ID: 964411027

View in Genome Browser
Species Human (GRCh38)
Location 3:156398228-156398250
Sequence CTGTCGGGGTGGTGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964411027 Original CRISPR CTGTCGGGGTGGTGGGAAAA GGG Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
902202410 1:14843710-14843732 CTGTCAGGGTAGTGGGATGAGGG - Intronic
903499308 1:23792816-23792838 CTGGAGGGGGTGTGGGAAAATGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
905006950 1:34717512-34717534 CTGTCGGGGGGTGGGGAGAAGGG - Intronic
905473735 1:38211501-38211523 CTGTAGGGGCGGTGGGGAACAGG - Intergenic
908534924 1:65067745-65067767 ATGGCGGGGGGGTTGGAAAAGGG + Intergenic
909340259 1:74523920-74523942 CTGTCGGGGGTGGGGGGAAAGGG - Intronic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
913438005 1:118867281-118867303 TTGTGGGGGTGGTGGTAAAGAGG - Intergenic
914815464 1:151059349-151059371 ATGCTGGGGTGGTGGGAAAGGGG - Exonic
915240305 1:154516417-154516439 ATATGGGGGTGGTGGGAGAATGG + Intronic
915312501 1:155011549-155011571 CTGGGGGGGTGGCGGGAAAGAGG + Intronic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917237384 1:172909016-172909038 CTGGTGAGGTTGTGGGAAAAAGG + Intergenic
917755171 1:178091810-178091832 CTGTCGGGGCGTGGGGGAAAGGG + Intergenic
918377681 1:183925328-183925350 CTGTCAGGGGGTTGGGGAAAAGG + Intronic
919070225 1:192746107-192746129 ATCTCAGGGTGGGGGGAAAAAGG - Intergenic
920873771 1:209815950-209815972 CTGTCCTGGGGGTGGGAAGAAGG + Intergenic
921017789 1:211208000-211208022 CTGTCTGGGTGGTGGGTTATGGG + Intergenic
921881568 1:220260589-220260611 CTGTTGGGGTGGTGGGGGGAGGG + Intronic
922533690 1:226364067-226364089 CTGTCTGGAAGGTCGGAAAAGGG + Exonic
923405394 1:233654192-233654214 CCATCGGGGTGGGGGGGAAAGGG + Intronic
1062904023 10:1167500-1167522 CACGCGGTGTGGTGGGAAAACGG - Intergenic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064110695 10:12536167-12536189 CAGTCTGGGTGGTGGGTACATGG - Intronic
1064331914 10:14402064-14402086 CTGTCGGGGGGTTGGGGACAAGG - Intronic
1064878203 10:20019392-20019414 ATGTCGGGGTGCAGGGGAAAGGG - Intronic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1068116897 10:52745980-52746002 CTGTCAAGGGGGTGGGAAGAGGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073649487 10:105343407-105343429 CTGTCTAGGTAGGGGGAAAAAGG - Intergenic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077014186 11:392721-392743 GGGTCGGGGTGGTGGGGAAGGGG - Intronic
1077159993 11:1108325-1108347 TTGTCTGGGAGGAGGGAAAAGGG - Intergenic
1077215422 11:1393443-1393465 CTGTCTGGGGGGCGGGAGAAAGG + Intronic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1081346842 11:41997987-41998009 ATGTCAGGGTGGAGGGGAAAGGG + Intergenic
1083255128 11:61490943-61490965 CTATCAGGGTGGCTGGAAAAAGG + Intergenic
1083363523 11:62127898-62127920 CTGGCGGGGGGGTGGGGACAGGG + Intronic
1083410596 11:62489820-62489842 CTTTCGAGGTTGTGGGAAGAGGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1085956991 11:81410631-81410653 CTGTCAGGGGGTTGGGAGAAAGG - Intergenic
1087550833 11:99645792-99645814 CTGTCGGGGTGGGGGGCTAGGGG + Intronic
