ID: 964410935

View in Genome Browser
Species Human (GRCh38)
Location 3:156397303-156397325
Sequence GGTAATATATGTAAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 609}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964410935 Original CRISPR GGTAATATATGTAAAGAAAT TGG Intronic
901406801 1:9054166-9054188 GGCAATATTTGTAGAGATATTGG + Intronic
902316315 1:15621957-15621979 GGTAGTATATGTAGATAACTTGG + Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
903546335 1:24125799-24125821 AATAATATATGTAAAGCATTTGG + Intronic
903964797 1:27080572-27080594 GCTAATATATTTAAAGATTTAGG - Intergenic
904244786 1:29180064-29180086 GATAATAAATGTAAAGCATTTGG - Intronic
904273183 1:29363618-29363640 GTTAATATGTGTAAAGCACTTGG - Intergenic
905148266 1:35905016-35905038 GGTGATATAGCTAAAGTAATAGG - Intronic
905965394 1:42089650-42089672 GGTAATATTTGAAGAGAAAACGG + Intergenic
906028878 1:42700633-42700655 GGCAATTTGTGTAAAGAGATGGG - Intronic
906185118 1:43856711-43856733 AGGAATATATGAAAAAAAATTGG - Intronic
906272568 1:44492274-44492296 GGTAAAAAATGTATAGAAATTGG + Intronic
910335399 1:86123125-86123147 GATAATATATGTAAAGAGACTGG + Intronic
910439316 1:87236433-87236455 GCTAATAAATGCAAAAAAATGGG - Intergenic
910475429 1:87600694-87600716 GGCAATTTGTTTAAAGAAATGGG - Intergenic
910541624 1:88364983-88365005 GGTAATATATCAACAGGAATTGG - Intergenic
910613938 1:89176568-89176590 GATAATCTATGTAAACAAAACGG - Intergenic
910878005 1:91895645-91895667 TGTAATCCATTTAAAGAAATGGG - Intronic
910915780 1:92287289-92287311 GGTATTTTAACTAAAGAAATAGG - Intronic
911481863 1:98453070-98453092 CTTAATATATACAAAGAAATGGG + Intergenic
912006032 1:104902916-104902938 TATTATATATGTAGAGAAATAGG + Intergenic
912036331 1:105320867-105320889 GCTACTATATGTTAATAAATTGG - Intergenic
912248220 1:107983587-107983609 GTTAATATGTGTAAAGTACTTGG + Intergenic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
912953779 1:114138242-114138264 CTTAATATATGTAAAGTAGTTGG + Intronic
913398776 1:118404711-118404733 GAAAATATATTTGAAGAAATAGG + Intergenic
913420824 1:118666855-118666877 GGCAAAATATGTAAAGATACTGG + Intergenic
913460255 1:119077975-119077997 ATTAATATATGTAAAGCACTGGG - Intronic
913464653 1:119127773-119127795 GGAAAGAGATGGAAAGAAATGGG - Intronic
915389916 1:155533256-155533278 GATAATATATGTAAAACATTTGG - Intronic
915890134 1:159765664-159765686 AGAAATATATGTGAAGGAATAGG + Intergenic
916499197 1:165372305-165372327 AGTAATACATGTAAAGCAATTGG - Intergenic
916852237 1:168715128-168715150 GGTTATATATTTGAAGAATTAGG - Intronic
917306615 1:173632207-173632229 GCAAATATATGTCAATAAATTGG + Intronic
917583531 1:176400627-176400649 ATTAATATATGTCAATAAATTGG - Intergenic
917588711 1:176455163-176455185 TGTAATATATGTAAAAGAATAGG + Intergenic
917767055 1:178231961-178231983 TGTAATATGTTTAAAGGAATAGG + Intronic
918457908 1:184743795-184743817 TGAAATATGTGTAAAAAAATTGG - Intronic
918609225 1:186467286-186467308 GGTAGGATATGAAGAGAAATTGG + Intergenic
919037574 1:192334580-192334602 TGTAATATATGTAAGAAACTTGG + Intronic
919141974 1:193583688-193583710 GCAAATATATTTAATGAAATTGG - Intergenic
919275750 1:195414305-195414327 TCTAAAATATGTGAAGAAATAGG + Intergenic
919277587 1:195440635-195440657 TGTAATTTATGAAAAGAAAGAGG + Intergenic
919569440 1:199228096-199228118 GGTACATTATGAAAAGAAATTGG + Intergenic
919686343 1:200487050-200487072 GTAAATACATGTAAAGAACTTGG - Intergenic
919687433 1:200497279-200497301 GGTAATATATTAAAAGATAATGG - Intergenic
919873309 1:201840919-201840941 GGGAATAGTTGTAAAGAAGTGGG + Intronic
920061113 1:203227622-203227644 GTTAATATATGTAAAACACTCGG + Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920335503 1:205242465-205242487 GTTAATATATGTAAAATACTTGG + Intronic
922022069 1:221715630-221715652 GGTAACAGATTTAAAGAAACAGG - Intronic
922547856 1:226471958-226471980 GGTAATATATGTAAAGTTGTTGG + Intergenic
923232767 1:232004188-232004210 GATAATAAATCCAAAGAAATGGG + Intronic
923261019 1:232268183-232268205 ATTTATTTATGTAAAGAAATGGG + Intergenic
923297461 1:232608673-232608695 TGTAATATATGCAGAGATATGGG - Intergenic
923509502 1:234637798-234637820 TATAATATATGTGAAAAAATTGG + Intergenic
923641878 1:235771520-235771542 GATAGCATATGTAAACAAATTGG - Intronic
924382738 1:243479261-243479283 AGTAAAATCTGTAAAGTAATAGG + Intronic
924392233 1:243574989-243575011 GCTGATATATTTATAGAAATTGG - Intronic
1063733191 10:8722663-8722685 GGTAATTTATGAAAAGGAAAGGG + Intergenic
1063989154 10:11541364-11541386 GGTAATATACATAAAGCATTTGG - Intronic
1064314590 10:14243471-14243493 GGTAATTTATTTAAAAAAAGAGG - Intronic
1064768863 10:18702989-18703011 GATAATATATGTAAAGGGCTTGG + Intergenic
1065901055 10:30208301-30208323 GATAATATGTGTAAAGTGATTGG - Intergenic
1065982427 10:30913290-30913312 GGGAATATATGGTATGAAATTGG - Intronic
1067979379 10:51066829-51066851 GGTAATAAATGTAATGAAAAAGG - Intronic
1068183198 10:53549057-53549079 GAAAAAATATGTGAAGAAATGGG + Intergenic
1068202726 10:53803912-53803934 GTAAATATTTATAAAGAAATTGG - Intronic
1070214756 10:74365431-74365453 GCTAATATATGCAACAAAATGGG - Intronic
1070260457 10:74849721-74849743 GATAATAAATGTAAAGCACTTGG - Intronic
1071043790 10:81348405-81348427 GGCAATATTTATAAAGAAACAGG - Intergenic
1071279242 10:84084935-84084957 GCTTCTATATGTGAAGAAATTGG - Intergenic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1072536134 10:96364730-96364752 AGTATTATATGTAAACATATGGG - Exonic
1073359969 10:102890301-102890323 GGGTATATATCTAAAGAAAATGG - Intronic
1073710906 10:106039428-106039450 AGTCATATAAGTAAAGAACTTGG - Intergenic
1073937798 10:108655068-108655090 GTTAATATATGTAAAGAATTTGG + Intergenic
1074803740 10:117027464-117027486 GGTAATTTATTTAAAAAAAAAGG - Intronic
1074837162 10:117307276-117307298 AGTTATATATGTTTAGAAATTGG - Intronic
1074931321 10:118129115-118129137 GATAATATATGTAAAGTGTTTGG + Intergenic
1074991745 10:118714724-118714746 AATATTTTATGTAAAGAAATGGG - Intronic
1075294255 10:121259884-121259906 GGGTATATATGTAAGGGAATTGG - Intergenic
