAAGCACAGGAAGGAAGG + Intronic
929088125 2:38188794-38188816 GTTCACAAGAATGGGAAGGAGGG + Intergenic
929204665 2:39277263-39277285 GTGAAATAGCATGGCAAGTTTGG - Intronic
929227301 2:39524120-39524142 GTGTAAACTCATGGGAAGAAAGG + Intergenic
929359334 2:41065574-41065596 GTGAACAAGTGTGGAAAGGATGG + Intergenic
929409760 2:41684678-41684700 GTCAAAAAGTATGGGAACCACGG + Intergenic
929458039 2:42079992-42080014 GAGAAAAAGAAAAGGAAGGAAGG + Intergenic
929471638 2:42199724-42199746 GTGAAAAAGGTTGGAAAAGAGGG + Intronic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
930932745 2:56907349-56907371 GTTAAAAAGCATGTAAAAGATGG - Intergenic
931568802 2:63646303-63646325 GTTGAAAAGCATGGGAGGAAGGG - Intronic
931822925 2:65970711-65970733 GGGAAACAACATGGGAAGGTAGG + Intergenic
932338187 2:70943048-70943070 GTGAAAAGGCAAGGGAAGGAGGG - Intronic
932470099 2:71949428-71949450 TGGAAAAGGCATGGCAAGGATGG + Intergenic
933124614 2:78588719-78588741 ATGAGAAAGAATGGGAAGGGAGG + Intergenic
933132850 2:78694832-78694854 GTTAAAAAGCATGGAAATTATGG + Intergenic
933595045 2:84274874-84274896 GAGAAAGAGAAAGGGAAGGAGGG + Intergenic
933794132 2:85906405-85906427 CTCAAAAAGAAAGGGAAGGAAGG - Intergenic
933992261 2:87642333-87642355 GTAAGAAAACATGGGAGGGATGG + Intergenic
934056300 2:88254082-88254104 GAGAAAAAGTATGAGAAGAAGGG + Intergenic
934909792 2:98241286-98241308 GTGATAAAGCTGGTGAAGGAAGG + Intronic
935043335 2:99455887-99455909 GTGAAAAAGCAGGTGGAGGGGGG - Intronic
935184619 2:100720949-100720971 GTCAAAAGCCTTGGGAAGGATGG - Intergenic
935882775 2:107582848-107582870 GTGAAAAAGCTTCTGAAGGGAGG + Intergenic
936350521 2:111708883-111708905 CTGGCAAACCATGGGAAGGAAGG + Intergenic
936894181 2:117407952-117407974 GTGAGGAAGGAAGGGAAGGAAGG - Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938478965 2:131643478-131643500 GGGAAAAAGGAGAGGAAGGAAGG - Intergenic
938671185 2:133588377-133588399 GGGAAGAAGGAAGGGAAGGAGGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
940075447 2:149736536-149736558 GTAAAGATGCAGGGGAAGGAAGG + Intergenic
940221756 2:151359993-151360015 CTGAAAAAGAAGGGAAAGGAAGG + Intronic
940575127 2:155493770-155493792 GGGAAAGAGCGAGGGAAGGAGGG - Intergenic
940610852 2:155989808-155989830 GGGAGAAAGGATGGGGAGGAAGG - Intergenic
941366831 2:164620810-164620832 GTGAAAATGCATGGCCACGAAGG + Intronic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
941525979 2:166607836-166607858 GTGGAAAATCATGGGAACAATGG + Intergenic
941615063 2:167709371-167709393 GTGAGAAAGAGAGGGAAGGAAGG + Intergenic
942775325 2:179574841-179574863 GTGAGAGAGCAAGGGAAGCAAGG - Intronic
945181468 2:207096173-207096195 GTGAGAAAGCTAGGGGAGGAAGG + Intronic
946415959 2:219539776-219539798 TTGGAAATGCATGGGAAAGAAGG + Exonic
946471318 2:219963837-219963859 GTGAGAAAGCATGGGATGTGGGG + Intergenic
946921824 2:224588136-224588158 GTGAAAAAGGATGTGATGGCAGG - Intergenic
947433580 2:230052914-230052936 GAGAGAAAGAAAGGGAAGGAAGG - Intronic
947869731 2:233427979-233428001 GGGAGACAGCATGGGTAGGAAGG - Intronic
948670582 2:239566209-239566231 GTGAAGAAGGCTGGGAAGGAAGG + Intergenic
1168778079 20:464754-464776 GGGAGAAAGCAAGAGAAGGAAGG - Intergenic