1087901993 11:103651349-103651371 CTGTTGGGGTGGGGGCACAATGG + Intergenic
1088921046 11:114259941-114259963 CAGTCAGGGTGGTGGGTAAGGGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089685061 11:120141521-120141543 ATGTTGGGGTGGTGGGACGAGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091541997 12:1470379-1470401 CTGTCAGGGTGGTAAGAACAAGG - Intronic
1093734642 12:22606542-22606564 CTGTCGGGGTGGGGGGCTAGGGG + Intergenic
1094202871 12:27810972-27810994 CCTCCGGGCTGGTGGGAAAACGG + Intergenic
1094579130 12:31717868-31717890 CTGTCGGGGGGTTGGGGACAAGG - Intronic
1098612004 12:72470341-72470363 GTGTCTATGTGGTGGGAAAAGGG - Intronic
1099022391 12:77422939-77422961 CTGTCAGGGGGTGGGGAAAAGGG - Intergenic
1100942760 12:99741739-99741761 CTGTCGAGGTGGGGGGCAAGGGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105279297 13:18953972-18953994 CTTTCCGGGTGGTGGAGAAAGGG - Intergenic
1105699279 13:22923861-22923883 CTGTCGGGGTGGAGGGGAAGGGG + Intergenic
1107244451 13:38275860-38275882 CTGTCGGGGTGTGGGGAGTAAGG + Intergenic
1107976371 13:45692566-45692588 CTGTCGGGGTAGGGGGGAATTGG - Intergenic
1108656752 13:52540928-52540950 CTGTCGGGGTTGGGGGAAAGGGG - Intergenic
1108849783 13:54714216-54714238 CTGTCAGGGTTGGGGGGAAAGGG - Intergenic
1110727073 13:78838210-78838232 CTGTCGGGGGTGGGGGACAAGGG - Intergenic
1111266032 13:85814709-85814731 CTGTTGGGGTGGGAGGAAAGAGG - Intergenic
1112628178 13:101129866-101129888 CTATCGGGGTGGGGGGCAAGGGG - Intronic
1112907803 13:104445892-104445914 CTGTCGGGGTGGGGGTCAAGGGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116668429 14:47809273-47809295 CTGGCGGGGAGGTGGAGAAAAGG - Intergenic
1117102953 14:52369290-52369312 CTGTCGGGGAAGTGGCTAAAAGG - Intergenic
1117234578 14:53757997-53758019 CTGGGGGGGTTGTGAGAAAAGGG + Intergenic
1118734473 14:68691639-68691661 CTGGCGGGTAGGTGGGAAACAGG + Intronic
1119776921 14:77254848-77254870 ATCTCTGGGTGGTGGGAATATGG - Intronic
1119912018 14:78358189-78358211 CTGTAGGGGTGGTGGTAATGAGG + Intronic
1120883368 14:89432502-89432524 CTGTAAGGGTGGTGGAAAGATGG - Intronic
1121234391 14:92381425-92381447 CTGTCAGGACGGTGGGGAAAGGG + Intronic
1121330195 14:93044905-93044927 CTGTCAGGTTGGTGGGGAAAGGG - Intronic
1121582560 14:95041765-95041787 CTCTCTGGGTTGTGGGGAAAGGG - Intergenic
1122675489 14:103409291-103409313 CTGTCGGGGTGAGGGGCAAGGGG + Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1123178535 14:106445016-106445038 CTGTCGGGGTGGGGAGCAAGGGG - Intergenic
1124827370 15:33111780-33111802 TGGACGGGGTTGTGGGAAAATGG + Intronic
1125428954 15:39577280-39577302 CTGGCAGGGAAGTGGGAAAAAGG + Intergenic
1126736897 15:51739120-51739142 CAGTTGGGCAGGTGGGAAAAAGG - Intronic
1127535716 15:59888223-59888245 CTGTCGGGGGGTGGGGAGAAAGG + Intergenic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1128210985 15:65902392-65902414 TTGGCTGGGTGGTGAGAAAAGGG + Intronic
1129325503 15:74798413-74798435 CTGACTGAGTGCTGGGAAAAAGG - Intronic
1129472973 15:75765445-75765467 CTGTCTGGCTGCTGGGGAAAGGG + Intergenic
1129498577 15:76013493-76013515 CTGTCGGGGTGGGGGGCTAAGGG - Intronic