1075346180 10:121683317-121683339 GGTGATATTTGTAAAGAGCTTGG + Intergenic
1077805072 11:5581995-5582017 GGTGACATATTTAAAAAAATTGG - Intronic
1077908579 11:6555140-6555162 GGCAGTATATGTAAGGGAATAGG - Intronic
1078971271 11:16414417-16414439 GGTAAATTATGAAAAGAATTGGG + Intronic
1079508276 11:21179980-21180002 CAGAATATATGTAAACAAATGGG + Intronic
1079892813 11:26079443-26079465 GGTTATATAGGTCAAGTAATGGG + Intergenic
1081129852 11:39365480-39365502 GTTAATATATGAAAAGAGGTTGG + Intergenic
1082699213 11:56407281-56407303 GGAAATAACTGTAAAGTAATAGG + Intergenic
1084663939 11:70565717-70565739 GATAAAATATATAAAGTAATAGG - Intronic
1084663954 11:70565957-70565979 GGTAATTTATGTAGAAAAAAAGG + Intronic
1085132417 11:74052321-74052343 GATAATATATGTAAAGTACTTGG - Intronic
1085187311 11:74586928-74586950 GTTAATATTTGTAAAGCACTTGG + Intronic
1085918513 11:80922233-80922255 GATAATATAAGTAAAGCACTGGG + Intergenic
1086021596 11:82237497-82237519 GTTAATATGTGTAAAGAACTTGG + Intergenic
1086253317 11:84843942-84843964 GGGGATATATGTATATAAATAGG - Intronic
1086881157 11:92155197-92155219 GGTAATACATATAAAGCACTAGG - Intergenic
1086966684 11:93035075-93035097 GCTAATATATGGGAAGAAGTAGG + Intergenic
1087381285 11:97408429-97408451 GGTAATTAATTTAAAAAAATAGG + Intergenic
1087866503 11:103234218-103234240 TGTAATGTATGTTAAGAAAAAGG + Intronic
1087884170 11:103458826-103458848 GCAATTCTATGTAAAGAAATGGG - Intronic
1088268014 11:108006035-108006057 GCTAATTTTTGTATAGAAATGGG - Intergenic
1088340640 11:108762264-108762286 GGTAACATATTTGAGGAAATTGG + Intronic
1088681570 11:112247939-112247961 AGTAATTTCTGTTAAGAAATGGG - Intronic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089748548 11:120634136-120634158 GATAATATATGTAAAGTGCTTGG + Intronic
1090271667 11:125390183-125390205 GATAATATATGTAAAACAGTTGG - Intronic
1090544094 11:127743722-127743744 GGTCATGCATGTAAAGAAATAGG - Intergenic
1090922675 11:131220601-131220623 GGTAATAAGTATAAAGAAATAGG + Intergenic
1091611536 12:2014646-2014668 GGCAATTCATGTAAAGAAACTGG - Intronic
1091724751 12:2838077-2838099 GGTAATGGATGTCAAGACATGGG - Intronic
1092056939 12:5515324-5515346 GATAAGATATGTATAGAACTAGG - Intronic
1092892185 12:12979250-12979272 GGGAATAAATGTAAAGAATTGGG - Intronic
1093142463 12:15525266-15525288 GGTGATATATGGGAAAAAATGGG - Intronic
1093146545 12:15573544-15573566 GGTCATATATGTAATTAATTGGG + Intronic
1094079956 12:26523175-26523197 GGTAATAGAAGTTGAGAAATTGG - Intronic
1094168350 12:27465238-27465260 GGTAATATATGTAAAACACTTGG + Intergenic
1094320675 12:29179428-29179450 GGGAATGTATGTAAAGAACCTGG - Intronic
1094332392 12:29308764-29308786 GGTAAAAAATGTTAAGAAATGGG + Intronic
1094627537 12:32138342-32138364 GTTAATATATTTAAAGCACTTGG - Intronic
1097422720 12:59400225-59400247 GGTAATATATAAATAGAAACAGG - Intergenic
1097626392 12:62006644-62006666 GGTAAAATATGGAAAAACATTGG - Intronic
1097717280 12:62980272-62980294 GGTAATGTATGAAAAAAAAGAGG - Intergenic
1098048116 12:66423306-66423328 GCTATTACATGTAAAGAGATTGG + Intronic
1098280029 12:68853468-68853490 GTTAATAAATATAAACAAATTGG - Exonic
1098414951 12:70222676-70222698 GAGAAAATATTTAAAGAAATAGG + Intergenic
1098454242 12:70654166-70654188 GATAATATATGTAAAACACTTGG - Intronic
1098497434 12:71152469-71152491 GTTAATATATATAAAGAAGTAGG - Intronic
1098700569 12:73619888-73619910 GTTAATATATGTAAAGTATTTGG - Intergenic
1098724446 12:73945024-73945046 TGTACTACATGTAAAGAAACAGG - Intergenic
1099429824 12:82570069-82570091 TGCAATAAATGTAAATAAATGGG + Intergenic
1099907149 12:88784995-88785017 GGCAATATAAGCAGAGAAATAGG + Intergenic
1099945494 12:89239175-89239197 GCTAATATATGTAAAGCAGCAGG + Intergenic
1100102300 12:91123584-91123606 GGTTATATTTGCAAGGAAATAGG + Intergenic
1100506199 12:95223026-95223048 TGTAATATAGTTAAAGATATGGG + Intronic
1101010224 12:100441763-100441785 TGAAATATATGTAAGGAAACAGG + Intergenic
1101481370 12:105100919-105100941 TGTAAAATATGTAAATTAATGGG + Intergenic
1101909631 12:108851389-108851411 GGAAATATGTGTTCAGAAATTGG - Intronic
1103232841 12:119346275-119346297 AATAATATAGGCAAAGAAATTGG - Intronic
1104249023 12:127072140-127072162 GGTAATAAATGTAAAGCACTTGG + Intergenic
1104515930 12:129426697-129426719 GTTAATATATATAAAGAGTTTGG - Intronic
1105492260 13:20900440-20900462 AGTAATATATGTAAAGGGCTTGG + Intronic
1106504412 13:30358531-30358553 GGTTGTATATGGAAAGATATTGG - Intergenic
1106957055 13:34951376-34951398 GTTAATATATGTAAAGTGCTTGG + Intronic
1107166649 13:37289946-37289968 GGAAATATATGGAAATAACTGGG - Intergenic
1107352479 13:39530284-39530306 AGTAGCATATGTAAAGACATGGG + Intronic
1108969847 13:56360058-56360080 GGTAATAAATGGAAAGAATAGGG + Intergenic
1109306577 13:60648167-60648189 GGTAATAAATTTAAAGAAGGGGG - Intergenic
1109454128 13:62561013-62561035 GGTGTTATATCTAAAGGAATTGG + Intergenic
1110054692 13:70952695-70952717 GGTTACATATGTGAATAAATAGG + Intergenic
1110179583 13:72599372-72599394 GGTAATAAATGTAAATGATTTGG + Intergenic
1110820411 13:79908888-79908910 GGAAAAATATGTAAGGAAATGGG + Intergenic
1110875167 13:80500700-80500722 GGTATTATTTGTAAAGAAACCGG + Intergenic
1111449531 13:88396396-88396418 GTTAATTTATATAAAGAACTTGG + Intergenic
1112869703 13:103954961-103954983 AGTAATCCATGTAAAAAAATGGG - Intergenic
1113206243 13:107920452-107920474 TGTACTATATGTAAAAATATAGG + Intergenic
1113684579 13:112273680-112273702 GGTAATTTTTGTATAAAAATAGG - Intergenic
1114038312 14:18650509-18650531 GGTCAAAAATGTCAAGAAATGGG + Intergenic
1114120309 14:19664535-19664557 GGTCAAAAATGTCAAGAAATGGG - Intergenic
1114172892 14:20291595-20291617 GGTGAAATATGTAAAAACATAGG + Intronic
1115102328 14:29717567-29717589 GTTAATATATGTGAAGCACTTGG + Intronic
1115796045 14:36936687-36936709 GGTAATATAAGTAAACGTATTGG + Intronic
1116057642 14:39883915-39883937 GATAATATATGTGAAAATATAGG - Intergenic
1116097265 14:40386725-40386747 GGTAATAAAGGTAAACATATGGG - Intergenic
1116217253 14:42032769-42032791 AGTAAGAGATGTAAATAAATGGG - Intergenic
1116304045 14:43226996-43227018 AGTAAAATATGAAAATAAATGGG - Intergenic
