ID: 964412477

View in Genome Browser
Species Human (GRCh38)
Location 3:156413172-156413194
Sequence AGGGTCTGAGTGGGGATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964412465_964412477 29 Left 964412465 3:156413120-156413142 CCCTTCCATTGGAACAGTGACTA 0: 1
1: 0
2: 1
3: 12
4: 111
Right 964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG 0: 1
1: 1
2: 5
3: 38
4: 327
964412466_964412477 28 Left 964412466 3:156413121-156413143 CCTTCCATTGGAACAGTGACTAC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG 0: 1
1: 1
2: 5
3: 38
4: 327
964412467_964412477 24 Left 964412467 3:156413125-156413147 CCATTGGAACAGTGACTACAGTT 0: 1
1: 0
2: 1
3: 10
4: 169
Right 964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG 0: 1
1: 1
2: 5
3: 38
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964412477 Original CRISPR AGGGTCTGAGTGGGGATAGA AGG Intronic
900387970 1:2419287-2419309 AGGGGCTGGCAGGGGATAGATGG - Intergenic
901651024 1:10743363-10743385 TGGGTCTGAGTGGGGGTACTTGG - Intronic
902106713 1:14043070-14043092 AAGGACTGGGTGGGGATTGAAGG - Intergenic
902690159 1:18106043-18106065 TGGGTCAGAGTGGGGAGGGAGGG + Intergenic
903545708 1:24122109-24122131 AGGGTCAGGGTGGGAAAAGAAGG + Intronic
903668177 1:25020769-25020791 AGGGCCACAGTGGGGCTAGAGGG - Intergenic
903807642 1:26016872-26016894 TGGGTCTGAGGAGGGACAGAAGG + Intergenic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905878858 1:41450619-41450641 AGGGTCTGAATGGGAGTATAAGG + Intergenic
906129979 1:43450278-43450300 AGGGCATGGGTGGGGATAGGAGG - Intronic
906533805 1:46540094-46540116 AGGGACTGAGAGGGAACAGAAGG - Intergenic
906946370 1:50297857-50297879 AGTGTCTGAGTGGGGAAGGCGGG - Intergenic
910980421 1:92955174-92955196 GGGGGCTCAGTGGGGACAGAAGG + Intronic
911598350 1:99822233-99822255 AGGATCTGTGTGGGGGTAGTGGG - Intergenic
911895798 1:103433466-103433488 GGGGTGAGGGTGGGGATAGAAGG - Intergenic
913113744 1:115678504-115678526 TGGGACAGAGTGGGGATAGATGG + Intronic
915253201 1:154605269-154605291 AGGGTCAGAGTTGTGATAGGTGG - Intronic
915836798 1:159183306-159183328 AGGATATGAGTGAAGATAGATGG - Intronic
915908881 1:159900027-159900049 GGGCTCTGAGTGGGGAAAGTGGG - Intronic
915913327 1:159927668-159927690 AGGGCCTGACTGGGAATAGATGG + Intronic
916374874 1:164142010-164142032 AGACTCTGAGTGGAGAAAGAAGG + Intergenic
918301984 1:183212957-183212979 GGGGTCTGAGTGAGAAGAGAAGG - Intronic
918356088 1:183707561-183707583 AGGGTTTGAATGGGGAAAGGGGG + Intronic
919977739 1:202623579-202623601 AGTGATTGAGTGGGGACAGATGG + Intronic
920230133 1:204464699-204464721 CTGGGCTGAGTGGGGACAGAGGG - Intronic
920558369 1:206920901-206920923 AAGGTCTGAATGAGGATACATGG + Intronic
920866527 1:209758216-209758238 AGGGTGGGAGTGGGCATAGGGGG - Intronic
920867038 1:209761793-209761815 CTGGTCTGAGTGGGGAGTGAGGG - Intronic
921776840 1:219111586-219111608 AGGATCTGAGAGTGGATAGAGGG + Intergenic
922002496 1:221494318-221494340 AGGGTAAGAGTGGGAAGAGATGG - Intergenic
1062794646 10:335411-335433 AGGGTCTGAGCTGGGACAGGAGG - Intronic
1063439374 10:6060030-6060052 AGGGTCTGAGTGGTCTTGGAGGG - Intronic
1064800253 10:19062720-19062742 AGGGTTTGAGTAGGGAGAAATGG + Intronic
1067748752 10:48956352-48956374 TGGGTCTGAGGGTGGAGAGATGG - Intronic
1069773733 10:70915075-70915097 AAAGTGTGAGTGGGGAGAGATGG + Intergenic
1069836212 10:71309980-71310002 AGGTTATGAGTGAGGATAGCTGG + Intergenic