1168810395 20:701057-701079 GTGAAGAAGGAATGGAAGGAAGG + Intergenic
1168848340 20:960106-960128 GTGAGAAAGAAGAGGAAGGAAGG + Exonic
1169339172 20:4783054-4783076 GTGAAGGTGCATGGGGAGGATGG - Exonic
1169516738 20:6324605-6324627 GATAAAAAGAATGGGAAGAAAGG + Intergenic
1169742337 20:8908447-8908469 GAGAAACAGCATGTGCAGGAAGG - Intronic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1172216684 20:33240498-33240520 GGGAAAATGGATGGGAAGGAGGG + Intronic
1173149964 20:40558600-40558622 GTGAAGGAGAAAGGGAAGGAAGG + Intergenic
1173563555 20:44023069-44023091 GGGAAAAAGGATGGGAAGGAGGG + Intronic
1173596549 20:44262303-44262325 GTGAAAAAATATGAGAAAGATGG + Intronic
1173827045 20:46054820-46054842 GTGAAAGGCCAAGGGAAGGAAGG - Intronic
1174137381 20:48389738-48389760 GTGAAAATTCCTTGGAAGGATGG - Intergenic
1174986242 20:55456230-55456252 GTGATAAAGCAGAGGAAGAACGG + Intergenic
1175154294 20:56959127-56959149 GAGAAAAAGGGAGGGAAGGAAGG - Intergenic
1176167856 20:63683421-63683443 GTGAAAATGGCTGGGAAGGAAGG + Intronic
1176858153 21:13986952-13986974 GGGAAAAAGCATGGCCAGGGAGG - Intergenic
1177537077 21:22441910-22441932 GGGCAAAAGCATTGGAAGCAAGG + Intergenic
1177563019 21:22781083-22781105 GTGAAAATGCATGGAAATGATGG - Intergenic
1177898473 21:26883807-26883829 GTGAGAAAGCAAGGGAAGCTGGG + Intergenic
1178063491 21:28877209-28877231 GAGAGAAAGGAAGGGAAGGAAGG + Intronic
1178299872 21:31443305-31443327 TTATAAAAGCATGGGAAGTAGGG + Intronic
1179644380 21:42766746-42766768 CTGAAAAACCAAGGGAAGGAGGG + Intronic
1179679673 21:43010162-43010184 GTAAGAAAGCAAGAGAAGGAAGG + Exonic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181449296 22:23007458-23007480 GTGAAACAGCTTGGGAAGCTTGG + Intergenic
1181997106 22:26891758-26891780 GTGAAAATGTATGGGCATGAAGG + Intergenic
1182497805 22:30722651-30722673 GAGAAAAAGAGAGGGAAGGAAGG - Intronic
1183784349 22:40021054-40021076 GGGAAAGAGCATGGGAAGTCAGG - Intronic
1184544510 22:45157548-45157570 GAGAAAAAGTATGTGAAAGAGGG + Intergenic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
949482220 3:4504601-4504623 GTGAAAACGTGTGGGGAGGAGGG + Intronic
949947118 3:9199062-9199084 CTTAAAAAGGATGGGAAGGGGGG - Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951131223 3:19047526-19047548 GTTAAATTGCATGGGAAGTATGG - Intergenic
951221807 3:20076514-20076536 TTCAAAAAGCACGGAAAGGAGGG - Intronic
951600563 3:24370273-24370295 GTGACATACCATGGGCAGGATGG - Intronic
951748697 3:26009152-26009174 ATGAGAAAGCAAAGGAAGGAAGG - Intergenic
952388715 3:32861602-32861624 GTGCAAAAGCAGGTGAAAGAGGG - Intronic
952558354 3:34559677-34559699 ATGAAAAAAAATAGGAAGGAAGG - Intergenic
952809356 3:37387455-37387477 GTGAAAAAGCCAGGGATGGTGGG + Intronic
952962557 3:38601861-38601883 ATCAACAAGGATGGGAAGGAAGG - Intronic
953410173 3:42686426-42686448 AAGAAAAAGAAGGGGAAGGATGG + Exonic
954257553 3:49417153-49417175 GTGAAAAACCATGGTGAGGTAGG + Exonic
954388340 3:50256089-50256111 GAGAAATGGCATGGGAGGGAAGG + Intronic
956746986 3:72318161-72318183 GTTAAAATGCATGGGATGGCCGG + Intergenic
957327824 3:78718870-78718892 GGGAAAAAGGGAGGGAAGGAGGG + Intronic