1116586828 14:46716705-46716727 GGCAATATATTTCATGAAATAGG + Intergenic
1116730890 14:48621341-48621363 GGTAATATTTGTTAAGACATAGG - Intergenic
1117380926 14:55162218-55162240 ATTAATATATATAAAGTAATTGG + Intronic
1117864136 14:60127712-60127734 GTTGAGATATGCAAAGAAATGGG + Intronic
1118412576 14:65497153-65497175 GGTAATATATGTCCAGTAACCGG + Intronic
1118480989 14:66165644-66165666 GGGAATAAATGTAATGAAAGAGG - Intergenic
1118540405 14:66817342-66817364 TGTATTATATTTAAATAAATTGG - Intronic
1118577616 14:67259217-67259239 GGGTATACATGTATAGAAATCGG - Intronic
1118583991 14:67334153-67334175 GGTATTAAATATATAGAAATAGG + Exonic
1118658336 14:67978554-67978576 GGTAAAAGAAGTAAAGAAGTGGG + Intronic
1118957109 14:70492320-70492342 GGTAGTATCTTTAAAGCAATGGG - Intergenic
1119926327 14:78497776-78497798 GGTCATATAGCTAAAGTAATGGG - Intronic
1119942404 14:78655602-78655624 GGAAATATTTGTAAGCAAATAGG - Intronic
1120000887 14:79302176-79302198 TGTAATATATGTAAAGCACCTGG - Intronic
1120080269 14:80208468-80208490 GGAAAGATATGTAGAGAAAGTGG - Intronic
1120143735 14:80956712-80956734 GTTGATAGATGAAAAGAAATGGG + Intronic
1120181591 14:81348523-81348545 GGGAATAAATGTAAACAAAGAGG + Intronic
1121292681 14:92790110-92790132 GGGAATATCAGTAAAGAGATAGG - Intergenic
1121399599 14:93661721-93661743 GATAATATATGTAAAGCACTTGG - Intronic
1121467132 14:94123161-94123183 GGTAATTTATTTAAAAAAAAAGG - Intergenic
1121988966 14:98536347-98536369 TTTTATATATGTAAAGCAATTGG + Intergenic
1122237973 14:100343563-100343585 AGTAAAATATATAAAGAAAATGG - Intronic
1123878358 15:24649145-24649167 GGTAATTTATGGAAATAAAAAGG + Intergenic
1124403319 15:29370035-29370057 GGTAATTTATTTAAAAAAATAGG - Intronic
1124865223 15:33483875-33483897 GGGAATAGATGTCAAGAAAAAGG - Intronic
1126422972 15:48494782-48494804 GCTAATTGATGTAAAGAAACCGG - Intronic
1127571321 15:60244659-60244681 GGTAATATAAGCAGAGAGATGGG + Intergenic
1128027402 15:64449990-64450012 GGTACTAAATGTAAAAATATTGG + Intronic
1129209826 15:74061868-74061890 AGCAATGTATGCAAAGAAATAGG + Intergenic
1129404201 15:75303537-75303559 AGCAATGTATGCAAAGAAATAGG - Intergenic
1129835067 15:78698380-78698402 GCAACTATATGCAAAGAAATAGG - Intronic
1129962240 15:79697747-79697769 AGGAATGTATGTAAAGAAAAAGG - Intergenic
1130723434 15:86412864-86412886 GATAATATATGTAAAGTACTTGG - Intronic
1131039333 15:89247873-89247895 ATTTATAGATGTAAAGAAATTGG + Intronic
1131634322 15:94214409-94214431 GCAAATATATGTCAATAAATTGG + Intergenic
1132269603 15:100512239-100512261 GGGAAAATATGTAAAGGGATTGG - Intronic
1133463126 16:6004394-6004416 GTTAATATTTGTAAAGATTTAGG + Intergenic
1133897107 16:9940379-9940401 GGTAATAGATTTAAAGACTTTGG + Intronic
1135951258 16:26916517-26916539 GTTAATATGTGTAAAGATCTCGG - Intergenic
1135961610 16:26999380-26999402 GGTAATATATGCAAAGACCTTGG - Intergenic
1138218682 16:55229270-55229292 GGTAATTTATTTAAAAAAAGAGG - Intergenic
1140622213 16:76748843-76748865 GGTAAGAAAAGTAAAGAAAAAGG + Intergenic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1141769004 16:86077536-86077558 GATAATATATGTAAAGGGCTTGG + Intergenic
1141811117 16:86376944-86376966 GGTCATTTATGGAAGGAAATGGG - Intergenic
1145833874 17:27939135-27939157 GTTAGTATTTGTAAAGCAATTGG + Intergenic
1146523290 17:33543666-33543688 GGTAATGTACGTAAAGTACTTGG - Intronic
1146595428 17:34164220-34164242 TGAAATATAAGTAATGAAATGGG + Intronic
1148137494 17:45303705-45303727 GTTTATATATGTATAGTAATTGG - Intronic
1148538916 17:48464161-48464183 GGTAATATATTTTAAGGAAGAGG - Intergenic
1149296663 17:55267199-55267221 GATAATATATGGAAAGAACCAGG + Intronic
1150129781 17:62662499-62662521 GATAATACATGTAAAGCATTTGG - Intronic
1151044042 17:70898335-70898357 GCTAATGCATGAAAAGAAATTGG + Intergenic
1151123647 17:71821278-71821300 GGGAATAGAAGTAAAGGAATGGG - Intergenic
1152051935 17:77986114-77986136 GGAAATAAATATGAAGAAATGGG + Intergenic
1152057150 17:78038849-78038871 GTTAATATGTGTAAAGCAATTGG - Intronic
1152916401 17:83038906-83038928 TGTAATGTGTGTAAACAAATTGG - Intronic
1153084454 18:1268291-1268313 GCCAACAAATGTAAAGAAATGGG + Intergenic
1153546164 18:6207394-6207416 AGTAGCATATGTAAGGAAATAGG - Intronic
1153589946 18:6663046-6663068 GTTATTATATGTAAAATAATCGG + Intergenic
1153718546 18:7876987-7877009 GTTAATATATGTAAAACATTTGG + Intronic
1154309827 18:13258787-13258809 GGTAATCTAGCTAAAGAAAGAGG - Intronic
1155017085 18:21854358-21854380 TGGAAAATATGTAAATAAATGGG + Intronic
1155302014 18:24438934-24438956 AGAAATATATTTTAAGAAATTGG + Intronic
1155753155 18:29454827-29454849 GGTAATTTATTTAAAAAAAAAGG + Intergenic
1155847112 18:30721748-30721770 GCTAATATTTTTAAAGAATTTGG + Intergenic
1156052043 18:32949044-32949066 AGTAACATATTTAAAGTAATGGG - Intronic
1156077059 18:33292078-33292100 GGTTATATATCCAAAGAAAAAGG + Intronic
1156102829 18:33619042-33619064 GGTAATTTATGTAAAGTCCTTGG - Intronic
1156486685 18:37470927-37470949 TATAATAAATGTAAAGAAAGAGG - Intronic
1156707762 18:39904308-39904330 GGTAATTTATTTAAAAAAAGAGG + Intergenic
1157234161 18:45947605-45947627 GGTAATAGAGGTGAAGAACTCGG - Intronic
1157410932 18:47462357-47462379 GATAATATATGTAAAGATCTTGG + Intergenic
1157465772 18:47943619-47943641 GGTAATGGATATAGAGAAATAGG + Intergenic
1158042202 18:53108504-53108526 TGTAATATATGACAACAAATAGG - Intronic
1158187049 18:54782511-54782533 TGTTATACAAGTAAAGAAATAGG - Intronic
1158249853 18:55475667-55475689 GTGAAGATATGTAAGGAAATAGG - Intronic
1158370664 18:56799322-56799344 TGAAATATATGTAAATAAAAAGG + Intronic
1158622616 18:59046214-59046236 GATAATGTATGTAAAGAACTTGG + Intergenic
1159446497 18:68546685-68546707 TGTGAGATATGTAAATAAATGGG + Intergenic
1159849704 18:73513458-73513480 AAAAATATAAGTAAAGAAATGGG + Intergenic
1160326554 18:77955005-77955027 GGGAATATATGCAAAGAGTTTGG + Intergenic
1164132040 19:22372494-22372516 GTTAATATTTGTAATAAAATGGG - Intergenic
1164167529 19:22695259-22695281 GTTAATATTTGTAATAAAATGGG + Intergenic
1164275147 19:23710511-23710533 CGTGATATATGTAAATATATGGG - Intergenic
1164475742 19:28574647-28574669 GGTAATTTATTTAAAAAAAAAGG - Intergenic