1070741249 10:78904563-78904585 AGGGTCAGAGTGGGGCTGGGTGG - Intergenic
1070743644 10:78919381-78919403 AGGGAGTAAGTGGGGATGGAAGG + Intergenic
1072780073 10:98244286-98244308 AAGGACTGACTGGGTATAGAAGG + Exonic
1073105355 10:101029756-101029778 AGGGTCAGAGGAGGGAAAGAAGG - Intronic
1073115712 10:101090312-101090334 TGTGCTTGAGTGGGGATAGATGG + Exonic
1073318002 10:102596457-102596479 AGGGTCTCGATGGGGAGAGAAGG + Intronic
1073529639 10:104219314-104219336 AGGGTGGGAGTAGGGATGGAGGG - Intronic
1075345935 10:121681954-121681976 AGGGTCTAAGTGGGGAAATGTGG - Intergenic
1075560955 10:123468113-123468135 AGGGTCTGTCTGGGGGTTGAGGG - Intergenic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077993029 11:7428993-7429015 AGGGTCTGTGTTGGAATAGGTGG + Intronic
1078449770 11:11432058-11432080 AGGGTCTGGCTAGGGACAGATGG + Intronic
1078613157 11:12839897-12839919 AGGGTGAGAGTGGGAACAGATGG + Intronic
1078729691 11:13963557-13963579 AGGGACTGAGCGGGGAAAGCTGG - Intronic
1078937672 11:15965816-15965838 TGAGTCTGAGTGGGGACGGAAGG - Intergenic
1079417163 11:20249441-20249463 AGGTTCTGAGTGAGTATTGAGGG - Intergenic
1081464743 11:43306060-43306082 AGGGTCTGACATGGGACAGAAGG + Intergenic
1081772845 11:45660364-45660386 GAGGTCAGAGTGGGGATGGAAGG - Intronic
1083197904 11:61102128-61102150 GGGGTCTGGGTGGGGAGAGGCGG - Intergenic
1083491630 11:63018471-63018493 AGGGTGGGAGTGGGGAGAGAGGG - Intergenic
1084276309 11:68052760-68052782 AGGGGCTGAGTGGGTGCAGATGG + Intergenic
1085314670 11:75537280-75537302 AGAGTCACAGTGGGGCTAGAGGG + Intergenic
1086345067 11:85887589-85887611 AGGATTTGAGTGCGGACAGAGGG - Intronic
1089070577 11:115696561-115696583 AGGTTCTGTGATGGGATAGATGG - Intergenic
1089567220 11:119378190-119378212 AGGGTCAGAGTGCAGATGGAAGG - Intronic
1089626945 11:119757293-119757315 AGGGTCTGACAGGTGGTAGATGG - Intergenic
1091142209 11:133244909-133244931 AAGGTCTGAGGGGGGAGACATGG + Intronic
1091628580 12:2141152-2141174 AGGATGTGAGTGGGGTTGGAGGG + Intronic
1092749520 12:11705785-11705807 AGGGTTTGAGTGGGCAGACAGGG - Intronic
1092791112 12:12071725-12071747 AGGCTCTGATTGTGGAAAGAAGG - Intronic
1093661780 12:21765892-21765914 AGGGTCTGAATAAGGATGGAAGG + Exonic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1094059123 12:26294781-26294803 AAGGACTGAGTGGGGATAGGGGG - Intronic
1095653345 12:44639972-44639994 AGGCTTTGAGTTGGGATAAAAGG - Intronic
1096238998 12:49949485-49949507 AGGCTCAGAGTGGGGACAGAAGG - Intergenic
1096496011 12:52039897-52039919 AGGCCCTGAGTGGGGAGAGAAGG + Intronic
1096524896 12:52204624-52204646 AGGGTCTGAGCGGGGGAAAAAGG + Intergenic
1097688342 12:62711681-62711703 AGGGTCTGAGGGGGGAAGAAAGG + Intronic
1099338159 12:81391914-81391936 AGGGTGGGAGTGGATATAGATGG + Intronic
1100218483 12:92478479-92478501 AAGGTCTGAGTAGGAATAAATGG + Intergenic
1101602884 12:106225717-106225739 AGGGTCTCACTTGGGCTAGAGGG + Intergenic
1102717481 12:114986644-114986666 AGGACATGAGTGGGGAGAGAAGG - Intergenic
1103435901 12:120925138-120925160 AGGAACTGAGTGGGCATTGAAGG + Intergenic
1104538683 12:129642506-129642528 TAGGTCTGAGTGTGGATGGAAGG - Intronic
1105437622 13:20391335-20391357 GGGGTCTGGGTGGGGAAGGAAGG + Intergenic
1105623073 13:22087779-22087801 AGCTCCTGAGTGGGCATAGAAGG + Intergenic
1105759050 13:23496428-23496450 AGAGTCTGCGTGGTGGTAGAGGG + Intergenic
1105897074 13:24725578-24725600 AAGCTCTGAGAGGGGAAAGAAGG + Intergenic