1129848314 15:78778108-78778130 CTGTCGGGGTGTGGGGGAAACGG - Intronic
1132378857 15:101351746-101351768 CTTCATGGGTGGTGGGAAAATGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133371732 16:5250419-5250441 CTGTCGGGGGTGAGGGACAAGGG - Intergenic
1133449451 16:5891528-5891550 CTCTCGGGGATGAGGGAAAACGG - Intergenic
1133741658 16:8656377-8656399 CTGTGGGGGAAGTGGGGAAAAGG - Intergenic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134337431 16:13313790-13313812 CTCTCTGGATGGTGGGAAACAGG + Intergenic
1134800541 16:17080483-17080505 CTGTCGGGGGTGGGGGGAAAGGG - Intergenic
1134887904 16:17810694-17810716 CTGTCGGGGGTGGGGGAAAAGGG - Intergenic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1136481768 16:30546452-30546474 CTGTCGGGGAGGGGGAAAATTGG + Intronic
1136900665 16:34034296-34034318 CTTTACCGGTGGTGGGAAAATGG - Intergenic
1138191279 16:55016182-55016204 GTGGGGGGGTGTTGGGAAAAGGG + Intergenic
1138442113 16:57041405-57041427 GTGTCTGGGGGGTGGGAAAGCGG + Intronic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1140582152 16:76243655-76243677 CTCTTGGGGAGATGGGAAAAGGG + Intergenic
1141320250 16:83001772-83001794 CTGTCCAGGTGGTGGGATACAGG + Intronic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141709356 16:85688974-85688996 CTCTCGCCGTGGCGGGAAAACGG - Exonic
1141822820 16:86459353-86459375 CTGTCGGGATGAAGTGAAAATGG + Intergenic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1143735118 17:8906152-8906174 CTGTCGGGGATGGGGGACAAGGG - Intronic
1144012517 17:11163185-11163207 CTGTCAGGGTGGTGGGGGACAGG + Intergenic
1146400527 17:32497101-32497123 GGTTCGGGCTGGTGGGAAAATGG + Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147516766 17:41125543-41125565 CTGTCGGGGGTGAGGGACAAGGG + Intergenic
1147612361 17:41809557-41809579 GTCTAGGGGTGGTGGGAATATGG - Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1149730819 17:58944483-58944505 CTGGAGGGGTGGTGGGAATGAGG - Intronic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1152285696 17:79411488-79411510 CTGGAGGGGAGGTGGGAGAAGGG - Intronic
1152449201 17:80365740-80365762 CTGTGTGGGTGTGGGGAAAAGGG - Intronic
1152610244 17:81311796-81311818 CTGTGCGGGGCGTGGGAAAAAGG - Exonic
1152615688 17:81336837-81336859 GTGTCAGGCTGGTGGGAAATGGG - Intergenic
1152982348 18:290336-290358 CTGTCGGGGTGGGGGGCAAGAGG + Intergenic
1154317610 18:13317778-13317800 CTGTCTGAGTGGTGGGATTATGG + Intronic
1155012679 18:21796387-21796409 CTGTCAGGGTGGGGGGCAAGGGG + Intronic
1155763205 18:29591734-29591756 CTGTCGGGGAGTAGGGGAAAAGG + Intergenic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1158157899 18:54446018-54446040 CTGTCGGGGGGTTGGGGACAAGG - Intergenic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161938414 19:7386547-7386569 ATGTGGAGGAGGTGGGAAAAGGG + Intronic
1164157934 19:22607751-22607773 CTGATGGGGCAGTGGGAAAAAGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1168503492 19:56913351-56913373 CTGTCGGGGTGTGGGGGAAGGGG + Intergenic
925158984 2:1669294-1669316 CTGTCGGGGGGTTGGGGGAAAGG + Intronic
927200324 2:20574458-20574480 CCTTCGCAGTGGTGGGAAAAAGG - Intronic