1165380876 19:35479274-35479296 GATAATATATGCAAAGCACTTGG + Intergenic
1166578622 19:43870059-43870081 GGCAATCTTAGTAAAGAAATAGG + Intergenic
926589300 2:14722789-14722811 GATAATAAATGTAAAGCACTTGG - Intergenic
927473282 2:23392546-23392568 GATAATATATGTAAAGTACTCGG - Intronic
928048517 2:27964317-27964339 GGGAATTTATATAAAGAAAAAGG - Intronic
928744572 2:34396433-34396455 GGTTTTATTTGGAAAGAAATGGG + Intergenic
928794404 2:34998676-34998698 ATTAATATATGTAAAGCAGTTGG + Intergenic
929066350 2:37978987-37979009 GGTGAAATTCGTAAAGAAATAGG + Intronic
929407779 2:41662765-41662787 GTTAATATGTGTAAAGCACTTGG - Intergenic
929462831 2:42116417-42116439 GGTAATATGTGTAAAGTGCTTGG + Intergenic
930162794 2:48175604-48175626 GGTAATATTTTTTAAGAAAGAGG + Intergenic
930298079 2:49580092-49580114 TATTATATATGTAAACAAATAGG + Intergenic
930396897 2:50833128-50833150 TGTAATATATGTATAGAACATGG - Intronic
930438616 2:51378188-51378210 GGTAATTTATTTAAAAAAAGAGG - Intergenic
930654848 2:53997812-53997834 GGTAATATAGGAAAATACATTGG + Intronic
931800661 2:65755198-65755220 GGTAATTTATATAAAAAAAGAGG + Intergenic
932155973 2:69418008-69418030 GATAACATATGTAAAGCACTAGG + Intronic
932524414 2:72448188-72448210 TATAGTATATGTAAAGAAACAGG - Intronic
933079760 2:77971006-77971028 TGTAAAAAATGTAAAAAAATAGG + Intergenic
933126610 2:78616249-78616271 GGAAATATATGTAAATATATAGG - Intergenic
933395791 2:81729237-81729259 AATAACATATGTAAAGAAAATGG - Intergenic
935431103 2:102976818-102976840 TGTAACACTTGTAAAGAAATGGG + Intergenic
935646939 2:105345167-105345189 GGGAATATATTTAAAGAAACAGG - Intronic
936555834 2:113498361-113498383 GGTTAAATATTCAAAGAAATTGG + Intergenic
936737410 2:115463191-115463213 AGTAATGCATGTATAGAAATAGG - Intronic
936991429 2:118371052-118371074 GCAAATATATGTAAAAAGATTGG + Intergenic
937105101 2:119304593-119304615 GGAAATCTAGGTAAACAAATGGG + Intronic
937468994 2:122159177-122159199 GGCAAAATATGTAAAGACAGAGG + Intergenic
937610211 2:123852187-123852209 GGTGATATATGAAAACAAAATGG - Intergenic
938215351 2:129508150-129508172 GGTATTAACTGCAAAGAAATGGG + Intergenic
938272652 2:129988589-129988611 GGTCAAAAATGTCAAGAAATGGG - Intergenic
938443585 2:131357527-131357549 GGTCAAAAATGTCAAGAAATGGG + Intergenic
939092170 2:137792039-137792061 GGTAATTTATTTAAAAAAAGAGG + Intergenic
939229402 2:139407097-139407119 GTTAATAAATATAAAGAAAAAGG + Intergenic
939336612 2:140836975-140836997 GGAAATATATGTAACCAAGTGGG - Intronic
939827940 2:147037829-147037851 ATTAATATATGTAAACCAATGGG + Intergenic
939884069 2:147662196-147662218 GGTAATTTATTTAAAAAAAGAGG + Intergenic
940332215 2:152487679-152487701 GGTAAGATTTGATAAGAAATGGG + Intronic
940558098 2:155257978-155258000 GATAATAAATGAAAAAAAATTGG + Intergenic
940729901 2:157376536-157376558 GGTAATTTATTTAAAAAAAAAGG + Intergenic
941017000 2:160368939-160368961 GGTAACATATCTAAATTAATGGG - Intronic
941380149 2:164782976-164782998 TGTAATATATGAAAAAAAATGGG - Intronic
941428652 2:165384138-165384160 AGTAATATATGAAAAGAACATGG + Intronic
941779999 2:169433400-169433422 GGTACTGTATGTAACCAAATGGG - Intergenic
942503040 2:176612061-176612083 TGGAATATAGGAAAAGAAATGGG - Intergenic
942804702 2:179916536-179916558 AGTAATATATGTAAAGTACTTGG - Intergenic
942926013 2:181433470-181433492 GGTGATACATGAACAGAAATAGG + Intergenic
943174556 2:184453779-184453801 GATAATATAATTAAAGAAATTGG - Intergenic
943204712 2:184878766-184878788 GGTAAAATATGTAACCATATTGG - Intronic
943592939 2:189821126-189821148 GGTAAAATATAAAGAGAAATAGG + Intronic
944090648 2:195906587-195906609 GTTAATATATGAAAAGAGCTGGG - Intronic
944320132 2:198331060-198331082 GATAATATATGTAAAGCGCTTGG + Intronic
944639739 2:201712352-201712374 GGTAATTTATTTAAAGAATTTGG + Intronic
944866285 2:203865668-203865690 TATATTATATGTAAACAAATGGG - Intergenic
945470453 2:210223113-210223135 AGTAAAATATATAAAGACATAGG + Intronic
945529681 2:210935840-210935862 GGTAATATATGGAATAAAAGTGG + Intergenic
945549050 2:211196807-211196829 GGAGATGTATGTCAAGAAATGGG - Intergenic
945549282 2:211199202-211199224 ATGAATAGATGTAAAGAAATTGG + Intergenic
946214243 2:218171554-218171576 GTTAATATATGTAAAGTGGTTGG + Intergenic
946245936 2:218387443-218387465 GGTAACATATGTTAAGCACTTGG + Intronic
946951742 2:224883536-224883558 GCTAATATGTGAAAAGAACTGGG - Intronic
947057078 2:226116724-226116746 GGTAATATTTGTGAAGTACTTGG + Intergenic
947227615 2:227855220-227855242 GATACTAAATGTAAAGAAAGAGG - Intergenic
947559764 2:231138524-231138546 GAGAATATATGTACAGAAAGGGG - Intronic
1169054250 20:2607331-2607353 GGGAATATAGATAAAGGAATGGG - Intronic
1169180578 20:3562571-3562593 GGCATTATATATAGAGAAATTGG + Intronic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1169711570 20:8570382-8570404 GGTAATATATGAATATATATAGG + Intronic
1169735839 20:8836749-8836771 AGTAACAAATGTAAAGAGATTGG + Intronic
1169808754 20:9587052-9587074 AGTAATATGTGTAAAAAACTTGG + Intronic
1170258661 20:14377095-14377117 CATTATATAGGTAAAGAAATGGG - Intronic
1172728638 20:37068034-37068056 TGAAATATATCTAAAAAAATTGG + Exonic
1173294671 20:41746636-41746658 AGTAATATAGGGAAAGAAAAAGG - Intergenic
1174860937 20:54090369-54090391 GGGTCTATTTGTAAAGAAATGGG + Intergenic
1176314988 21:5233825-5233847 AGTTGTATTTGTAAAGAAATGGG + Intergenic
1176938452 21:14894739-14894761 GTTAATAGATGTAAAGGAATTGG + Intergenic
1177033222 21:16009644-16009666 AATAAAATATGTAAATAAATGGG - Intergenic
1177219381 21:18171634-18171656 TGTAAGACATGCAAAGAAATAGG - Intronic
1177445056 21:21183924-21183946 GTTGATACATGTAAAGAGATGGG + Intronic
1177671431 21:24235364-24235386 GATAACATATGCAGAGAAATGGG - Intergenic
1178143170 21:29707263-29707285 GGTAATACATTGAAAGAAAGGGG + Intronic
1178165961 21:29977394-29977416 GTTAATAGATATAAAAAAATTGG + Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1179121947 21:38555889-38555911 GGAAATATATGTAAAAATTTTGG + Intronic
1179526140 21:41977090-41977112 TATAATATATGTAAAGAAACGGG + Intergenic
1181069293 22:20322517-20322539 GGTGATATATGTGTAGGAATGGG + Intergenic
