ID: 964411110

View in Genome Browser
Species Human (GRCh38)
Location 3:156398821-156398843
Sequence GAGACAACCCACTATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964411110_964411116 8 Left 964411110 3:156398821-156398843 CCCACACCATAGTGGGTTGTCTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 964411116 3:156398852-156398874 TATCCATCCTATTTTGGAGATGG 0: 1
1: 0
2: 1
3: 24
4: 189
964411110_964411115 2 Left 964411110 3:156398821-156398843 CCCACACCATAGTGGGTTGTCTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 964411115 3:156398846-156398868 GGAGCATATCCATCCTATTTTGG 0: 1
1: 0
2: 1
3: 3
4: 68
964411110_964411119 27 Left 964411110 3:156398821-156398843 CCCACACCATAGTGGGTTGTCTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 964411119 3:156398871-156398893 ATGGTTGTCCCCTAGCACTGAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964411110 Original CRISPR GAGACAACCCACTATGGTGT GGG (reversed) Intronic
903573793 1:24325274-24325296 GAGACCACCTCCTTTGGTGTTGG + Intronic
906264922 1:44421496-44421518 GAGACAATCCATCATGCTGTGGG - Intronic
908814728 1:68020200-68020222 GAGAGAAACCATTATGGTGATGG - Intergenic
909356192 1:74712669-74712691 AACACAACCCACTATGGGGTGGG + Intronic
916018537 1:160772836-160772858 GAGAAAACAGACAATGGTGTAGG + Intergenic
920392030 1:205612344-205612366 AAGACAACCAACTGGGGTGTGGG + Exonic
921033782 1:211357000-211357022 GAGACAAACCAACAAGGTGTAGG + Intronic
923934527 1:238746381-238746403 CCGACAGCCCACTAGGGTGTTGG + Intergenic
924041435 1:239988162-239988184 GAGAGAGCCCACTATGGATTTGG + Intergenic
1068474312 10:57506624-57506646 GAGCCCGCCCACTATGGAGTTGG + Intergenic
1070667547 10:78356157-78356179 CATTCAACCCACTATGGAGTGGG + Intergenic
1070726159 10:78792493-78792515 GTGACATTCCACAATGGTGTTGG - Intergenic
1071377105 10:85018076-85018098 GAGGCAACCCCCTATGGATTTGG - Intergenic
1082645391 11:55718183-55718205 GAAACAAACCAGTATGGTTTAGG + Intergenic
1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG + Intronic
1086186029 11:84017001-84017023 GAGCCAACCCAGTGTGGTATTGG + Intronic
1086345329 11:85890376-85890398 GAGACAGCTGACTAGGGTGTTGG + Intronic
1086384962 11:86297711-86297733 AAGATAACACACTATGGTATTGG - Intergenic
1090302160 11:125652037-125652059 GAAATAACCCACTATGTTCTGGG - Intronic
1090561763 11:127940091-127940113 GAGACGACCCAGTTTGGTGGAGG + Intergenic
1091693099 12:2610433-2610455 GAGACCACACACTGTGGGGTGGG - Intronic
1096536829 12:52280170-52280192 GGAACAACACACTATGGTGGAGG + Intronic
1099194547 12:79600062-79600084 CAAACAACCCACTTTGGTTTTGG + Intronic
1101858916 12:108466785-108466807 CAGTCAACCCTCTATGGTGGTGG - Intergenic
1106756966 13:32831249-32831271 GAGACAGGCCACTAGGGTGGGGG - Intergenic
1107887331 13:44884666-44884688 GAGTCCAGCCACTATGCTGTGGG - Intergenic
1108222670 13:48252737-48252759 TGGAAAACCCACTATGGAGTAGG - Intronic
1109935906 13:69283979-69284001 GAGACAACGCACTAGGATATTGG + Intergenic
1111580489 13:90216316-90216338 GATACAATCTACTATGGTGGAGG + Intergenic
1113330652 13:109323890-109323912 GAGACAACACATTATGGTACTGG + Intergenic
1113990221 14:16022877-16022899 GGGACAAGCGACGATGGTGTGGG + Intergenic
1116917870 14:50542784-50542806 GGGCCACCCCATTATGGTGTGGG - Intronic
1118970607 14:70634203-70634225 GAAACCAATCACTATGGTGTAGG + Intergenic
1122096659 14:99377378-99377400 GAGACAAGCCCCCATGGAGTGGG + Intergenic
1130331108 15:82923010-82923032 GAGAGAACCCAGTCTGGTGTTGG - Intronic
1138232498 16:55349068-55349090 GAGGCAGCCCAGTCTGGTGTTGG - Intergenic