927235027 2:20865252-20865274 CTGTCGAGGTTGTGGAGAAAAGG + Intergenic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
928923052 2:36545992-36546014 CTGGAGGGGTGGTGGGAGCAGGG - Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
930070031 2:47358812-47358834 CTGTCTGCGTGGGGGGGAAAAGG + Intronic
931873379 2:66485251-66485273 CTGTCGGGGTGGGGTGCAAGGGG - Intronic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
934857671 2:97739231-97739253 CTGTTGGGGTGGCGGGACATTGG - Intronic
934925855 2:98381286-98381308 TTTTCTGGGGGGTGGGAAAAGGG + Intronic
936629749 2:114189413-114189435 ATGGCTGGGTGGTGGGAGAATGG + Intergenic
938423787 2:131167249-131167271 CTGTCGGGGTGGGGGGCAAGTGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
942547562 2:177080565-177080587 CTGTCGGGGGTGTGGGGGAAAGG + Intergenic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
945154915 2:206828397-206828419 CTGCGGTGGTGGTGGGGAAAGGG - Intergenic
945920225 2:215748233-215748255 CTGAGGAGGAGGTGGGAAAACGG + Intergenic
946511992 2:220367786-220367808 CAGTCGGGGTGTGGGGAGAAAGG + Intergenic
946908598 2:224439245-224439267 GTGTGGTGGTGGTGGGGAAAAGG - Intergenic
947531231 2:230909816-230909838 CTGTCTGGGCAGTGGAAAAAAGG + Exonic
948133784 2:235620726-235620748 CTGTCTAGGTGCTGGGGAAACGG - Intronic
1170190916 20:13644176-13644198 CTGACGAGGTTGTGGGGAAAAGG - Intergenic
1170238773 20:14138613-14138635 GTGGCTGGGTGGGGGGAAAATGG + Intronic
1170427046 20:16245499-16245521 TTGTTGGGGTTGTGGGAAATGGG - Intergenic
1172058086 20:32168112-32168134 GTGGCGGGGTGGTGGGTAACAGG - Intergenic
1172289111 20:33762682-33762704 CTGTCGGGGGGCTGGGGACAAGG - Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173750590 20:45472265-45472287 CTGTCGGGGGGTTGGGAATTAGG - Intronic
1174285655 20:49471188-49471210 CTGTAAGGGTGCTGGGAAAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175336032 20:58197031-58197053 GTGACGGGGTGGTGGTAAGATGG - Intergenic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1175849867 20:62084063-62084085 CTGTCTCTGTGGTGAGAAAATGG - Intergenic
1176117711 20:63440244-63440266 CTCTAGGGGTGGTGGGCAAGGGG + Intronic
1177534235 21:22403173-22403195 TTGGCGGGAGGGTGGGAAAAGGG + Intergenic
1180278804 22:10673504-10673526 CTGTCAGGGGGGTGGGAGACTGG - Intergenic
1181309287 22:21935346-21935368 CTGTAGGGGTGGGGGTATAAGGG + Intronic
1181858249 22:25798168-25798190 CTCTCGGAGCGGTGGGAACAGGG + Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1185017905 22:48356158-48356180 CTGTCGGGGGGTGGGGAGAAAGG - Intergenic
1185083420 22:48722551-48722573 CTGTCGGGGTGGGGGGCTAGGGG + Intronic
950182219 3:10922562-10922584 CTTCAGGGGTGGTCGGAAAAGGG + Intronic
950260188 3:11537785-11537807 CTGTATGGTTGGTGGTAAAATGG + Intronic
950889105 3:16387355-16387377 CTCTGGAGGTGGTGGGAAAGTGG - Intronic
953800171 3:46016766-46016788 GAGTCAGGGTGGTGGGAAACTGG - Intergenic
955113371 3:55972424-55972446 CTGTTGGGGTGTTGGGGACAAGG - Intronic
955589048 3:60514487-60514509 CTGTCGAGGAGGTGGGGAGAAGG + Intronic