1182164818 22:28162647-28162669 GGAAATATATCTAAAGAAAGAGG + Intronic
1182813969 22:33141885-33141907 TGTAGAATATGTAAAGAAACAGG - Intergenic
1183445489 22:37851097-37851119 GGTAATATTTTTGAAGAAACAGG + Intronic
1185421344 22:50736032-50736054 CTAAATATTTGTAAAGAAATAGG + Intergenic
949577280 3:5351078-5351100 GTTAATATGTGTGAAGAGATTGG - Intergenic
949657362 3:6235935-6235957 GGTAATTTATATAAAAAAAGAGG - Intergenic
949744608 3:7275152-7275174 GGTAATATAAATAGAGAGATGGG - Intronic
949752945 3:7375516-7375538 GGAAACATATGTAAAGAAGGGGG - Intronic
950235287 3:11314471-11314493 GGAAATATAAGTAAGGAAAAAGG + Intronic
950739398 3:15037912-15037934 GGCCACATATGGAAAGAAATGGG - Intronic
951800936 3:26595532-26595554 GTTAATATGTGTAAAGTACTTGG + Intergenic
953213196 3:40894433-40894455 GATAAAATATGTGAAGAAATTGG - Intergenic
955617888 3:60828164-60828186 GATAATTTATGTAAAGAACCTGG + Intronic
955618174 3:60831657-60831679 GATAATATATGAAAAGTTATTGG - Intronic
956108771 3:65850127-65850149 TTTTATATATATAAAGAAATAGG - Intronic
956286687 3:67617791-67617813 GTTAATATATGCAAATAAACTGG + Intronic
956483421 3:69696095-69696117 GTTAATATATGTAAAGTGCTTGG - Intergenic
956680105 3:71770949-71770971 GGAATTATGAGTAAAGAAATAGG - Intergenic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
957396047 3:79640027-79640049 AGTAAGAAGTGTAAAGAAATTGG + Intronic
957469428 3:80639269-80639291 TATAAGATATGTAAAGAAACAGG + Intergenic
957698996 3:83685288-83685310 GATAATATATGCAAAATAATTGG + Intergenic
957842020 3:85684579-85684601 GGTAATTTATATAGAAAAATAGG + Intronic
958519300 3:95162909-95162931 GGAAATATGTAGAAAGAAATGGG + Intergenic
958711834 3:97725994-97726016 GATAATATATGTAAAGTACCTGG + Intronic
959088991 3:101882144-101882166 GGTAATAAATATAAATCAATGGG - Intergenic
959189597 3:103094261-103094283 GCAAATATATGTGAATAAATTGG - Intergenic
959273062 3:104239055-104239077 ACAAATATATGCAAAGAAATTGG - Intergenic
959961501 3:112303453-112303475 GGCACTATAGATAAAGAAATTGG + Intergenic
960123242 3:113968884-113968906 GGTAATTTATTTAAAAAAAGAGG + Intronic
960207065 3:114915340-114915362 ATTAATACATGTAAATAAATTGG - Intronic
960246970 3:115410577-115410599 GATAATATATGCAAAGCATTTGG - Intergenic
960272558 3:115690595-115690617 GGTAACATATTTAAAGAACCAGG + Intronic
961035680 3:123640025-123640047 GTTAATATAGGTAAAGGGATGGG - Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
961413364 3:126739759-126739781 GGCAACATATGTAAAGAGATGGG - Intronic
961968722 3:130935838-130935860 AATAATTTATGTAATGAAATGGG + Intronic
962930699 3:140033107-140033129 TGCAATATTTGAAAAGAAATAGG + Intronic
963223683 3:142838578-142838600 GGTAATTTATTTAAAAAAAGAGG - Intronic
963471790 3:145750423-145750445 GGTTATAGAAGTAAAGAAAGGGG + Intergenic
963536006 3:146529270-146529292 TATAATATATGTATAGAACTGGG + Intronic
964275646 3:155005837-155005859 GGTAATTTATTTAAAAAAAGTGG - Intergenic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
964516490 3:157514684-157514706 GGTAATATTTGTAAAGTGCTTGG + Intronic
964879655 3:161409543-161409565 AGTAATGTATCTAACGAAATAGG + Intergenic
965111187 3:164425523-164425545 TGTAATATAAGTATAAAAATTGG + Intergenic
965223551 3:165958723-165958745 GGTAATACCCTTAAAGAAATTGG + Intergenic
965265697 3:166539575-166539597 TATGAAATATGTAAAGAAATAGG + Intergenic
966396532 3:179509695-179509717 CTTAATATATCTAAAGAAAGAGG - Intergenic
966471696 3:180296745-180296767 GGGAATGTATGAGAAGAAATTGG + Intergenic
966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG + Intergenic
967190058 3:186977254-186977276 GGTGATAAAAGCAAAGAAATGGG - Intronic
967258261 3:187615534-187615556 GGTAATCTGAGTAAATAAATTGG - Intergenic
967282058 3:187832466-187832488 GATAAAAGATGTAAAGCAATTGG + Intergenic
967441486 3:189514215-189514237 GGTAATTTATTTAAAAAAAAGGG + Intergenic
967642279 3:191879601-191879623 GGAAATATCAGTAGAGAAATTGG - Intergenic
967673214 3:192264156-192264178 GGTGATATATGAAAACAAATCGG - Intronic
968936744 4:3615014-3615036 GGTAATTTATGAAGAGAAAGAGG + Intergenic
969081656 4:4623494-4623516 GGTAATTTATTTAAAAAAAGAGG - Intergenic
970125778 4:12808722-12808744 GATAATATATGTAAATCATTTGG + Intergenic
970624100 4:17858422-17858444 AGAAATACATTTAAAGAAATTGG + Intronic
970835408 4:20399496-20399518 GTTAATATATGTAAAGTGATCGG + Intronic
971327210 4:25654549-25654571 GCTAAAATATGTAAAGAATGTGG - Intergenic
971391150 4:26186366-26186388 GTTAATATTTGTAAGGCAATTGG + Intronic
971396276 4:26230414-26230436 GTTAATATATGTAAAGCACTTGG - Intronic
971664952 4:29471308-29471330 GGAGATATATCTAGAGAAATAGG - Intergenic
971900477 4:32651545-32651567 GGTAATAATTGTAAATAAATTGG + Intergenic
972261643 4:37414834-37414856 ATTAATATAAGTAAAGAAATTGG - Intronic
972763950 4:42133922-42133944 AATAATACATGTAAAGCAATGGG + Intronic
973165274 4:47069846-47069868 GGAAATGCATGGAAAGAAATTGG - Intronic
973302040 4:48596623-48596645 GTTAATATCTGTAAAGCACTTGG + Intronic
974146643 4:57956110-57956132 GTTCATATAAATAAAGAAATTGG + Intergenic
974179144 4:58361698-58361720 GGGAATATATGATAAGAAAAAGG + Intergenic
974686649 4:65240840-65240862 TATAATATATGTAAAGATTTTGG - Intergenic
974778523 4:66520956-66520978 GGTAATTTATGAGAAAAAATGGG + Intergenic
974878060 4:67721646-67721668 GGTAACACATGTACAGAAAATGG - Intergenic
975049950 4:69850621-69850643 GCTAATAGATGAAAAGAACTAGG - Intronic
975223227 4:71838497-71838519 GATAATATATTTAAAGCTATGGG + Intergenic
975337700 4:73199415-73199437 GGTACTCTATATAAAGTAATGGG - Intronic
976049809 4:80998241-80998263 GGTAATTTATTTAAAAAAAGAGG - Intergenic
976253471 4:83077020-83077042 GGTAATATAAGCAGAGAGATGGG + Intergenic
976779857 4:88747070-88747092 AGTAATTTAAGTAAAGAAGTTGG - Intronic
977101248 4:92817835-92817857 AATAATATGTGTAAAAAAATTGG - Intronic
977440534 4:97060932-97060954 GGTAACATATGTAAAGATCCTGG + Intergenic
977509490 4:97944653-97944675 AGTAAAATGTGTAAAAAAATGGG - Intronic
977595239 4:98872282-98872304 ATGAATATATGTAAACAAATGGG + Intronic
978435429 4:108678981-108679003 GCTAATATATATAAAGAGTTTGG - Intergenic