1106448872 13:29861908-29861930 AGGGTCTGAGTGAGGTGTGAGGG - Intergenic
1106716474 13:32393922-32393944 AGGGTGTGAGTGGGGGAAAAAGG - Intronic
1106769245 13:32945593-32945615 AGGCTTGGGGTGGGGATAGATGG + Intergenic
1106923415 13:34588682-34588704 AGAGGCTGGTTGGGGATAGAGGG + Intergenic
1107434813 13:40372927-40372949 AAGGTTTGAGTGGGGATGGGAGG - Intergenic
1108131670 13:47308682-47308704 TGGGTCTGAGTGGGGTGAGGTGG - Intergenic
1108722880 13:53150009-53150031 AGGGTATGAGTACGGAGAGAAGG + Intergenic
1109048484 13:57444688-57444710 AGGATATGAAAGGGGATAGATGG + Intergenic
1110504610 13:76271207-76271229 AGGGCCTGTCTGGGGATGGAGGG - Intergenic
1112773888 13:102823425-102823447 AGGGTCAGTGTGAGGATAAAAGG + Intronic
1113701218 13:112390103-112390125 AGGGGCTGAGTGGGAAGAGAAGG + Intronic
1113827488 13:113268007-113268029 ATGGTCTGGGTGAGGACAGACGG + Intergenic
1114067634 14:19077985-19078007 AGGGCCTGTGTGAGGGTAGAGGG - Intergenic
1114094623 14:19322041-19322063 AGGGCCTGTGTGAGGGTAGAGGG + Intergenic
1114665758 14:24376405-24376427 AGGGTCTTCATGGGGATAGGAGG - Exonic
1117270573 14:54139289-54139311 TGGGACTGAGTAGGGAGAGAGGG - Intergenic
1117428348 14:55624640-55624662 AGGATGTGAGAGGTGATAGAAGG + Intronic
1117732842 14:58741080-58741102 ATGGGCTGAGGTGGGATAGAAGG - Intergenic
1118103479 14:62631482-62631504 GGGGTCTGAGAGTGGAAAGAAGG - Intergenic
1119711639 14:76826748-76826770 CGGGCCTGAGTGGTGAGAGATGG - Intronic
1121198404 14:92096166-92096188 AGGGTGGGGGTGGGGAAAGAAGG + Intronic
1121406231 14:93720848-93720870 AGGGTGTCAGTGGGGATAGGAGG + Exonic
1121935916 14:98018451-98018473 AGGGTGTGAGTTGGGGTAGTGGG + Intergenic
1122790599 14:104182704-104182726 GGGGTCTGAGTGGGGTTGGGTGG + Intergenic
1202892108 14_KI270722v1_random:168376-168398 AGGGTCTCAGTGAGGTTGGAGGG - Intergenic
1124493385 15:30171943-30171965 AGTGATTGAGTGGGGACAGATGG + Intergenic
1124750149 15:32366382-32366404 AGTGATTGAGTGGGGACAGATGG - Intergenic
1125962746 15:43845978-43846000 AAGATGTGAGTGGGGATAGGAGG + Intronic
1126101734 15:45122012-45122034 AGGGTAAGAGTGGGGAGATAAGG + Intronic
1128662824 15:69514696-69514718 AGGGACTGAGAGGGAAGAGATGG - Intergenic
1130550851 15:84889155-84889177 AGAGACTGAATGGGGGTAGAAGG - Intronic
1130669568 15:85899611-85899633 AGGGGCTGAGTGGTGGGAGAGGG + Intergenic
1131531785 15:93199979-93200001 AGGGTAAGAGTGAGCATAGAAGG - Intergenic
1132235358 15:100216022-100216044 AGAGTCTGAGCGGGGTGAGAAGG + Intronic
1133761482 16:8802215-8802237 CCGGTCTGACTGGGGCTAGAAGG - Intronic
1134901171 16:17939376-17939398 AGGCTCTGAGTTTGAATAGAGGG - Intergenic
1135063765 16:19292075-19292097 AGGGGCTGAGTGGAGTGAGAAGG - Intronic
1135403306 16:22181058-22181080 AGGGGCTGAGGGTGGACAGAGGG + Intronic
1135718741 16:24795905-24795927 AGGGTCTGAGTGGCAAAAAAAGG + Exonic
1136366754 16:29812492-29812514 AGGGGCTGACAGGGGATCGAAGG + Intronic
1136561124 16:31039867-31039889 AGGGTCTGAGGGAGGAGGGAGGG - Intronic
1137613165 16:49832554-49832576 AGGTCCTGAGTGGGGCAAGAGGG + Intronic
1138812987 16:60172302-60172324 AGTGTCAGAGAGGGGATATATGG + Intergenic
1139593243 16:67944553-67944575 AGGGGCCGAGTGGGGTTTGAAGG - Exonic
1141139467 16:81487722-81487744 AGGGTCTGTGTGAGGATTAAAGG + Intronic
1142854832 17:2723879-2723901 AGGGTCAGGGTGGGGGTAGAAGG + Intergenic
1144497626 17:15758466-15758488 AGGGACTGAGGGAGGAAAGAAGG + Intergenic