957889240 3:86333492-86333514 GTGAAAAAGAAAGAGAGGGAAGG + Intergenic
958463781 3:94432654-94432676 GTGAAACAGGAAAGGAAGGAGGG + Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
960034786 3:113091578-113091600 GAGAAAAAGAAAGAGAAGGAGGG + Intergenic
960424123 3:117485393-117485415 GGGAAAAAGGAAGGGAAGAAAGG + Intergenic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961173499 3:124815737-124815759 GTGAGCCTGCATGGGAAGGAGGG - Intronic
961646504 3:128395471-128395493 GTGAAAAGCCCTGGGAAGAAAGG - Intronic
962404792 3:135091625-135091647 GTGAGGAAGCCTGGAAAGGAAGG + Intronic
962914667 3:139888968-139888990 ATGAAGAAGGAAGGGAAGGAAGG - Intergenic
963440323 3:145333170-145333192 GGGAAGAATCATGGGAAAGAGGG + Intergenic
964345256 3:155748712-155748734 GTGTTAAAGCATGGTAAGGAAGG + Intergenic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964581865 3:158248111-158248133 GAGAAAATGCCTGTGAAGGAGGG - Intronic
964844068 3:161026902-161026924 GAGAAATAGCAGGGGAAGAAGGG + Intronic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
966557799 3:181283450-181283472 GAGAAAAAGGATGTGAAGTATGG + Intergenic
966842571 3:184101405-184101427 GTAAACAAGCATGGGAAGTGGGG + Intronic
967172189 3:186830371-186830393 GTGAAAAGGCGAAGGAAGGAGGG - Intergenic
967218296 3:187228478-187228500 GAGAAGAAGCCAGGGAAGGAGGG - Intronic
967604240 3:191425272-191425294 GAGAAAAAGAGAGGGAAGGAAGG - Intergenic
967983670 3:195080222-195080244 GTGACAAAGACTAGGAAGGAAGG + Intronic
968266980 3:197369924-197369946 AAGAAAAAGGAAGGGAAGGATGG - Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969452980 4:7285584-7285606 GGCAGAAAGCATGGGAAGGAGGG - Intronic
969606152 4:8203208-8203230 GGGAAAAGGCATGGCAGGGATGG + Intronic
969987264 4:11225272-11225294 GTGAAAGGAAATGGGAAGGAAGG + Intergenic
971092918 4:23365712-23365734 GTAGAAAAGAATGGGAATGATGG - Intergenic
971461813 4:26907315-26907337 GTGAAAAAGGATAGGTAGAAAGG + Intronic
971810132 4:31414311-31414333 GTGAAAAAGAAAGGGAAAGCAGG - Intergenic
972103169 4:35447565-35447587 GGGAAAAAGGAAGGGAGGGAGGG + Intergenic
972152198 4:36106605-36106627 GTGAAAAAAGGTGGGGAGGATGG - Intronic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
972623163 4:40768911-40768933 GTGAAAAAGTAGAGAAAGGAGGG + Intronic
973174937 4:47193802-47193824 GTGAAGAATCATGGAATGGAGGG - Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973595938 4:52490282-52490304 GTAAAGAAGGAAGGGAAGGAAGG + Intergenic
974043090 4:56874525-56874547 GTGACAAAGAAAAGGAAGGAGGG + Intergenic
974292335 4:59948559-59948581 GAGAAAAGGAAAGGGAAGGATGG + Intergenic
975208573 4:71672454-71672476 GTGAATGAACATGGGAAGAAGGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976154981 4:82134131-82134153 GAAAAAAAGCAAGGGCAGGACGG + Intergenic
976293640 4:83447911-83447933 TTGAAAAAGCAAGGTAAGGCCGG + Intronic
976783334 4:88786832-88786854 GTGAAAAAGAATGCGAATGAGGG + Intronic
977040298 4:92008139-92008161 TTGAAAAAGTCTGGGAAGGGAGG + Intergenic
977378808 4:96243273-96243295 GAGAAAAATCTGGGGAAGGAAGG + Intergenic
977895298 4:102357822-102357844 GAGAGAAAGAAAGGGAAGGAAGG + Intronic