979142298 4:117192397-117192419 TGTTATATATGCTAAGAAATAGG + Intergenic
979149747 4:117296195-117296217 AGTTAGATATTTAAAGAAATTGG + Intergenic
979266207 4:118705860-118705882 GGTTATGCATGTCAAGAAATAGG + Intronic
979430373 4:120622321-120622343 GTTAATATATGTAAAGCACTTGG - Intergenic
979541409 4:121887739-121887761 GCTATGATATGTTAAGAAATAGG - Intronic
979818184 4:125136504-125136526 GTTAATATTTGTACAGAACTTGG + Intergenic
980649379 4:135690368-135690390 GATAATTTATGCAAAGCAATTGG + Intergenic
980759136 4:137205137-137205159 GTTGATAAATGTAGAGAAATTGG - Intergenic
981042430 4:140235654-140235676 GGAAAATTATCTAAAGAAATAGG + Intergenic
981373627 4:143988240-143988262 GGTATTATATGTCAATAAATAGG - Intergenic
981382731 4:144091500-144091522 GGTATTACATGTCAATAAATAGG - Intergenic
981450153 4:144887566-144887588 TGTAATAAAAGTATAGAAATGGG - Intergenic
982413253 4:155103373-155103395 GGTAATGTATACAAAGACATAGG - Intergenic
983654470 4:170068440-170068462 GCTAATCTTTCTAAAGAAATGGG - Intronic
983950654 4:173636666-173636688 GGTAATATTTGAAAAGATAATGG - Intergenic
984156115 4:176197803-176197825 TGTAAAATATGGAAATAAATAGG + Intergenic
984632198 4:182073062-182073084 GGTAATTTATATAAAGAAAAGGG + Intergenic
984655372 4:182311660-182311682 GGTCATATATGTAAAGCACCTGG + Intronic
985292177 4:188397795-188397817 GGAAAAAGATGTACAGAAATCGG - Intergenic
985583088 5:710290-710312 GGTAATTTATTTAAAAACATAGG - Intergenic
986749506 5:10774323-10774345 TGAACAATATGTAAAGAAATGGG - Intergenic
987004320 5:13693879-13693901 AGTGATATATGCATAGAAATTGG - Intronic
987394344 5:17407907-17407929 GGCATTATTTGTAAAGAAATGGG + Intergenic
987515011 5:18894355-18894377 AGTAATACAAGTAAAGACATAGG + Intergenic
987561838 5:19533868-19533890 TACAATACATGTAAAGAAATTGG + Intronic
987662342 5:20893686-20893708 GGTAATTTATATAGAAAAATAGG - Intergenic
987977923 5:25038811-25038833 GTTAATATATCTCAAAAAATCGG - Intergenic
988008467 5:25450677-25450699 GGCAATACATATACAGAAATAGG + Intergenic
988025482 5:25682119-25682141 GTACATATATGTAAAGAAAGAGG - Intergenic
988372986 5:30396298-30396320 GGTAATTTATAAAAAAAAATAGG - Intergenic
988465389 5:31486065-31486087 GGAAAAATATGTAAATATATGGG + Intronic
988761240 5:34311631-34311653 GGTAATTTATATAGAAAAATAGG + Intergenic
989106273 5:37866126-37866148 GTTGATATATATAGAGAAATTGG + Intergenic
989780009 5:45253654-45253676 TGTGATATATGTTAAGAAGTAGG + Intergenic
990769709 5:59229363-59229385 GGTCACTTATTTAAAGAAATAGG + Intronic
990770399 5:59237367-59237389 AATAATGGATGTAAAGAAATTGG - Intronic
991138593 5:63212636-63212658 GAAAATATCAGTAAAGAAATAGG - Intergenic
991313972 5:65278664-65278686 GGTAAGATATAAGAAGAAATTGG - Intronic
992541779 5:77772980-77773002 GGTCATATAAGTAAATGAATGGG + Intronic
992707864 5:79415500-79415522 TGTAATATATGTAAAATAAATGG - Intronic
992905323 5:81339823-81339845 TGTAGTATATGTGATGAAATTGG - Intronic
993555807 5:89336201-89336223 TTTAATATGTGCAAAGAAATAGG - Intergenic
993952181 5:94189913-94189935 GGTAAAATAAGTAAATAAATGGG - Intronic
994065148 5:95531340-95531362 GGCAAAATATGAAAACAAATTGG + Intronic
994727045 5:103448492-103448514 ATTAATAGATGTAAAGAACTTGG - Intergenic
995167944 5:109068749-109068771 AATAATATATGTAAAGAATGTGG + Intronic
995272678 5:110240063-110240085 GGCAAGATATGGAAAGAAGTAGG + Intergenic
995322563 5:110853178-110853200 AGTAACATAGGTAAAGAAGTTGG + Intergenic
996019790 5:118578493-118578515 TGTAATAGATCTAAAGTAATTGG - Intergenic
996354472 5:122580654-122580676 GGTGATAGATGGAAACAAATAGG - Intergenic
996454517 5:123664856-123664878 AGTAATATAAGGAAAGAAGTGGG - Intergenic
998282043 5:140820980-140821002 GGTGTTATAGATAAAGAAATAGG + Intronic
998478786 5:142444074-142444096 GGTCTTATATGTAAAGCACTTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999344346 5:150802187-150802209 GGTAATATAAGTAAGGTAGTTGG + Intergenic
999403603 5:151286767-151286789 GTTAATGTATGTAAATAATTTGG + Intronic
999900291 5:156079752-156079774 GCTAAAATATGTAAAGGCATAGG - Intronic
1000191529 5:158915551-158915573 GGACATTTATGTAAAGCAATCGG + Intronic
1000584076 5:163074056-163074078 GATAAAATATTTAAAGAAATAGG + Intergenic
1001366743 5:171148640-171148662 GATCATATATATAAAGTAATTGG + Intronic
1001627638 5:173149632-173149654 GGTAATTTATTTAAAAAAATGGG + Intronic
1003522750 6:6872552-6872574 GGTATTATCTGTAGAGACATCGG - Intergenic
1003790469 6:9541067-9541089 GATAATATGTATAAAGAAGTTGG + Intergenic
1003847947 6:10193301-10193323 TGTATTATATTTGAAGAAATGGG + Intronic
1003953174 6:11137898-11137920 CCTAATATCTCTAAAGAAATGGG - Exonic
1004021568 6:11780467-11780489 GCTAATATGTGTAAAGCAACTGG - Intronic
1004146784 6:13075185-13075207 GTTAATATATGTGATGAACTTGG - Intronic
1004938769 6:20533842-20533864 GATAACATATGTAGAGAAAGCGG + Intergenic
1005007071 6:21298208-21298230 GGTAAAAGATGAAGAGAAATAGG + Intergenic
1007169015 6:39849458-39849480 GTTAATATTTGTAAAGCATTTGG - Intronic
1008818773 6:55605500-55605522 TGTAATATATTTATAGATATTGG + Intergenic
1009357044 6:62763266-62763288 GGTAATTTATGAAAAAAAAGAGG - Intergenic
1009438463 6:63645996-63646018 GGTAATATATATATAGACAAAGG - Intronic
1009684824 6:66943770-66943792 GGTAATTTATTAAAAAAAATAGG + Intergenic
1009743237 6:67776020-67776042 GGTAATATTTGTAAAACAGTAGG + Intergenic
1009897344 6:69769536-69769558 TATAAAATATGCAAAGAAATAGG - Intronic
1009931197 6:70179247-70179269 GGAGAAATATGAAAAGAAATGGG - Intronic
1010510662 6:76715165-76715187 AGTAATATAGGAAAAGAAACAGG + Intergenic
1010656493 6:78517880-78517902 GGTAATATCTGGATTGAAATGGG - Intergenic
1011015264 6:82747221-82747243 GGTAATATATGTATATATAGTGG - Intergenic
1011060347 6:83259008-83259030 GGAAATATATGAACAGATATTGG + Intronic
1011152270 6:84287397-84287419 GATAATTCATGTAAAGCAATTGG + Intergenic
1011360073 6:86514370-86514392 TCTAATACATGTAAAGAAATTGG - Intergenic
1011469371 6:87692437-87692459 GGTAGTAGATGTTAAGAACTTGG - Intronic
1011600062 6:89051736-89051758 GGTAATTTAGGGAAAGAAAGAGG + Intergenic
1011676542 6:89739967-89739989 GGTAACATATGTAAAGGGCTAGG + Intronic
1011979021 6:93348091-93348113 GTTAATATTTGTAATGAAATAGG - Intronic