955718474 3:61856309-61856331 TTGCCGGGGCGGTGGGAAATGGG - Intronic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
957068897 3:75550062-75550084 TGGTGGTGGTGGTGGGAAAATGG - Intergenic
957168251 3:76703510-76703532 CTGTCGGGGGTGGGGGAAAGGGG - Intronic
957850152 3:85797402-85797424 CTGTTGGGGTAGTGGGGTAAGGG - Intronic
957910781 3:86618275-86618297 CTGACCGGGTGTTGGCAAAAGGG + Intergenic
958615059 3:96482737-96482759 CTGTTGGGGGGTGGGGAAAAGGG - Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
961069781 3:123911944-123911966 CTCCAGGGGTGGTGGGAATAAGG + Intronic
961282874 3:125777277-125777299 CTGTCGGGGGTGAGGGACAAGGG - Intergenic
961284512 3:125790265-125790287 CGGTGGTGGTGGTGGGAAACTGG + Intergenic
961988879 3:131166632-131166654 GTGTCAGAGGGGTGGGAAAAGGG - Intronic
962200609 3:133398599-133398621 CTCTCTGGGTGGTGGGCAACAGG + Intergenic
962694559 3:137935159-137935181 CTGTCGGGGGTGGGGGACAAGGG - Intergenic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963346001 3:144097214-144097236 CTGTCGGGGGGGTGGGGACTGGG + Intergenic
963628696 3:147706987-147707009 TTGTCGGGGTTGGGGGCAAAGGG - Intergenic
964179629 3:153867711-153867733 CTGTCGGGGTGGGGGGTTAGGGG - Intergenic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967039966 3:185682834-185682856 CTGTTGGTGGGGTTGGAAAATGG + Intronic
967507606 3:190270758-190270780 CTGTCGGTGAAGTGGGGAAAGGG - Intergenic
967670828 3:192233187-192233209 CTGGTGGGGTTGTGGAAAAAAGG - Intronic
968545085 4:1194280-1194302 CAGTCAGGGTGGCAGGAAAAAGG + Intronic
968613418 4:1567174-1567196 CTGGCAGGGTGCTGGGGAAAGGG - Intergenic
970888711 4:21017338-21017360 CTGTCAGGGGGTTGGGAGAAGGG - Intronic
971428672 4:26541122-26541144 CTGTCGGGGTGGGGGACAAGGGG + Intergenic
971517184 4:27501370-27501392 CTGTTGGGGGGTTGGGACAAGGG + Intergenic
972035619 4:34515454-34515476 CTGTCAGGGTGCTAGGAAATTGG - Intergenic
975535952 4:75450583-75450605 TTCTCGGGGTGGGGGGAAGAAGG - Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977297696 4:95229272-95229294 CTGTCGGGGTGGGGGGCTAGGGG - Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979452619 4:120890602-120890624 CTGGTGAGGTTGTGGGAAAAAGG - Intronic
979641185 4:123013590-123013612 CTGTCGGGGTTGGGGGGCAAGGG + Intronic
980078425 4:128318763-128318785 CTGTGCATGTGGTGGGAAAAGGG + Intergenic
980317098 4:131216558-131216580 CTGTTGGGGTTGGGGGACAAGGG - Intergenic
980799957 4:137734999-137735021 CTGTCGGGGAGTCGGGGAAAAGG + Intergenic
981589290 4:146339972-146339994 CTGTCGGGGTGGGGGACAAGGGG - Intronic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
983264609 4:165494865-165494887 GTGTAGGGGTGTTAGGAAAAAGG + Intronic
983526248 4:168763019-168763041 CTGTTGGGGTAGGGGGCAAAGGG + Intronic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
984450407 4:179893673-179893695 ATGTAGGGGTGGGAGGAAAAGGG + Intergenic
984691898 4:182735500-182735522 ATGTGGAGGTGGTGGGGAAAGGG + Intronic
985515598 5:343353-343375 TTCTCGGGGTGATGGGAACACGG + Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985819808 5:2151873-2151895 CTGTTGGGGAGCTGGGGAAAGGG + Intergenic
986511652 5:8513565-8513587 CTGTCAGGGTGTTGGGCAAGGGG - Intergenic