1144629422 17:16862949-16862971 AGGGACTGAGGGAGGAAAGAAGG + Intergenic
1144652005 17:17013167-17013189 AGGGACTGAGGGAGGAAAGAAGG - Intergenic
1144732406 17:17536391-17536413 GGGGTCTGAGTGAGGGGAGATGG - Intronic
1144837354 17:18163667-18163689 GGGGCCTGAGTGGGGCCAGAAGG + Intronic
1145013971 17:19385052-19385074 AGGGGCTGTGAGGGGAAAGAAGG - Intronic
1145044839 17:19605511-19605533 AGCGCATGAGTGGGGATAGTGGG + Intergenic
1145160995 17:20573515-20573537 AGGGACTGAGGGAGGAAAGAAGG + Intergenic
1145943694 17:28758112-28758134 GGGATCTAAGTGGGGACAGAAGG - Exonic
1146679404 17:34796248-34796270 AGGGCCAGTGTGAGGATAGATGG - Intergenic
1147359460 17:39921938-39921960 AGGGTCAGGTTGGGGAAAGATGG - Intronic
1147542078 17:41368767-41368789 AATGTCTGAGTGGGGTTTGAAGG - Intronic
1147567705 17:41547855-41547877 TGGGTCTGTGTGGGGAGAGACGG - Intergenic
1149328309 17:55555766-55555788 AGGGACCGAGTGGGGAGAGAGGG - Intergenic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1150271249 17:63866820-63866842 AGGGTGTCAGTGTGGACAGATGG + Intergenic
1151701055 17:75742763-75742785 TGGGTCTGGGTGGGGAGAGTGGG + Intronic
1151955629 17:77378833-77378855 AGGGTGGGGGTGGGGGTAGATGG - Intronic
1153897622 18:9580947-9580969 AGGGGCTTAGTGGGTATGGAAGG - Intronic
1153985775 18:10349981-10350003 AGGCTCTGAGTGGGGTTTGGTGG - Intergenic
1154109079 18:11550559-11550581 ATGGTCTCAGTGGAGATAGGGGG - Intergenic
1154301456 18:13196298-13196320 AGGGGCTGGGTGAGGATAAAAGG - Intergenic
1154472827 18:14721653-14721675 ATGGTGGGAGTGGGGACAGATGG + Intergenic
1155117834 18:22787082-22787104 TGGTTCTGACTGGGGATACAGGG - Intergenic
1157248385 18:46072587-46072609 AGGCTCTGCGGGGTGATAGACGG + Intergenic
1158041130 18:53095614-53095636 AGGGTCTGAATCAGGATAGGAGG - Intronic
1158333758 18:56392028-56392050 AGGGACTGAGTTGAGAAAGAAGG - Intergenic
1159070163 18:63613950-63613972 AGGGTCTGTGTGGGGAGACCAGG - Intergenic
1159646556 18:70925055-70925077 TGGGTAGGAGTGGGGAGAGAGGG - Intergenic
1160767297 19:814210-814232 AGGGTCTGAGGGGGGAGGCATGG - Intronic
1161231465 19:3176981-3177003 GGGGTCTGAGTGGGGAGGCATGG - Intronic
1161703507 19:5807011-5807033 AAGCTCAGAGTGGGGATGGAGGG + Intergenic
1162310891 19:9906696-9906718 AGGACCAGAGTGGGGACAGATGG + Intronic
1162523575 19:11195259-11195281 AGGGGCGCAGTAGGGATAGAGGG + Intronic
1163090975 19:15020443-15020465 AGGGTCTGGGTGGGGAGGGGAGG - Exonic
1163350535 19:16774026-16774048 AGGGTGGGAGTGTAGATAGATGG - Intronic
1163526561 19:17824912-17824934 AGGGCCAGAGTGGGGCTGGAGGG + Exonic
1163586713 19:18168375-18168397 AGGGTCTGGCTGAGGAGAGAGGG - Intronic
1163722227 19:18903715-18903737 AGGGTCTGAGTGGGGACCACTGG + Intronic
1163887729 19:19982858-19982880 AGGGTCTGCTTGAGAATAGAGGG + Intergenic
1165490602 19:36120949-36120971 AGGCTGGGAGTGGGGACAGACGG + Intronic
1166090572 19:40506120-40506142 AGGGTCAGAGTCGGGAGTGATGG + Intronic
1166106214 19:40599384-40599406 AGGGACTAAGTGGGGAAGGAGGG - Intronic
1166276192 19:41755777-41755799 AGGCTCTGAGAGGAGACAGAGGG + Intronic
1166423260 19:42654341-42654363 GGGCTCTGAGAGGGGACAGAGGG + Intronic
1166695875 19:44851239-44851261 TGGGTCTGAGAGGGGAAGGATGG - Intronic
1168517034 19:57017425-57017447 AGGGGCTGAGAGGGGAGGGAAGG - Intergenic
1168609308 19:57786543-57786565 AGGGTCTGTGTGGGGATGGCGGG - Intronic
1168724280 19:58572304-58572326 TGGGGCTGAGTAGGGAGAGAGGG - Intronic