1012321882 6:97859334-97859356 GGTAAAATATGCTAATAAATTGG - Intergenic
1012760040 6:103289284-103289306 AGTAAGATGTGTAAGGAAATAGG + Intergenic
1014024130 6:116625108-116625130 GGTAGTATATATAAAGGATTTGG + Intronic
1014055750 6:117013927-117013949 GGTTATATATTTCCAGAAATTGG - Intergenic
1014418016 6:121208256-121208278 GGTAATTTATTTAAAAAAAAAGG + Intronic
1014487100 6:122012946-122012968 GGAAAAATATGTTAAGAAATAGG + Intergenic
1014662305 6:124188225-124188247 GGAAATATATATTAAGAGATTGG + Intronic
1014667008 6:124250747-124250769 GGTAATGTTAGTAAAGATATAGG + Intronic
1014897225 6:126917132-126917154 GGTAAAACATGTACACAAATTGG - Intergenic
1015103268 6:129506049-129506071 GGTAATTTATTTAAAGTGATTGG + Intronic
1015122433 6:129714151-129714173 GGTAATTTATGTACCCAAATAGG + Intergenic
1015942934 6:138470104-138470126 GGCAATCTCTGTTAAGAAATTGG - Intronic
1016327774 6:142922523-142922545 ACTAATATATGTAAAGAACCTGG - Intronic
1017311146 6:152979098-152979120 AGTAATATAAGTTAAGCAATGGG - Intronic
1017649528 6:156568166-156568188 GGTAATATTCTAAAAGAAATTGG + Intergenic
1018516759 6:164589253-164589275 GGTAAAAAATGTTAGGAAATAGG + Intergenic
1018766357 6:166936417-166936439 GGTAATTTATTTAAAAAAAGAGG + Intronic
1020569388 7:9839361-9839383 TATAATACATTTAAAGAAATGGG - Intergenic
1020612818 7:10422198-10422220 GGTCTTTTGTGTAAAGAAATTGG + Intergenic
1020899426 7:13986745-13986767 GGAAATATTTGTCATGAAATTGG + Intronic
1021300162 7:18962776-18962798 GATAATATATGTAAATACTTAGG - Intronic
1021854234 7:24838110-24838132 GGGAATGTCTGTAAAGAACTAGG + Intronic
1021896612 7:25242270-25242292 GGTAAGATCTGTAAACAATTGGG + Intergenic
1023195301 7:37631211-37631233 GCTACTATATGTTAATAAATTGG - Intergenic
1023300486 7:38765590-38765612 GTTTATAAATTTAAAGAAATTGG - Exonic
1023305896 7:38826581-38826603 GTTAATATATGTAAATTACTTGG - Intronic
1023858764 7:44203674-44203696 GGTAATACGTGTAAAGCACTTGG - Intronic
1024130954 7:46353000-46353022 GGTACTGTGGGTAAAGAAATAGG + Intergenic
1024215349 7:47243750-47243772 TGAAATACATGTAAAGAAATTGG + Intergenic
1025172828 7:56776482-56776504 GCTAAAATATTTAAAGCAATTGG - Intergenic
1025699283 7:63801679-63801701 GCTAAAATATTTAAAGCAATTGG + Intergenic
1027523496 7:79238475-79238497 GGACATATACGTCAAGAAATTGG + Intronic
1027565470 7:79786695-79786717 AATAATATATCTAAAGAAATTGG + Intergenic
1027796930 7:82707119-82707141 ATTAATATATTTAAAGAATTAGG - Intergenic
1028023965 7:85813467-85813489 GGTAATTTATGGAAAAAAAGAGG + Intergenic
1028041619 7:86060870-86060892 GGTAATTTATAAAAAGAAAGAGG + Intergenic
1028147451 7:87334039-87334061 AGTTATAGATGTGAAGAAATTGG - Intergenic
1028683922 7:93571444-93571466 GTTAATATTTGTAAAGCATTTGG - Intronic
1028885836 7:95931667-95931689 GGGACAATATGTAAATAAATGGG - Intronic
1030272040 7:107679007-107679029 AGTAACAAATGCAAAGAAATAGG + Intronic
1030372757 7:108719073-108719095 GAGAATATATGTAAGGGAATAGG - Intergenic
1030407050 7:109128398-109128420 TGTAAAGTATGTAAATAAATGGG - Intergenic
1030444365 7:109630540-109630562 GGAAATATGAGTGAAGAAATGGG - Intergenic
1031031706 7:116742546-116742568 GGTATTTTAAGTAAAGAAAATGG + Intronic
1031240733 7:119235630-119235652 TGTAATAGATGCAAACAAATTGG - Intergenic
1031289262 7:119911645-119911667 GGGAATAAATGTAAATAAATAGG - Intergenic
1031318414 7:120288185-120288207 TGTAATAAAAGTAAAGAAAATGG + Intronic
1031404807 7:121371885-121371907 GTTATTATAAGTACAGAAATTGG - Intronic
1031666165 7:124485114-124485136 GTTAAAATATGTAAAGCAAGAGG + Intergenic
1031746287 7:125502594-125502616 GCAACTATATGTAAATAAATTGG - Intergenic
1032278757 7:130484034-130484056 GTTAATATGTGTAAAGCACTTGG - Intergenic
1032488049 7:132303268-132303290 GGTAGAAAATGTAAAGAAATTGG + Intronic
1032778162 7:135137187-135137209 GGTAATATAAGCAGAGAGATGGG + Intronic
1032898096 7:136274966-136274988 GGTAACATATGTAGAAAAACTGG - Intergenic
1033019029 7:137703073-137703095 GGTAATTTATGAAAAAAAAGAGG + Intronic
1033779783 7:144654765-144654787 GTTAATATATATAAAGCACTTGG + Intronic
1034082572 7:148293400-148293422 GGTAATAGATGTAAAGAATTGGG + Intronic
1034391394 7:150790361-150790383 GGTACAATGTGTAAAGAAATGGG + Intergenic
1035040451 7:155922941-155922963 GATAATATTTGTAAAGCGATTGG - Intergenic
1035978780 8:4344520-4344542 AGAAATATATATAAATAAATAGG + Intronic
1036005277 8:4655087-4655109 AGTAATATAGGTAAATTAATAGG - Intronic
1036086898 8:5622235-5622257 AGAGATATATGTTAAGAAATTGG - Intergenic
1037009768 8:13826549-13826571 GGCCATATATGCAAATAAATGGG + Intergenic
1037207811 8:16345078-16345100 AGTAATATATGTAAAGAATATGG - Intronic
1037456901 8:19072791-19072813 GTTATAATATGTAAAGAACTTGG - Intronic
1038296294 8:26293154-26293176 GGTAATGAATGCAAAGAAATGGG + Intronic
1038763441 8:30405971-30405993 GGTAATATTTAAATAGAAATGGG + Intronic
1039530803 8:38259971-38259993 GATAATATATGTAAAACATTTGG + Intronic
1039638139 8:39188579-39188601 GTTAATATATGTAAAGTGCTTGG - Intronic
1041539034 8:58962349-58962371 GTTAATACATGTAAAGATACAGG - Intronic
1041850668 8:62388475-62388497 GGTAATATGTGGTAACAAATGGG + Intronic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1042378110 8:68079385-68079407 GGTAATAAATATAAATAACTTGG - Intronic
1042617123 8:70662170-70662192 GGTAAAATATGTAAAGTCCTTGG - Exonic
1042895837 8:73666826-73666848 TGTAATATATCTTAAGAAAATGG - Intronic
1043086692 8:75843621-75843643 GGTGAAGTATGCAAAGAAATAGG - Intergenic
1043092126 8:75918047-75918069 GGTAATTTATTTAAACAAAATGG - Intergenic
1043133761 8:76494802-76494824 AGCAATATATGTCAACAAATTGG - Intergenic
1043234866 8:77851051-77851073 GCTAATATAAGAAAAGAAACAGG - Intergenic
1043836093 8:85048486-85048508 GGTAAAATAGTTAAACAAATTGG - Intergenic
1044095175 8:88055137-88055159 TGTAATATCTGTTAACAAATGGG + Intronic
1044189277 8:89295972-89295994 GGAACTATAAGTAAAAAAATGGG - Intergenic
1044398154 8:91738385-91738407 GATAATGTATGTAAAGAGTTTGG - Intergenic
1044995955 8:97838440-97838462 GTTAATCTATGTAAAGCACTCGG - Intronic
1045012579 8:97970989-97971011 GGGAATAAATGTAAACATATGGG + Intronic
