ID: 964413279

View in Genome Browser
Species Human (GRCh38)
Location 3:156421741-156421763
Sequence CCAGGACCTGGTCTCAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964413274_964413279 0 Left 964413274 3:156421718-156421740 CCAGGGAGTGACTGTGGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 964413279 3:156421741-156421763 CCAGGACCTGGTCTCAGATGAGG 0: 1
1: 0
2: 2
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964413279 Original CRISPR CCAGGACCTGGTCTCAGATG AGG Intronic
900899295 1:5506149-5506171 CCTGGACCTGGGGTCAGCTGGGG + Intergenic
901232095 1:7646993-7647015 CCAGTACCGGGCCTCGGATGGGG + Intronic
901643320 1:10704131-10704153 CCAGGAACTGGTCCCAGCTTGGG + Intronic
902955328 1:19921304-19921326 CCAGGAGCTGGGCTGAGCTGGGG + Intronic
903959427 1:27047434-27047456 CCAGGGCAGGGTCTCAGCTGAGG - Intergenic
905028517 1:34866646-34866668 CCTGGACCTTGTCTGCGATGAGG - Intronic
906143827 1:43548633-43548655 CCAGGTCATGGCCTCAGATAAGG - Intronic
906839307 1:49119723-49119745 CCAGGACTTGGACTCAGCTCTGG - Intronic
907328499 1:53656330-53656352 CCAGGAGGAGGTCTCAGGTGAGG - Intronic
907786422 1:57617338-57617360 CAAGGATGTGGTCTCAGCTGGGG - Intronic
908977874 1:69920151-69920173 CCAGGACCTGGTGGGACATGGGG - Intronic
911329407 1:96510029-96510051 CCAGGACCAGGTCTTAGGAGGGG - Intergenic
912167431 1:107057297-107057319 CCAGCATCTGGTCGCTGATGGGG - Exonic
915313382 1:155015560-155015582 AGAGGAGCTGGGCTCAGATGAGG + Exonic
916403420 1:164473088-164473110 CCTGGAGCTGGTAACAGATGAGG + Intergenic
916498410 1:165365759-165365781 TCAGGCCCTGGTGACAGATGTGG + Intergenic
916692268 1:167201656-167201678 CAATGACCTGGTCTCAGCTCAGG - Intergenic
920009564 1:202858073-202858095 GCAGGACCTGGCCTTAGAAGTGG - Intergenic
921940446 1:220833390-220833412 CCTGGATCTGGTCTCTGGTGTGG - Intergenic
922470408 1:225873532-225873554 CCAGGATCTTGTGTCAGATGTGG - Intronic
923133682 1:231098970-231098992 CCAGATCCGGGTCTCAGGTGTGG + Intergenic
923947268 1:238901755-238901777 CCAGGACTTGATCTCAGCTCTGG + Intergenic
924721905 1:246631221-246631243 TCAGGAGCTGGTCTCAGTTCAGG - Intronic
1063962420 10:11318140-11318162 ACAGGAACTGTTCTCAGAAGTGG + Intronic
1064004225 10:11687619-11687641 TCTGGGCCTGGTCTCACATGTGG - Intergenic
1064845795 10:19651596-19651618 CAAGGACCTGGGATCAGATGTGG + Intronic
1065857924 10:29845279-29845301 CTAGGGCCTGGGCTCAGTTGGGG - Intergenic
1067107761 10:43377071-43377093 CCAAGCCCTGGCCTCAGATTGGG - Intergenic
1068186376 10:53591546-53591568 TCAGGACCTGGACTCAGCTCTGG - Intergenic
1068638698 10:59376925-59376947 TCAGGACCTGGTCTCAGCACTGG + Intergenic
1069663067 10:70136660-70136682 ACAGCACCTGGTCTCAAATTAGG + Intergenic
1069910872 10:71758399-71758421 CCAAGACCTCTTCTCAGAAGAGG + Intronic
1069913939 10:71775673-71775695 CCCAGACCTGGTCTCAGAGCAGG + Intronic
1071396923 10:85233244-85233266 CAAGGATTTGGTCTTAGATGTGG + Intergenic
1072290829 10:93962918-93962940 CCAGGACCTGGTATCATACTTGG - Intergenic
1076874887 10:133211109-133211131 CCAGCACCTGGTGTCAGGAGAGG + Intronic
1077018243 11:406373-406395 CCGGGCCCTGGACTCAGAGGTGG - Exonic
1077391290 11:2301782-2301804 GCAGGACCTGGTGTGGGATGTGG - Exonic
1077915429 11:6608690-6608712 CCAGGACCTGGTGGCAAATGGGG + Exonic
1080408865 11:32004578-32004600 GCAGGACCTGGTTTCAGGAGGGG + Intronic
1082029135 11:47592265-47592287 CCAGGACCTGAACCCAGATCTGG - Intronic