978595905 4:110376899-110376921 GTGAAAAAGAAGGAGAAAGAAGG - Intronic
979278793 4:118841428-118841450 GTGAAAAAGAGAGGGCAGGAAGG - Intergenic
979364418 4:119803329-119803351 GTGAAAAATCAAGGGAGGGAAGG + Intergenic
980831758 4:138138006-138138028 CTGAAAGTGCATGGGATGGAAGG - Intergenic
981092155 4:140742979-140743001 GAGGAAAAGGAAGGGAAGGAAGG + Intronic
981597283 4:146440777-146440799 AAGAAAAAGCAAGGAAAGGAAGG + Intronic
982538810 4:156641353-156641375 GGAAAAAAAGATGGGAAGGAAGG + Intronic
982882067 4:160731870-160731892 GAAAAAAAGGAAGGGAAGGAGGG - Intergenic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
983296895 4:165877727-165877749 GTAAAAAAGCAAGGAATGGAAGG - Intronic
983428227 4:167614975-167614997 GTGAGTAAGCATGGAATGGATGG - Intergenic
983525147 4:168753336-168753358 GTCAGGAAGCAGGGGAAGGAGGG - Intronic
984731082 4:183068876-183068898 GTGAAGGAGAAAGGGAAGGAAGG + Intergenic
984973872 4:185212949-185212971 AAGAAAAAACAAGGGAAGGAAGG - Intronic
985864741 5:2505569-2505591 ATGAAAAATGATGGGAAAGAAGG + Intergenic
985872501 5:2568628-2568650 GTGTGAAGGGATGGGAAGGAGGG + Intergenic
986530126 5:8727071-8727093 AAGAAAGAGCAAGGGAAGGAAGG + Intergenic
987803335 5:22727471-22727493 GTGAAATAGTATGTGAAGTATGG - Intronic
988492699 5:31718111-31718133 GTAAAAGAGCAGAGGAAGGAAGG + Intronic
989200172 5:38755381-38755403 GTGACAAAGCGTGGAAAGGGTGG - Intergenic
990334112 5:54755665-54755687 GAAAAAAAGGAAGGGAAGGAGGG - Intergenic
990644019 5:57822975-57822997 GTGAAAAAGGAAGGGAGGAAAGG + Intergenic
990762802 5:59149303-59149325 GTGAAAGAGCGTAGGAAGGAAGG - Intronic
990847359 5:60157916-60157938 GTGAGAAAGAGAGGGAAGGAAGG - Intronic
991051457 5:62277060-62277082 TTGAAAAAGCATACGAATGAAGG - Intergenic
991574011 5:68083938-68083960 GGGAGAAAGGGTGGGAAGGAGGG + Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992314798 5:75541487-75541509 GTGAAGAAGAATGGGACAGAGGG - Intronic
992809301 5:80370783-80370805 GTGCAAAATCCTGGGAGGGAAGG - Intergenic
993095526 5:83474223-83474245 GGAAAAAAGAAAGGGAAGGAAGG + Intronic
993187502 5:84637942-84637964 GGGAAAAAGGAAGGGAGGGAGGG - Intergenic
993204549 5:84863152-84863174 GAGAAAAAAAAAGGGAAGGAAGG - Intergenic
993243071 5:85415421-85415443 GTGAAAAGGAATGGGATTGAGGG + Intergenic
993448663 5:88046451-88046473 CTGAAAAGTCATGGGAAGGCAGG - Intergenic
993681665 5:90885856-90885878 ATGAAGAAGAAAGGGAAGGAGGG + Intronic
993753877 5:91703272-91703294 CTGAATAAACATGGGAAGGGAGG - Intergenic
993959476 5:94279551-94279573 TAGAAAAAGAATGGGAAGAAAGG - Intronic
994130794 5:96225261-96225283 GAAAAAAAGGAAGGGAAGGAGGG - Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994617730 5:102127485-102127507 GTGAAACAGCATGGCAAGATGGG + Intergenic
994619166 5:102142444-102142466 GTGCAAAATCATAGGAAAGAAGG - Intergenic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995778259 5:115748328-115748350 GGAAAAAAGGATGGGAGGGAGGG + Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
996138412 5:119873974-119873996 GGGAAGAATCATGGGAAAGAAGG + Intergenic
997763335 5:136472428-136472450 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
997950801 5:138241364-138241386 AGGAAAAAGCATGGGAAGCTGGG + Intergenic