1045220883 8:100199246-100199268 TGGCAAATATGTAAAGAAATTGG - Intronic
1045736768 8:105305283-105305305 GTTAATATATGTAAAGTGCTTGG - Intronic
1045930041 8:107611619-107611641 GGTTCTAGATATAAAGAAATAGG - Intergenic
1046441656 8:114262951-114262973 GGTAATTTATTTAAAAAAAAGGG - Intergenic
1046445655 8:114314696-114314718 GGTTATATAAGTAAAGGACTAGG + Intergenic
1047085713 8:121513166-121513188 AGTAACATTTATAAAGAAATGGG - Intergenic
1047642112 8:126832023-126832045 GGAAATATTTGCAAAGAAATAGG + Intergenic
1047894304 8:129349126-129349148 GGTAATTTATTTAAAAAAAAAGG + Intergenic
1048255514 8:132902368-132902390 GTTGATATTTGTAAAGAGATGGG + Intronic
1048650042 8:136465781-136465803 GGAAACATTTGTAAAGAAAAGGG + Intergenic
1049897188 9:118991-119013 GGTTAAATATTCAAAGAAATTGG - Intergenic
1050058786 9:1683598-1683620 GTTAATATATTTAATGTAATTGG - Intergenic
1050086198 9:1968304-1968326 AGTTACAAATGTAAAGAAATGGG + Intergenic
1050907558 9:11024951-11024973 GTTAGTAAATATAAAGAAATTGG - Intergenic
1051865672 9:21678300-21678322 GGTAATATAAGTAAAACAACTGG + Intergenic
1051868374 9:21708078-21708100 AGTAATATAAGTTAAGACATAGG - Intergenic
1051937919 9:22466811-22466833 GTTATTATATTTAAAGCAATGGG + Intergenic
1051992366 9:23167230-23167252 GCAAATATATGTCAATAAATTGG + Intergenic
1052073895 9:24117337-24117359 GGTATTATATTCAAAGCAATAGG + Intergenic
1053721300 9:40949778-40949800 AGTTGTATTTGTAAAGAAATGGG - Intergenic
1053740289 9:41129256-41129278 GGTTAAATATTCAAAGAAATTGG - Intergenic
1054344693 9:63902390-63902412 AGTTGTATTTGTAAAGAAATGGG + Intergenic
1054443254 9:65285249-65285271 GGTTAAATATTCAAAGAAATTGG - Intergenic
1054487026 9:65736252-65736274 GGTTAAATATTCAAAGAAATTGG + Intergenic
1054688060 9:68302057-68302079 GGTTAAATATTCAAAGAAATTGG + Intergenic
1055547708 9:77397432-77397454 GGAAATATATTTAAGAAAATTGG - Intronic
1055698799 9:78918305-78918327 GGTAATATATGAAGAAAAAAAGG - Intergenic
1055902836 9:81260989-81261011 AGTAATAAATGCAAAGAAATGGG + Intergenic
1056163327 9:83919877-83919899 GGTAATATCTATAAAGAATTTGG + Intronic
1056453759 9:86740786-86740808 GGTGATATATGAAAAGTACTCGG + Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1057940752 9:99281535-99281557 TGTAATTTTTTTAAAGAAATGGG + Intergenic
1057972553 9:99571680-99571702 GGTAATTTTTTTAAAGAGATGGG - Intergenic
1058007175 9:99929665-99929687 TGTAATATATGTAATTATATGGG - Intronic
1058122000 9:101148836-101148858 GGGAATAAAGGCAAAGAAATGGG - Intronic
1058416162 9:104790856-104790878 TTTAATTTATTTAAAGAAATAGG - Intronic
1058586938 9:106518341-106518363 GGTAGTTTATGTCAAAAAATTGG - Intergenic
1058961472 9:109996314-109996336 GGTAATATTTGTGAAATAATTGG + Intronic
1060229486 9:121816041-121816063 CGTAATGTATGTAAAGAACCGGG - Intergenic
1060625864 9:125110748-125110770 GGGTAAATTTGTAAAGAAATAGG - Intronic
1061752345 9:132788612-132788634 GTTAATATATTTAAAGACAGGGG + Intronic
1203654427 Un_KI270752v1:9137-9159 TGTAATATTTGGAAAGAAACTGG + Intergenic
1185682900 X:1903122-1903144 GGTAATATATTTACATAAGTCGG - Intergenic
1185834532 X:3332827-3332849 GGTAAAATATTAAAAGAATTGGG + Intronic
1186343756 X:8669884-8669906 GGTAAGATAATTAAAGCAATCGG - Intronic
1186792974 X:13016905-13016927 GGGAAATTATGTACAGAAATGGG - Intergenic
1187082610 X:16007001-16007023 GGTAATTTATTTAAAAAAAGAGG + Intergenic
1187546645 X:20260726-20260748 GATAATATATGTAAAGTACTTGG - Intronic
1187565482 X:20445324-20445346 GCTAATATATTAAAAGAAAAAGG + Intergenic
1188239407 X:27766911-27766933 GTCATTTTATGTAAAGAAATGGG + Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1189016023 X:37097210-37097232 GGTAATATTTAAATAGAAATGGG + Intergenic
1189387304 X:40547913-40547935 GATAATATGTGTAGAGGAATTGG - Intergenic
1189575448 X:42348156-42348178 TGGAATAAATGTAAAGATATCGG - Intergenic
1192292120 X:69809215-69809237 GGTAATTTATGGAAAAAAAGAGG + Intronic
1193453167 X:81696128-81696150 ATTAATATATTTAAAGAATTAGG + Intergenic
1193657565 X:84217207-84217229 GGCAGTTTATGTAAAGAAAAAGG - Intergenic
1193950114 X:87787328-87787350 GGTAATTTATATAAAAAAAGAGG + Intergenic
1194038424 X:88910001-88910023 GGTAATATATGTAAAGTAAATGG + Intergenic
1194226345 X:91263983-91264005 AGTGATATATGTAAAAAAATTGG - Intergenic
1194244107 X:91489867-91489889 GGTGAAAGAAGTAAAGAAATTGG - Intergenic
1194599558 X:95903711-95903733 AGTAGTATATATAAGGAAATAGG - Intergenic
1195061657 X:101201353-101201375 GTTAGAATATGTAAAGAACTGGG - Intergenic
1195154680 X:102110903-102110925 GGTAATTTATTTAAAAAAATAGG - Intergenic
1195155739 X:102122543-102122565 GGTAATTTATGTAAAGTCACTGG - Intergenic
1195627319 X:107017729-107017751 GGTGATATATGTAAAATACTTGG + Intergenic
1195720868 X:107866870-107866892 GATAATACATGTAAAGCACTTGG - Intronic
1195869912 X:109475082-109475104 GGGCAAATGTGTAAAGAAATGGG + Intronic
1196070982 X:111521559-111521581 AGTAATATATGTTAATACATTGG - Intergenic
1196696274 X:118616176-118616198 ATTAATATATGAAAAGAAAAGGG - Intronic
1196908220 X:120459666-120459688 TGTAACATATGTACAGAAACAGG + Intronic
1196972159 X:121121568-121121590 GCTAATATATGTGAAGAGAGGGG - Intergenic
1197814642 X:130484646-130484668 GGAATTAGAAGTAAAGAAATTGG - Intergenic
1198003456 X:132465281-132465303 GGTAATACTTTTAAATAAATTGG + Intronic
1198010393 X:132546823-132546845 GGTAATTCATGTGAAGAATTAGG + Intergenic
1198017268 X:132624077-132624099 GGGAAAATATGCAAAGAAATGGG + Intergenic
1198021213 X:132659937-132659959 GTTAATGCATGTAAAGAAATGGG - Intronic
1198509773 X:137338610-137338632 GATAATATATGTAAAGCACTTGG + Intergenic
1198912614 X:141631561-141631583 AGTAATTTATGTAAAAAACTTGG + Intronic
1199174379 X:144767983-144768005 TGCTATATATGAAAAGAAATAGG - Intergenic
1199473020 X:148215847-148215869 GGGAATACATGTAAAACAATTGG - Intergenic
1199948828 X:152689229-152689251 GGTAATTTATTAAAAAAAATAGG + Intergenic
1200310066 X:155069467-155069489 GTCAATATATGTAAACATATAGG - Intronic
1200563088 Y:4731197-4731219 GGTGAAAGAAGTAAAGAAATTGG - Intergenic
1201423922 Y:13828895-13828917 GGTAAGATAATTAAAGCAATTGG + Intergenic
1201928456 Y:19315563-19315585 GGTGATTTATATAAAGAAAGAGG + Intergenic