925128854 2:1480535-1480557 GGGGTTTGAGGGGTGATAGAGGG - Intronic
925146815 2:1587713-1587735 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146856 2:1587848-1587870 AGGGACAGAGCGGGGAGAGAGGG - Intergenic
925146876 2:1587922-1587944 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146898 2:1587982-1588004 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925146911 2:1588020-1588042 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925815708 2:7746281-7746303 GGAGTCTGAGTGGGAATAGACGG - Intergenic
925853676 2:8108748-8108770 AGGGTCTGGGAGTGGAGAGATGG - Intergenic
926243359 2:11104706-11104728 AGGGTCTGTGAAGGGAGAGAAGG - Intergenic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
927632152 2:24783914-24783936 AAGGTGTTAGTGTGGATAGATGG - Intergenic
928006435 2:27566397-27566419 AGTTTCTGGGTGGGGATTGAAGG + Intronic
928061732 2:28120466-28120488 AGGGTCTGAGTCAGCATACATGG + Intronic
928105156 2:28465824-28465846 GGGGACTGAGTGGGGAAAGATGG - Intronic
929272562 2:39988629-39988651 AGGATCAGAGTGGTGAGAGAGGG - Intergenic
929869093 2:45743098-45743120 AGGGGCTGGGTGGGGAGTGAGGG + Intronic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
932057707 2:68462826-68462848 AGGGTGGAAGTGGGGCTAGAAGG + Exonic
932430324 2:71670304-71670326 GGGGTCTGAGTGGGTAGAGTAGG + Intronic
934734833 2:96684844-96684866 GGGGGCTGGGTGGGGGTAGAAGG + Intergenic
935694528 2:105760197-105760219 AGATTTTCAGTGGGGATAGAAGG + Intronic
935743331 2:106170101-106170123 GAGGTCTGAGTGGGGAAGGAAGG - Intronic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
936349750 2:111703740-111703762 AGGGCCTGAGTGAGGATGGCTGG - Intergenic
937032135 2:118749805-118749827 AGGGTGTGAGAGCTGATAGAGGG - Intergenic
937092913 2:119218358-119218380 AGGGTCTCAGTGGGGATTGAAGG + Intergenic
937469455 2:122162801-122162823 GGGATCTGAGTGGGGGTAGCTGG + Intergenic
937577807 2:123445294-123445316 CGGTTCAGAGTGGGGAAAGAAGG + Intergenic
941615212 2:167711033-167711055 TGAGTTTGAGTGGGGAGAGAGGG - Intergenic
941696353 2:168556426-168556448 ATTGTCTAAGTGGGGATAGGTGG + Intronic
945274083 2:207970623-207970645 AGGGTCTGAGTGGGAATCAAAGG - Intronic
945276133 2:207989494-207989516 AGGCTGTAATTGGGGATAGATGG - Intronic
945417875 2:209597788-209597810 AGGGTGGGAGTGGGGAGAGATGG - Intronic
945680065 2:212903178-212903200 AGGGTATGAGTAGGGATATGAGG - Intergenic
945992188 2:216405482-216405504 AAGGGCAGAGTGGGGATAGGAGG - Intergenic
946146899 2:217738055-217738077 AGGGTGGGAGTGGGAATGGAGGG - Intronic
947166998 2:227272947-227272969 AGGCTCTGAGTGGTGAGAAAGGG + Exonic
947812960 2:233015673-233015695 AGGGACAGAGAGGGGAAAGAGGG - Intronic
1172654267 20:36527446-36527468 AAGGTCAGAGCGGGGATAGCTGG - Exonic
1172940092 20:38648327-38648349 AGGGAATGAGTGGTGACAGATGG - Intronic
1172945540 20:38685426-38685448 AGGCACTGAGTGGGAAGAGAGGG + Intergenic
1173086558 20:39925004-39925026 AAGGTCTGGGTGGGGGTGGAAGG - Intergenic
1174363805 20:50044233-50044255 ATGGCCTGAGTGGGGAGATAGGG + Intergenic
1175276645 20:57775169-57775191 AGGGCCTGGGTTGGGACAGAGGG + Intergenic
1175764493 20:61583122-61583144 AGGCTCTGCGGGGGGACAGAGGG + Intronic
1176108226 20:63399398-63399420 AGGGTCTGAGAAGGGCTAGAGGG - Intergenic
1177674375 21:24277315-24277337 AGGGAGGGAGTGGGGAGAGAGGG - Intergenic
1177727553 21:24989159-24989181 AGGGTTGGAGTGGGGAGAGCTGG + Intergenic