1151120137 17:71783853-71783875 TAGACAACCCACTGTGGTTTTGG - Intergenic
1153986366 18:10354436-10354458 GAGAAAATGCTCTATGGTGTGGG - Intergenic
1154977241 18:21471423-21471445 GAGACAAGGTACTATGGGGTAGG - Intronic
1168703543 19:58455343-58455365 GAGAAAACCCACGGGGGTGTCGG + Exonic
1168706055 19:58470891-58470913 GAGAAAACCCACGGGGGTGTCGG + Exonic
932742152 2:74299657-74299679 GTGACATCTCACTATGGTTTTGG - Intronic
933390814 2:81664316-81664338 AAGACAACCCATTCTGATGTTGG + Intergenic
936737355 2:115462613-115462635 GAGACAACCTATTACGGTTTCGG - Intronic
946064368 2:216974178-216974200 AAGACAAGCCACTGGGGTGTGGG - Intergenic
1174587176 20:51618383-51618405 GAGACCACACACTGTGGGGTTGG - Intronic
1179461131 21:41536097-41536119 CAGACAACCCAGCATGGTGGTGG + Intergenic
1180317050 22:11284649-11284671 GGGACAAGCGACGATGGTGTGGG - Intergenic
1184561165 22:45263710-45263732 GAGCCACCCCACGAGGGTGTGGG + Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
964411110 3:156398821-156398843 GAGACAACCCACTATGGTGTGGG - Intronic
970517558 4:16848536-16848558 GAGACATCCAACAATGGAGTGGG + Intronic
973072277 4:45877786-45877808 GAGACCAGCCATTATGGTGAAGG + Intergenic
975361652 4:73477480-73477502 GAGACCACCCTCTATAGTTTAGG + Intergenic
978346374 4:107774278-107774300 GAAACAACCAAAGATGGTGTGGG - Intergenic
983676210 4:170296381-170296403 AAGACAACCCCATATAGTGTTGG + Intergenic
985445012 4:190017122-190017144 GGGACAAGCGACAATGGTGTGGG + Intergenic
985445380 4:190018748-190018770 GGGACAAGCGACAATGGTGTGGG + Intergenic
997855163 5:137366591-137366613 CACCCCACCCACTATGGTGTAGG + Intronic
1001259960 5:170219990-170220012 GAGACAATTTACCATGGTGTGGG + Intergenic
1003501724 6:6708667-6708689 GAGAGAAGCCAGAATGGTGTTGG + Intergenic
1005942675 6:30572340-30572362 GGGACAACCCAGTATGGTGAAGG + Intronic
1011808498 6:91100628-91100650 GGAACAACCCACTAAGATGTAGG + Intergenic
1016181756 6:141155510-141155532 GAGACCATCCACTATGGAGTGGG - Intergenic
1021484586 7:21153664-21153686 GAGAGAAGCCAGAATGGTGTGGG + Intergenic
1023381637 7:39614084-39614106 GAGAATACCCACAATAGTGTAGG - Intergenic
1023681780 7:42694813-42694835 GAGATGGCCCACTATGGTGATGG - Intergenic
1024239562 7:47423878-47423900 GAGACAGCCCCCTATGCTGCTGG - Intronic
1030110637 7:106023639-106023661 TAGAGAACCCACTATGGAGGTGG + Intronic
1034699505 7:153084015-153084037 GTGAGAACCCACTATGGAGAGGG + Intergenic
1040565779 8:48565501-48565523 TGGACAACCCACTAGGGTGTGGG - Intergenic
1043504597 8:80889835-80889857 TAGACATCCAACTATTGTGTTGG - Intergenic
1055666187 9:78555382-78555404 GAGACAATCCAAACTGGTGTGGG + Intergenic
1058151557 9:101469145-101469167 TAGACAACCCACACTGGTATTGG - Intergenic
1058247959 9:102654282-102654304 GTGACAACCCACGCAGGTGTGGG + Intergenic
1058548838 9:106091521-106091543 GACACATCCCACAATGGTGTTGG - Intergenic
1060167839 9:121434253-121434275 GAGACAACACTCTGTGTTGTTGG + Intergenic
1060559939 9:124534525-124534547 GAGACAACCCACTCTGGACAGGG + Intronic
1188538765 X:31226276-31226298 AAGACAACACAGGATGGTGTTGG - Intronic
1191605373 X:63057055-63057077 GAGACAGACAACTGTGGTGTTGG + Intergenic
1194832266 X:98638218-98638240 GAGACAACTCAGTATGTTGGTGG + Intergenic
1198005782 X:132491085-132491107 GAGAAAACCCCCGATGGTTTTGG + Intergenic
1198404137 X:136295744-136295766 GAGCTGGCCCACTATGGTGTCGG + Intergenic
1199912926 X:152307518-152307540 GAGACCAGCCAATATGATGTAGG + Intronic
1200870133 Y:8088801-8088823 GAGACACCTCACTTTGGTGCTGG + Intergenic