998132818 5:139659814-139659836 GGGAGAAAGCAAGGGCAGGAGGG - Intronic
998548253 5:143050536-143050558 GTGAAAAGGTATGGGAAATAAGG - Intronic
998594172 5:143510734-143510756 GTGAAAAAGAGTAGGAAGGAGGG + Intergenic
998742350 5:145218520-145218542 GTGAAAAAGGTAGGAAAGGAAGG - Intergenic
999185623 5:149706235-149706257 TAGTAAAAGTATGGGAAGGAGGG - Intergenic
999225498 5:150019978-150020000 GTTAAAAACCTTGGGAAGCAGGG - Intronic
999581743 5:153046211-153046233 GAGAAAATGCAGGGGAGGGAGGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000230588 5:159311872-159311894 ATGAGAAACCATGGGAAGGCAGG + Intergenic
1000840850 5:166216332-166216354 GAGAAAAAGCATAAGAAGAAAGG + Intergenic
1000885764 5:166745827-166745849 GAGAGAAAGAAAGGGAAGGAAGG - Intergenic
1000934420 5:167291152-167291174 GAGAAAGAGCAGGAGAAGGAAGG - Intronic
1001383851 5:171321741-171321763 GTTGAAAAGCATAGGAGGGAAGG + Intergenic
1001695545 5:173667313-173667335 GTGCTAAGGCATGGGAAGAAAGG - Intergenic
1002164527 5:177336235-177336257 GTGAAACAGCCGGGGCAGGAGGG + Intronic
1002175358 5:177398329-177398351 GTGGAAAGGCAGGGGAGGGAGGG + Exonic
1002424212 5:179166160-179166182 GTGAACCAGCATAGCAAGGAGGG - Intronic
1003299882 6:4869908-4869930 ATGCAAAACCATGGGAAGAACGG - Intronic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1004387561 6:15185680-15185702 AGGAAAAAGAAAGGGAAGGAAGG + Intergenic
1004436276 6:15597432-15597454 ATGAAAAAGCATGGGTAAGCAGG + Intronic
1004861487 6:19807740-19807762 GAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1006736715 6:36278944-36278966 AAGATAAAGCAGGGGAAGGATGG + Intronic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1006926530 6:37658503-37658525 GTGAAAAAGTATGGGAGAAAGGG - Intronic
1007271424 6:40640439-40640461 GGGAGAAAGAATGAGAAGGAGGG - Intergenic
1008368647 6:50709965-50709987 GTTAAAAAGGAAGGAAAGGAGGG + Intergenic
1008461494 6:51779213-51779235 GTCAAAAAGTCTGGGAAGAAAGG - Intronic
1008704197 6:54137902-54137924 TTGAAAGAGCTGGGGAAGGATGG - Exonic
1008977754 6:57447517-57447539 GAGAATGAGCATGGGTAGGAAGG + Intronic
1009165897 6:60340463-60340485 GAGAATGAGCATGGGTAGGAAGG + Intergenic
1009659126 6:66587045-66587067 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1009825664 6:68862727-68862749 GTGGAAAAGAAAGGGAAGCAGGG - Intronic
1009848391 6:69163618-69163640 GTGAAATAGGATGGGCAGGTAGG + Intronic
1009942616 6:70306300-70306322 GTGAAAAAGTATGTGGGGGAGGG - Intergenic
1010056240 6:71568655-71568677 ATGAGGAAGAATGGGAAGGAGGG + Intergenic
1010101286 6:72111274-72111296 GAGAAAAAGTATGAGAAGGTAGG - Intronic
1010587420 6:77670634-77670656 GTGAAAAAGCATGAAAAGGCAGG - Intergenic
1011023106 6:82836270-82836292 GTGAAAATCTCTGGGAAGGAGGG - Intergenic
1011114315 6:83873925-83873947 AGGAAAAAGCATGCAAAGGATGG + Intronic
1011208599 6:84929755-84929777 GTTAAAAAACATTGTAAGGATGG - Intergenic
1011770026 6:90665433-90665455 GAGAGAAAGGAAGGGAAGGAAGG - Intergenic
1013349685 6:109294067-109294089 GGGAAAAGGCATGGTAAGAAAGG - Intergenic
1014751459 6:125261493-125261515 ATGAAAAACAATGGGAGGGAAGG + Intronic
1016183193 6:141171795-141171817 GAGAGAAAGCAAGGGGAGGAGGG + Intergenic