1179049701 21:37878739-37878761 TGGGGCTGGGTGGGGAAAGAGGG + Intronic
1180021345 21:45129679-45129701 AGGGCGTGAGTGTGGACAGATGG + Intronic
1180179766 21:46112720-46112742 CGAGTCTGGGTGGGGATGGAGGG - Intronic
1180486109 22:15800555-15800577 AGGGCCTGTGTGAGGGTAGAGGG - Intergenic
1181967433 22:26666871-26666893 GGGGTCTGTGTGGGGAAGGAAGG + Intergenic
1182560453 22:31155020-31155042 AGGGTCTGTGAAGGGATGGAAGG - Intergenic
1183411153 22:37655631-37655653 CGGGGCTGAGGGGGGATAGCTGG - Exonic
1183494987 22:38138065-38138087 ATGGCCTGTGTGGGGACAGAGGG + Intronic
1183689737 22:39381954-39381976 AGGGGCTGGGTGTGGAGAGAGGG - Exonic
950568898 3:13787954-13787976 AGGGCCGGAGTTGGGATAGGCGG + Intergenic
950624181 3:14232290-14232312 AGGGTTTGAGAGGGAAGAGAAGG - Intergenic
950756565 3:15178247-15178269 AGGCTCTGAGTCTGGAGAGATGG - Intergenic
952853179 3:37745631-37745653 AGGGTATGAGTGTTGAAAGAAGG + Intronic
953020230 3:39108320-39108342 AGGCTCTCAGGGGGGAGAGATGG - Exonic
954137440 3:48588505-48588527 AGGGTCTGAGAGGAGGGAGAGGG - Intronic
954714575 3:52520709-52520731 AGGGGCTGAGTGGGGGTGGTGGG + Intronic
955005615 3:54965850-54965872 GGGGTGTGAGTGAGGAGAGAGGG + Intronic
955628409 3:60945962-60945984 TGGGCCTGAGTGTGGATGGATGG - Intronic
955992503 3:64642935-64642957 AAGGTCTCAGTGGGAATAGCAGG + Intronic
959148201 3:102575088-102575110 AGGGTCTGTCGGGGGGTAGAGGG + Intergenic
959354944 3:105314320-105314342 AGGGGCTAAGTGTGGAGAGAGGG + Intergenic
959667770 3:108940947-108940969 AGGGTCAGAGTGGGGACAGGAGG + Intronic
961574262 3:127822432-127822454 AGGGTCTGGGTGCGGGAAGAGGG - Exonic
961615116 3:128173139-128173161 AGGGTCTGGGTAGGAAAAGAAGG + Intronic
962173271 3:133125394-133125416 AGGGTCTGAGTGGAAATAAGTGG + Intronic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
963736098 3:149019417-149019439 AGGGGGTGAGTGGGGAGAGATGG - Intronic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
965845767 3:172959439-172959461 TGGTTCTCAGTGGGGAGAGAGGG - Intronic
967945749 3:194802397-194802419 AGGATCTGGGTGAGGATGGAGGG - Intergenic
968532020 4:1097112-1097134 AGGGTCTTAGTGAGGGCAGAAGG + Intronic
968610545 4:1554912-1554934 AGGGTCAGAGTGGGGAGTGGGGG - Intergenic
969049656 4:4363641-4363663 AGGGGCTGGGAGGGGACAGAGGG + Intronic
970486574 4:16530707-16530729 AGAGTCTCTGTGAGGATAGATGG - Intronic
971221621 4:24712779-24712801 AGGGTATGAGTGGGGCTGCAGGG + Intergenic
971708384 4:30078529-30078551 AGGCACTGAGAGTGGATAGAGGG - Intergenic
977515422 4:98016046-98016068 AGGGCCTGTGTGGGGGTGGAAGG + Intronic
978425900 4:108581986-108582008 AGGTGCTCAGTGGGGATTGACGG + Intergenic
978650769 4:111002074-111002096 AAGGTCTAAGAGGGGATGGAAGG - Intergenic
981919259 4:150068583-150068605 AGGGTCTGAGTGGGATGTGAGGG + Intergenic
983560206 4:169093493-169093515 AGGGTCTGATTGGTTTTAGAAGG - Intergenic
983989135 4:174097016-174097038 AGGCCCTGAATGGGGATACAGGG + Intergenic
985047813 4:185957997-185958019 AGGAGTTGAGTGGGGAAAGAAGG - Intergenic
985264291 4:188143917-188143939 CAGTTCTGAGTGGGGATAGGAGG + Intronic
988401295 5:30763667-30763689 TGGGTGTGAGTGAGGAGAGATGG + Intergenic
991327140 5:65446797-65446819 AGGGTAGGAGTGGGGACTGAGGG + Intronic
992589913 5:78283960-78283982 AGGGACTGACTGGTGAAAGATGG - Intronic
993294951 5:86125269-86125291 AGGCTATGACTGGGGAGAGATGG - Intergenic
997211361 5:132078896-132078918 AGGGGCTGTGTGGTGATGGAAGG - Intergenic