987773815 5:22338433-22338455 CTGAGAGGGTGGTGGGAAACTGG + Intronic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988642768 5:33059640-33059662 CTGTCGGGGGTGGGGGATAAGGG + Intergenic
988699148 5:33655804-33655826 CTGTCGGGGTTCAGGGGAAAGGG - Intronic
991046032 5:62223799-62223821 TTGACGGGGGGGGGGGAAAAAGG - Intergenic
991063947 5:62406049-62406071 CTGTGGAGGTGGTAGGACAAGGG + Intronic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992362433 5:76054140-76054162 CTGTCAGGGGGGTGGGTAAAGGG - Intergenic
992922383 5:81539889-81539911 CTGTCGGGGTGGGGGGCTAAGGG - Intronic
993764068 5:91833579-91833601 CTGTCGGGGTGTGGGGGGAAAGG - Intergenic
994624803 5:102205234-102205256 CTGTCTGGAGGGTGGGAGAAGGG + Intergenic
995080233 5:108042406-108042428 ATGTAGGGGTGGGAGGAAAATGG - Intronic
995211560 5:109545363-109545385 CTGGCGAGGTTGTGGAAAAAAGG - Intergenic
997052108 5:130394833-130394855 CTGTCGGGGTGTGGGGTCAAGGG + Intergenic
997405041 5:133639123-133639145 CTGTCGGGGAGTGGGGAACAAGG - Intergenic
1000421694 5:161045337-161045359 CTGTCGGGGTAGGGGGCAAGGGG - Intergenic
1000474105 5:161683918-161683940 CTGTTGGGGATGTGGGGAAAGGG + Intronic
1001537555 5:172508756-172508778 CTGCCATGGTGGTGGGAAGAGGG + Intergenic
1001891149 5:175340017-175340039 CTGATGAGGTTGTGGGAAAAAGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002181470 5:177433175-177433197 CTGTCGAGGTAGTCGGCAAAAGG - Exonic
1002202275 5:177536584-177536606 CTGCCGGGGTGGTGGGCAGCAGG + Exonic
1002533049 5:179859916-179859938 CTGACAGGGTGCTGGGAGAACGG + Intronic
1003109499 6:3241736-3241758 CTGTTGGGGTGGGGGGCAAGGGG - Intronic
1005034475 6:21543071-21543093 CTGTCGGGGGGTGGGGAACAAGG - Intergenic
1006826561 6:36940212-36940234 TGGTCAGGGTGGTGGGAACAGGG + Intergenic
1007126877 6:39432966-39432988 GTGTGGGGGTGGTGGGTGAAAGG + Intronic
1007859336 6:44890974-44890996 CTGTCGGGGTTGGGGGACTAGGG + Intronic
1009376551 6:62978201-62978223 CTGTCGGGGTGGAGGGCAAGGGG - Intergenic
1009524964 6:64732155-64732177 CTGTCGGGGTTGGGGGGCAAGGG + Intronic
1010823367 6:80443135-80443157 CTCTTGAGGAGGTGGGAAAAGGG - Intergenic
1012428645 6:99141976-99141998 CAGACGGGGTGGTGGGGCAAAGG - Intergenic
1012667969 6:102001353-102001375 CTGTCGGGGGGTGGGGAACAAGG - Intronic
1012982908 6:105848785-105848807 TTGTCTGGGTGGTGGGATTATGG - Intergenic
1015601110 6:134911630-134911652 CTGTCTGGGTGGTGGTCAGAGGG - Intergenic
1017577225 6:155818408-155818430 CTGTTGAGGTGGTGGGATACTGG + Intergenic
1017903050 6:158734673-158734695 ATGTCGGGGTGGTGAGGACATGG - Intronic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1019409674 7:901030-901052 GTCTTGGGGTGGTGGGAGAAGGG + Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020465590 7:8475061-8475083 CTGACTGGGGGGTGGGAAGAGGG + Intronic
1020607976 7:10361459-10361481 CTGTAGGGGTTGTGGGGTAAGGG + Intergenic
1020757893 7:12226604-12226626 CTGTGGTGGTGGTTGGAAAGAGG + Intronic
1022483734 7:30761295-30761317 CTGTGGGGGAGGTGGGGAAGAGG + Intronic
1023792339 7:43762949-43762971 TTGTCGTGCTGGGGGGAAAACGG + Intronic
1024009787 7:45257818-45257840 CTGTCGGGGTTGGGGGACAAGGG + Intergenic