1016298013 6:142596881-142596903 GGGAAACAGGATGGGAAGTAGGG - Intergenic
1016535023 6:145100186-145100208 GTGACAAAGAAAGGCAAGGAGGG + Intergenic
1016883575 6:148935732-148935754 GTGATATATCAGGGGAAGGAGGG + Intronic
1016983955 6:149880283-149880305 GTGAAACTGCAGGTGAAGGATGG + Intergenic
1017876196 6:158526218-158526240 GTGAAGAAGAATGTGAAGGCTGG + Intergenic
1018520356 6:164642243-164642265 GAGAAAGAGAAAGGGAAGGAGGG - Intergenic
1018685699 6:166302632-166302654 GTGAAAACACATGGCCAGGAAGG + Intergenic
1020973343 7:14975862-14975884 GAGAGAGAGTATGGGAAGGAAGG + Intergenic
1021044178 7:15902446-15902468 GTGGAAAAGGATGGAAAGGGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022648525 7:32253998-32254020 GAGAAAATGCATGGGAATGAGGG + Intronic
1022882857 7:34606980-34607002 GTGAAGAAGCATGGTAAGACAGG - Intergenic
1023043776 7:36194501-36194523 GGTAACAAGCCTGGGAAGGAAGG - Intronic
1023351205 7:39321763-39321785 GAGAAGATGCATTGGAAGGAAGG + Intronic
1024168612 7:46760766-46760788 GTGAAAAAGTTTAGCAAGGAAGG - Intergenic
1024505103 7:50156074-50156096 ATGAAAAAGCATGGTGCGGAGGG + Intronic
1024715468 7:52074955-52074977 ATGAAACAGCCTGAGAAGGAGGG + Intergenic
1025848657 7:65223645-65223667 GTTAAATTGCATGGGAAGCACGG - Intergenic
1026579256 7:71600213-71600235 TTGAAATTTCATGGGAAGGAAGG + Intronic
1026595759 7:71733055-71733077 GGGAAGGAGCAAGGGAAGGAGGG + Intergenic
1026947291 7:74324859-74324881 GTGGAAGAGCCAGGGAAGGACGG + Intronic
1028283871 7:88970070-88970092 GTAAAAAAGGAAGGAAAGGAAGG - Intronic
1030020774 7:105273310-105273332 GTGAAAAAGCATGGCATGCTTGG - Intronic
1030497141 7:110314440-110314462 GTGAACAAGGAGGGGAAGGGAGG - Intergenic
1030620034 7:111779137-111779159 ATGTAAAAGAATGGGAAAGAGGG + Intronic
1031051492 7:116950284-116950306 GAGAAAAATAAAGGGAAGGAAGG - Intergenic
1031519592 7:122747283-122747305 GGAAAAAAGGAGGGGAAGGAAGG + Intronic
1031537002 7:122946917-122946939 GTGAAAAGGGAGGGGTAGGAAGG + Intergenic
1031557151 7:123191496-123191518 GAGAAAGAGCTTGGGAAGGGAGG + Intronic
1031620335 7:123927401-123927423 CTGAAGTAGCATCGGAAGGAGGG + Intronic
1031893879 7:127325673-127325695 GAAAGAAAGCATGGGGAGGAGGG - Intergenic
1032055286 7:128679629-128679651 GTGTAGAAGCACAGGAAGGAAGG + Intronic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1032733620 7:134669460-134669482 GAGAAAAAGGAGGGGATGGAAGG - Intronic
1032824257 7:135553863-135553885 GTGAATAAGGAAGGGAAGGAAGG + Intergenic
1033433232 7:141308094-141308116 ATGAAGAAGCCGGGGAAGGAGGG + Intronic
1033476422 7:141697445-141697467 GTGGAAATACAGGGGAAGGATGG + Intronic
1033584236 7:142762418-142762440 GGGAAAGAGGCTGGGAAGGAGGG + Intronic
1033732022 7:144189415-144189437 ATGACAGAGCATGGAAAGGAGGG - Intronic
1033742871 7:144287998-144288020 ATGACAGAGCATGGAAAGGAGGG - Intergenic
1033751031 7:144361616-144361638 ATGACAGAGCATGGAAAGGAGGG + Intronic
1034960034 7:155359335-155359357 GTGAAAAAGGAAGGGCAGGGAGG - Intronic
1035835886 8:2751237-2751259 GAAAAAAAGAAAGGGAAGGAAGG + Intergenic
1035938023 8:3864407-3864429 GAGAAAAAGCATGAGAAGAAAGG + Intronic