997429653 5:133828918-133828940 AGGATCTGAGTGGGGCTAAGAGG + Intergenic
997850702 5:137330182-137330204 AGGTACTGAGTGGAGATACAGGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998888155 5:146716844-146716866 ATGGTCTGAATGTTGATAGATGG + Intronic
1000108310 5:158082187-158082209 AGAGTCTGAGTGGGCATAGTTGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1001127903 5:169037076-169037098 GGGGGCTGAGTGGAGAGAGAGGG - Intronic
1002440237 5:179260545-179260567 AGGCTCTGAGCGGGGACAGGAGG + Intronic
1002463230 5:179387323-179387345 AGGGGCTGTGTGGGGAGGGAAGG - Intergenic
1002974561 6:2061257-2061279 AGGGTGTGAGTGAGGATGGTGGG - Intronic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1005979336 6:30824424-30824446 AGGGACTGAGTGGGGACAGATGG + Intergenic
1006141147 6:31930714-31930736 AGGGCATGAGTGGGGATCCATGG - Intronic
1006300423 6:33191064-33191086 AGGGGCTGAGTGGGTAGAGATGG - Intronic
1006740428 6:36304133-36304155 ATGGTCTGGGTGGAGACAGAGGG + Intronic
1007382464 6:41499601-41499623 GGGGTCTGTGTTGGGGTAGAAGG - Intergenic
1007397307 6:41585259-41585281 AGGGTCTGGGTGCGGAGGGAGGG - Intronic
1008209401 6:48702368-48702390 GGGGTCTTAGTGGGGATGGAGGG + Intergenic
1008615224 6:53219799-53219821 TGGGGTGGAGTGGGGATAGAGGG + Intergenic
1011000791 6:82586036-82586058 ATGGTCTGAGTGGGAAAGGATGG - Intergenic
1011055449 6:83199123-83199145 AGGTTCTGAGAGGGGATGGATGG - Intergenic
1017382501 6:153846662-153846684 CCTGTCTGAGTGGGGATATATGG - Intergenic
1019510676 7:1415912-1415934 AGTGGATGAATGGGGATAGATGG + Intergenic
1019517964 7:1447947-1447969 GGGCTCTGAGTGGGGAGGGAAGG - Intronic
1021231044 7:18086716-18086738 CGGGGCTGGGTGGGGATAGGAGG - Intergenic
1021845642 7:24759757-24759779 ATGGTCTGTGTTGGGAGAGAGGG + Intergenic
1022399444 7:30023486-30023508 AGGGTCTGAGTGGGGATTTAGGG - Intronic
1022642860 7:32204715-32204737 AGGGTCTGAATGGGGATAATAGG - Intronic
1024047680 7:45596339-45596361 AGGTTCTGAGAGGGGATATGGGG + Intronic
1024391412 7:48816940-48816962 GAGGTCGGAGTGGGGACAGAGGG + Intergenic
1025591721 7:62868793-62868815 AGGGTCTGAGAAGGGATATTTGG + Intergenic
1027678225 7:81186028-81186050 AGGGACTAAGTTGGGATTGATGG + Intronic
1029420261 7:100468319-100468341 TGGGTCTGAGCGGGGAGTGAAGG + Intronic
1029708041 7:102285906-102285928 GGGGTCTGAGAGGGGAGGGAGGG - Intronic
1030183484 7:106735751-106735773 AAGGGCTGAGTGGGGGTAGTGGG - Intergenic
1031214602 7:118873958-118873980 TGGATTTGAGTGGGGCTAGAGGG - Intergenic
1032388051 7:131538192-131538214 AGGGTCTGCCTGGGGGTAGGGGG - Intronic
1032804217 7:135339418-135339440 AGGGCCTGAGTGGGGAGGCAGGG - Intergenic
1033685764 7:143640054-143640076 AGGGGCAGAGTGGGGAGATAGGG - Intronic
1033689979 7:143727261-143727283 AGGGGCAGAGTGGGGAGATAGGG + Intronic
1033698850 7:143817567-143817589 AGGGGCAGAGTGGGGAGATAGGG + Intergenic
1034962862 7:155373353-155373375 AGGGACTGTGTGGGGGAAGAAGG - Intergenic
1035272339 7:157727925-157727947 AGGCTCTGAGTGTGGAAGGATGG - Intronic
1035736428 8:1890502-1890524 AGATTCTGAGTGGGGCGAGACGG + Intronic
1036405325 8:8449865-8449887 AGGAACAGAGTGGGGCTAGAAGG + Intergenic
1036621743 8:10428549-10428571 GGGGTCTGAGTGAAGATAGCAGG + Exonic
1037181715 8:16014858-16014880 AGTGTCTGAGTGGACATAGAGGG + Intergenic
1037390292 8:18386235-18386257 TGGAGCTGAGTGGGGGTAGAGGG - Intergenic
1038364794 8:26920021-26920043 AGGGTCTGAGCAGAGATACAAGG + Intergenic