1024949219 7:54840794-54840816 CTCTCTGGGTGGTGGGGACATGG - Intergenic
1025248843 7:57338158-57338180 CTATAGGGGTGGCGGGAGAAGGG + Intergenic
1026125272 7:67573989-67574011 CAGTCGGGGGGGTGGGAGCAAGG + Intergenic
1026505462 7:70979156-70979178 CAGGCAGGGTGGTGGGAAAGTGG + Intergenic
1027476053 7:78632752-78632774 ATGACGAGGTTGTGGGAAAAGGG + Intronic
1028028128 7:85872437-85872459 TTGTCGGGGGTATGGGAAAAAGG + Intergenic
1028616639 7:92776057-92776079 CTGTCGGGGTGGGGGGGTTAGGG - Intronic
1028742126 7:94287240-94287262 ATGCCAGGATGGTGGGAAAATGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029373125 7:100161961-100161983 CTGTCGGGGTGGGGAGCAAGGGG + Intronic
1029489289 7:100861595-100861617 CTGGTGGGGCGGTGGGGAAATGG + Intronic
1029503651 7:100949434-100949456 CTGTCCGGGTGCAGGGAGAAGGG + Intergenic
1030301164 7:107976353-107976375 CTGGTGTGGTGGTGGGAATATGG - Intronic
1031636503 7:124107624-124107646 ATATCGGGGTGGGGGGCAAAAGG + Intergenic
1032987654 7:137356655-137356677 CTGTCCAGGTGGTGGGAGGAGGG - Intergenic
1033263538 7:139865233-139865255 CTGAAGGGTTGGTGGGGAAATGG - Intronic
1033543047 7:142374865-142374887 CTGTCGGGGGGTTGGGGGAAGGG + Intergenic
1033996237 7:147353294-147353316 CTGTCGGGGAGTAGGGGAAAGGG - Intronic
1033998497 7:147383614-147383636 CTGTCGGGGTGGGGAGCAAGGGG + Intronic
1034636571 7:152571951-152571973 GTCTCAGGGTGGGGGGAAAAAGG + Intergenic
1034791846 7:153977703-153977725 CTGTCGGGGGTGGGGGACAAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035554979 8:560684-560706 CTGTTGGGGTGATGGGGGAAAGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037831852 8:22194449-22194471 CTGCGGGGGTGATGTGAAAAAGG + Exonic
1038699180 8:29834231-29834253 CTGTTGAGGGGGTGGGAAGAGGG - Intergenic
1038942000 8:32315232-32315254 CTGTCAGGGGGGTGGGCAGAGGG - Intronic
1039433002 8:37540284-37540306 CTGACTGGGTTATGGGAAAACGG + Intergenic
1040392846 8:46964196-46964218 GGGTTGGGGTGGTGGGGAAAGGG + Intergenic
1040544358 8:48385806-48385828 CTGTCGGGGTGGAGGGCTAGGGG - Intergenic
1041273971 8:56138553-56138575 CTGTCGCGGTGCAGAGAAAAAGG - Intergenic
1041729620 8:61051387-61051409 GTGTAGGGGAGTTGGGAAAATGG + Intergenic
1043144651 8:76637820-76637842 CTGTCGCGGGGGTGGGGAGATGG + Intergenic
1043486642 8:80704592-80704614 CTCTGGGGGTGGTGGGGGAAAGG + Intronic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044428737 8:92084093-92084115 CTGTCGGGGTGGGGGGCTAAGGG + Intronic
1044893906 8:96867601-96867623 TTGTCTGGGTGGTGGGATCATGG - Intronic
1046971904 8:120232414-120232436 CTGTTGGGGTTGTGGGGCAAGGG - Intronic
1047736904 8:127773741-127773763 CTGTCGGGGGTGGGGGACAAGGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049586786 8:143436078-143436100 CTGCTGGGGTGGTCGGAACAGGG - Intergenic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1052330689 9:27264867-27264889 CTGTCGGGGTGGGAGGCAAGGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052380720 9:27767856-27767878 CTGTCGGGGTTGGGGGAAAGGGG + Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053850565 9:42286403-42286425 CTGTCGTGGTTGGGGGAAAGGGG + Intergenic