1035945240 8:3954686-3954708 GGGAAGAATCATGGGAAAGAGGG - Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036110931 8:5901477-5901499 ATGAAAGGGCATGGGAAAGAGGG + Intergenic
1036495741 8:9268538-9268560 GAGAAAAAGGAAGGAAAGGAAGG + Intergenic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037432849 8:18831909-18831931 TAGAAAAAGTATGGGAAGAAAGG + Intronic
1037598404 8:20373623-20373645 GAGAAGAAGGAAGGGAAGGAAGG + Intergenic
1037806866 8:22062808-22062830 GAGAGAAAGAATGGGAGGGAGGG - Intronic
1038052368 8:23826076-23826098 ATGAAAAAGCAAGGAAAGGTGGG + Intergenic
1038436712 8:27541521-27541543 TTGCAAAAGCTTGGGACGGAAGG + Exonic
1038735703 8:30167105-30167127 GAGAAAGAGAAAGGGAAGGAAGG + Intronic
1039759430 8:40558508-40558530 GTGGAAATGGAGGGGAAGGAAGG + Intronic
1041084619 8:54245223-54245245 GAGAATCAGGATGGGAAGGAGGG + Intergenic
1041192748 8:55369543-55369565 GAGAGAAAGAAAGGGAAGGAAGG + Intronic
1041275707 8:56155762-56155784 ATTAAAAAGCAGGGGAAGGCCGG + Intergenic
1041516133 8:58700691-58700713 CTGAACAACCCTGGGAAGGAAGG + Intergenic
1041869060 8:62612913-62612935 GTTAAAAAGCAAGGATAGGAAGG - Intronic
1042788168 8:72572831-72572853 TTGAAAATGCATGGGACGGAGGG + Intronic
1042850332 8:73210317-73210339 GGAAAAAAACATTGGAAGGAAGG + Intergenic
1044319708 8:90788955-90788977 GAGAAAAACCACGAGAAGGAGGG - Intronic
1044411693 8:91891346-91891368 GTGAAAAAGCAAAAGAAGGGTGG + Intergenic
1045174013 8:99700717-99700739 TTCAAAAAGCATGGGAAGTGTGG + Intronic
1045679379 8:104642230-104642252 GTGAGAAAGGAAGGAAAGGAAGG - Intronic
1045681607 8:104666795-104666817 GGGAATAATCATGGGAAAGAGGG - Intronic
1046050889 8:109021239-109021261 GTGTAAAATAATAGGAAGGATGG - Intergenic
1046584293 8:116132550-116132572 GTGAAATGACATGTGAAGGAGGG + Intergenic
1047013870 8:120701763-120701785 GGGAAGAAGCATTTGAAGGATGG + Intronic
1047186485 8:122637832-122637854 ATGAAAAGCCATGGGAAGCAAGG + Intergenic
1047872171 8:129096076-129096098 GGGAAAAAGCAGGGTAAAGAAGG + Intergenic
1047913008 8:129551718-129551740 GATAAAAAGGATGGGTAGGAAGG - Intergenic
1047923034 8:129654812-129654834 ATGAAAAAACTTGGGAGGGAAGG - Intergenic
1048009878 8:130446901-130446923 GTGAGAAAGTAAGGCAAGGAAGG - Intergenic
1049920269 9:356570-356592 GTGATGAAGCAAGGGAAGGTGGG - Intronic
1050041336 9:1496931-1496953 GGGAAAAGGTATGGGAGGGAAGG - Intergenic
1050096897 9:2076539-2076561 GTGAGAAAGAAAGGGAAGAAAGG - Intronic
1050131688 9:2419457-2419479 AGGAAAAAGGATGGGAAAGATGG + Intergenic
1051499285 9:17759335-17759357 GTGAAACAGCATCAGCAGGAAGG - Intronic
1051740432 9:20246668-20246690 GTTCAAGATCATGGGAAGGAAGG + Intergenic
1051858836 9:21601028-21601050 GGGAAACAGCATGCAAAGGAAGG + Intergenic
1052159970 9:25246065-25246087 GTGAGAAAGAAAGGGAAGGGTGG - Intergenic
1052648299 9:31267664-31267686 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1052835988 9:33250474-33250496 GAGTAGAAGCCTGGGAAGGAAGG - Intronic
1053065630 9:35066911-35066933 GTGAAAAAGAAAAGGCAGGATGG + Intronic
1055013144 9:71589212-71589234 GTGAGAAAGGAAGGGAGGGAAGG + Intergenic
1055332353 9:75197456-75197478 GGGAAAAAGAAAGGAAAGGAGGG - Intergenic
1055410315 9:76021926-76021948 GAGAAAGAGGATGGGTAGGATGG - Intronic