1038446255 8:27606305-27606327 AGGCTCTGAGTGGGGAAGGAGGG - Intronic
1039227516 8:35404349-35404371 AGGGTTTGAGAAGGAATAGAAGG + Intronic
1040387326 8:46922325-46922347 AGGGTTGGAGTGGGGAGGGATGG - Intergenic
1042709939 8:71706526-71706548 TGGTGCAGAGTGGGGATAGATGG - Intergenic
1046288223 8:112124419-112124441 AGAGTCAGACTGGGGTTAGAAGG - Intergenic
1047228980 8:122979927-122979949 AGGTTCTTAGGGGGAATAGAGGG + Intergenic
1047702387 8:127462073-127462095 GGGGGCTGGGTGGGGATAGGAGG + Intergenic
1048102390 8:131367657-131367679 AGAGTGTGAGTGGGGGTGGATGG + Intergenic
1048492390 8:134906206-134906228 AGGGCCACAGTGGGGAAAGAGGG - Intergenic
1049167852 8:141137840-141137862 AGGGACTCAGGGAGGATAGACGG + Intronic
1049592798 8:143470219-143470241 ACGGGCTGAGTGGGGACAGTAGG - Intronic
1050598675 9:7229027-7229049 TGGGGCTGAGTGGGGGAAGATGG - Intergenic
1050637967 9:7632493-7632515 GGGGTCTGTTGGGGGATAGAGGG + Intergenic
1052173201 9:25427047-25427069 AGGCACTGAGTGTGGACAGAGGG + Intergenic
1053071378 9:35104059-35104081 AGGGTGTGAAGGGGGATGGAGGG - Intergenic
1053120990 9:35547450-35547472 AGGGTCTGAGTGGCTGCAGAAGG - Exonic
1053833953 9:42114007-42114029 AGGGTCTGAATGAGAATATAAGG + Intronic
1054596596 9:67073402-67073424 AGGGTCTGAATGAGAATATAAGG - Intergenic
1055426708 9:76204194-76204216 ACGGTCATGGTGGGGATAGAGGG - Intronic
1057725251 9:97563895-97563917 AGGGGCTGGGTGGGGGTAGGGGG - Intronic
1058095125 9:100851350-100851372 AAGGGATTAGTGGGGATAGATGG + Intergenic
1060727325 9:126015160-126015182 TGGGGCTGATTGGAGATAGACGG + Intergenic
1061870922 9:133520061-133520083 TGGGAGTGAGTGGGGATAGAGGG + Intronic
1061954723 9:133955639-133955661 ATGGGGTGAGTGGGGATAGTTGG - Intronic
1062328484 9:136024228-136024250 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328487 9:136024247-136024269 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328490 9:136024266-136024288 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328508 9:136024449-136024471 AGGGTATGTGTGAGGACAGAGGG + Intronic
1203489253 Un_GL000224v1:87737-87759 AGGGTCTCAGTGAGGTTGGAGGG - Intergenic
1203501874 Un_KI270741v1:29632-29654 AGGGTCTCAGTGAGGTTGGAGGG - Intergenic
1185511774 X:669134-669156 AGGGCCTGTGGGGGGATAGAAGG - Intergenic
1186310827 X:8316860-8316882 AAGGACTGACTGGGGATAGACGG - Intergenic
1188330239 X:28861710-28861732 AGGGTATGTGTGAGGAGAGATGG - Intronic
1190132157 X:47758451-47758473 AGGGTCTTGGTGGGGATAGCTGG + Intergenic
1192579349 X:72268008-72268030 TTAGTCTGAGTTGGGATAGATGG + Intronic
1193701214 X:84763703-84763725 AGGGCCTAATTGGGGATGGAGGG - Intergenic
1194686317 X:96922150-96922172 AGGGTCACAGTGTGAATAGAAGG + Intronic
1195971060 X:110473941-110473963 AAGGCCTGAGTAGGGATAAAGGG + Intergenic
1196140283 X:112253937-112253959 AGGATGTGAGTGGGGATCAATGG - Intergenic
1196230564 X:113216480-113216502 AGGCACTGAGTGTGGAAAGAGGG - Intergenic
1196606739 X:117665692-117665714 AGGGCCTGTTTGGGGGTAGAGGG - Intergenic
1197996876 X:132386807-132386829 AGGGCCTGTGGGGGGAGAGATGG + Exonic
1198183992 X:134236746-134236768 AGGGTGTGCGTGGGGATGGAGGG + Intergenic
1198683611 X:139205492-139205514 CGGCTCTCAGTGGGGAGAGAAGG + Intronic
1199947925 X:152682418-152682440 AGGTCCTGAGTGAGCATAGAAGG + Intergenic
1199961754 X:152786036-152786058 AGGTCCTGAGTGAGCATAGAAGG - Intergenic
1202049904 Y:20769618-20769640 AGGGTCCAAGTGGGGATTGTGGG - Intronic