1053915096 9:42939883-42939905 CGGTTGGGGTGGAAGGAAAAGGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1056503033 9:87229352-87229374 CTCTCAGGCTGGTGGGAAAGCGG + Intergenic
1056506969 9:87266663-87266685 CTGTTGTGGTGGTGTGAAAACGG + Intergenic
1056561984 9:87738550-87738572 CTGTCAGGGGGGTGGGAGGAGGG + Intergenic
1057122112 9:92585980-92586002 ATGAGGGGGTGGTGGGACAAAGG - Intronic
1057273606 9:93664563-93664585 CTTTCTGGGTGGTGGAGAAAGGG + Intronic
1057308564 9:93926956-93926978 CTGTCGGGGTTGGGGGGCAAGGG - Intergenic
1057918404 9:99075408-99075430 CATTCGGGGTCGTGGGACAACGG - Intergenic
1058726388 9:107808599-107808621 CTGTCGGGGAGTTGGGGGAAAGG + Intergenic
1059783229 9:117551853-117551875 CTTTGGGGGTGATGGGTAAAGGG + Intergenic
1061484396 9:130912966-130912988 GGGTCGGGGTGCTGGGAAACCGG + Intronic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1186238186 X:7536422-7536444 CTGGCGAGGATGTGGGAAAAAGG - Intergenic
1186981913 X:14966132-14966154 CTGTCGGGGTGGGGGGCGAGGGG - Intergenic
1187559301 X:20385852-20385874 CTGTCGGGGGGTGGGGGAAAAGG + Intergenic
1187622067 X:21067769-21067791 CTGTCGGGGTGGGGGGCTAGCGG - Intergenic
1188329249 X:28848158-28848180 CTGTCGGGGATGGGGGGAAAGGG + Intronic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188413577 X:29904519-29904541 CTGTCGGGGTTGGGGGCAAAGGG - Intronic
1188892655 X:35629717-35629739 CTGTTAGGGAGGTGGGAGAAGGG + Intergenic
1189376019 X:40466879-40466901 CTGCCGGGGAGGTGGGAGCAAGG + Intergenic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191810312 X:65179251-65179273 CTGTCGGGGTGTTGGGGGTAAGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192963699 X:76155447-76155469 CTGTCGGGGGTGGGGGACAAGGG + Intergenic
1193427473 X:81356867-81356889 CTGGTGAGGTGTTGGGAAAATGG - Intergenic
1193484483 X:82069869-82069891 CTGGCAAGGTTGTGGGAAAAAGG - Intergenic
1193523906 X:82565663-82565685 CTGTCGGGGTGGAGGGCTACGGG - Intergenic
1193569890 X:83128676-83128698 CTGTCGTGGCAGTGGCAAAAGGG - Intergenic
1194765515 X:97843240-97843262 CTGCCGGGGAGGTGGGATCAAGG - Intergenic
1194997582 X:100608297-100608319 ATGTAGGGCTGGTTGGAAAAAGG + Intergenic
1196127580 X:112115633-112115655 CTGTCGGGGGGGTGGGGGCAGGG - Intergenic
1196517848 X:116634053-116634075 CTGTCGGGGTGGGGGGCAAGGGG + Intergenic
1196928721 X:120660155-120660177 TTGTTGGGGAGATGGGAAAAAGG + Intergenic
1196983895 X:121246637-121246659 TTGTCAGGGTGGTGGAAAAAGGG + Intergenic
1197566920 X:128099581-128099603 CTGTCAGGGGGCTGGGGAAAGGG - Intergenic
1198684719 X:139215709-139215731 CTGTCGGTGGTGTGGGGAAAGGG - Intronic
1199031250 X:143003170-143003192 CTGTCGGGGTTGGGGGTATAGGG + Intergenic
1199216984 X:145271158-145271180 CTGTCAAGGTTGTGGGGAAAAGG + Intergenic
1200234140 X:154460081-154460103 TTGGCGGGGTGGTGGGTGAATGG + Intronic
1200760644 Y:7035792-7035814 CTGTTGGGGTGGGGGGATAGGGG + Intronic
1200980496 Y:9259412-9259434 CTGGCCTGGTGTTGGGAAAATGG - Intergenic
1202130267 Y:21602898-21602920 CTGACCTGGTGTTGGGAAAATGG + Intergenic
1202148955 Y:21827652-21827674 CTGGCCTGGTGCTGGGAAAATGG - Intergenic