1055593608 9:77843553-77843575 GTGCAGAAGCATGGGTGGGATGG + Intronic
1056066653 9:82942411-82942433 GAGAAAGAGGATGGGAAGGGGGG + Intergenic
1058027382 9:100156577-100156599 ATCAATAAGGATGGGAAGGAGGG - Intronic
1058456265 9:105140865-105140887 GGGAAATAGCCTGGGAAGGCAGG + Intergenic
1058494074 9:105535601-105535623 GTAATAAAACATGGTAAGGAAGG - Intronic
1058654162 9:107204569-107204591 GTAAAAAAGGAAGGAAAGGATGG - Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058933721 9:109748198-109748220 GTGACCAAGCATGCAAAGGAGGG + Intronic
1059678842 9:116566856-116566878 GTGAAGGAGAGTGGGAAGGAAGG - Intronic
1060472808 9:123962641-123962663 GTGAAAGAAGATGGGTAGGAAGG + Intergenic
1060728368 9:126021268-126021290 AAGAAAAAGAAAGGGAAGGAAGG - Intergenic
1060922734 9:127433756-127433778 GAGAAGAAACATGGGAAGAAAGG - Intronic
1062300364 9:135864056-135864078 GTGGAAAGGCCTGGGAAAGACGG - Intronic
1186070278 X:5812091-5812113 GTCAAAGAGCATGAAAAGGAAGG - Intergenic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186327330 X:8494034-8494056 CTGACAAAGCATCAGAAGGAGGG - Intergenic
1186497654 X:10024687-10024709 GAGAGAGAGCATGGGGAGGAGGG + Intronic
1186616227 X:11190993-11191015 GTGGGAAAGCATGGGAACCAGGG - Intronic
1186774703 X:12853476-12853498 GAGAAAAAGAATGAAAAGGAAGG - Intergenic
1187605288 X:20875384-20875406 GTGAAAAAGCTTCTGGAGGAAGG + Intergenic
1188232659 X:27684262-27684284 GGGAAGCAGTATGGGAAGGAGGG + Intronic
1189054857 X:37687866-37687888 GGGAAAAAGAAAGGGAGGGAGGG + Intronic
1190110931 X:47588446-47588468 GTGAAGTAGCAGGGGAAGGATGG + Intronic
1190188420 X:48255880-48255902 AAAAAAAAGCATGGGCAGGATGG - Intronic
1191755251 X:64585966-64585988 GGGCAAAACAATGGGAAGGAGGG - Intergenic
1192554876 X:72081463-72081485 GGGAGAGAGAATGGGAAGGAGGG + Intergenic
1192630576 X:72774779-72774801 GTGACAAAGCAGGGCAAAGAAGG + Intergenic
1192651134 X:72946025-72946047 GTGACAAAGCAGGGCAAAGAAGG - Intergenic
1193074982 X:77346004-77346026 GGTAAAAAGGATGGGGAGGACGG - Intergenic
1193332122 X:80246377-80246399 ATGAAAGAGAATGGGAAGCAAGG - Intergenic
1193519061 X:82506781-82506803 GTGAAAAAGCTTGTGATGAAGGG - Intergenic
1194785304 X:98076650-98076672 GTGGAATAACATGGGAAGAAAGG - Intergenic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195813589 X:108860503-108860525 TTGAAAATGCAGGGAAAGGAAGG - Intergenic
1196214309 X:113033091-113033113 GTTAAAAAGCAGGGGAATGAAGG - Intergenic
1196522916 X:116695229-116695251 GTGAATAAGGATGGGAATGGGGG - Intergenic
1197483729 X:127020315-127020337 GAGAAACAGCAAGGGCAGGAAGG - Intergenic
1198015409 X:132605339-132605361 GGGAAAAGGCATGAGAAGGGAGG + Intergenic
1198171049 X:134105551-134105573 GGGAAAAAGCAAGAGAAAGATGG + Intergenic
1198518754 X:137431834-137431856 GAGAAAAAGAGTGAGAAGGAAGG + Intergenic
1201098897 Y:10656405-10656427 GTGGAAAACAATGGGATGGAGGG - Intergenic
1201129363 Y:10940936-10940958 GTGAAATAGAATGGAATGGAAGG - Intergenic
1201411616 Y:13704190-13704212 GCGAAACAGCAGGGGACGGAGGG + Exonic
1201434675 Y:13944044-13944066 CTGACAAAGCATCAGAAGGAAGG + Intergenic
1201943520 Y:19484424-19484446 TTGGAAAATCAAGGGAAGGATGG + Intergenic