1083457181 11:62786977-62786999 CAAGGGCCTGCTCTCAGAGGCGG - Exonic
1083811230 11:65108068-65108090 CCAGGAGCCGGGCACAGATGGGG - Intronic
1083811590 11:65109616-65109638 CCAGGAGCTGGGCACAGATTGGG - Intronic
1084497263 11:69512413-69512435 CCAGGGCCTGGTCTCATGAGTGG + Intergenic
1085532941 11:77202518-77202540 CCAGGCCCTGCTCACAGGTGGGG - Intronic
1086030268 11:82346117-82346139 CCAGGGCCTGGTGTGAGGTGGGG + Intergenic
1086155294 11:83658977-83658999 GGAGGACCTGGTTTCAGATCTGG - Intronic
1090376407 11:126292709-126292731 CCAGGACCTGGTCTCCTACTTGG + Exonic
1096835422 12:54347691-54347713 CTAGGACCTTGTCTCAATTGAGG - Intronic
1097546226 12:61004612-61004634 CCAGGAATTGAACTCAGATGTGG - Intergenic
1097694652 12:62764662-62764684 CTAGGCACTGGGCTCAGATGGGG + Intronic
1099333978 12:81329864-81329886 CCGGGTCCGGGTCTCAGCTGGGG + Intronic
1099661536 12:85568981-85569003 CCAGGCCCTGCTTTCAGAGGTGG - Intergenic
1099818078 12:87674112-87674134 CCAGGGCCTGGTAACATATGAGG + Intergenic
1099878700 12:88439588-88439610 TCAGGACCTGATCTCAGCTCTGG + Intergenic
1100374112 12:93996451-93996473 CCAGGACCTGAGCTTAGAGGAGG + Intergenic
1101800643 12:108019088-108019110 ACAAGACCTGGTATTAGATGTGG - Intergenic
1101877715 12:108606616-108606638 CCAGGGCCTAGTGTAAGATGCGG + Intergenic
1102533298 12:113562705-113562727 CCAGGACATGCTCTGAGCTGGGG - Intergenic
1104959726 12:132482958-132482980 CCATCCCCTGGTCTCACATGGGG + Intergenic
1106608350 13:31252828-31252850 CCAGGACCTGAACTCAGCTCTGG + Intronic
1114342818 14:21762673-21762695 CCAGGACTTGATCTCAGCTCTGG + Intergenic
1116049630 14:39787373-39787395 TCAGGAGCAGGTCTCAGATGAGG - Intergenic
1117641306 14:57801946-57801968 CCAGGACCTAAACTCAGCTGTGG + Intronic
1118872646 14:69756238-69756260 CCATGACCTGGTCTGACATCTGG - Intronic
1119688730 14:76654111-76654133 CCAGGGCCTGGTATCTGATAAGG - Intergenic
1121843047 14:97150581-97150603 CCAGAACCAGGTGTCAGCTGAGG + Intergenic
1122823556 14:104359039-104359061 AGAGGACCTGGTGTCAGGTGGGG + Intergenic
1123111267 14:105868089-105868111 CCAGGGCCCTGTCTCAGCTGGGG - Intergenic
1124583774 15:30986707-30986729 CCAGGGCCTGGTATCAGATTTGG - Intronic
1125054331 15:35339905-35339927 CCAGGACCTGAACTCAGCTGTGG - Intronic
1125219782 15:37319732-37319754 CCAGGACTTGAACTCAGCTGTGG + Intergenic
1126048053 15:44663096-44663118 CCCGGAACGGGTCTCAGCTGAGG - Intronic
1126357682 15:47813373-47813395 CAAGGATCTGGTCTTAGGTGAGG - Intergenic
1126897249 15:53272220-53272242 CCAGAACCTTTTCTCATATGAGG - Intergenic
1126951942 15:53891388-53891410 CCAGGACCTGAACTCAGCTCGGG - Intergenic
1127536980 15:59899432-59899454 CCAGGACCTCATCTCAGAGTTGG + Intergenic
1128653971 15:69444996-69445018 CCAGGAACTAGCCTCCGATGGGG + Exonic
1129362780 15:75034639-75034661 CTAGGACCTGGGCACAGATCTGG + Intronic
1129737813 15:77975693-77975715 CCAGGATCTGGGCTCAGACACGG + Intergenic
1130674242 15:85938247-85938269 CCAGGACCTAGGCCCAGCTGGGG + Intergenic
1132497129 16:269181-269203 CCAGGACCTGGGCCAAGACGGGG + Exonic
1136147278 16:28322727-28322749 CAAGGACCAGGTCTCAGAGAAGG + Exonic
1137046362 16:35666349-35666371 CCAGGACTTGAACTCAGCTGTGG + Intergenic
1137299105 16:47129691-47129713 CCAGGAGCTGATCTCTGATATGG + Intronic
1137919077 16:52467896-52467918 CCAAGACTTGGTCACAGCTGGGG - Intronic
1138593645 16:58017376-58017398 CCTGGACCTGGTTTCAGAGGTGG + Exonic
1140112167 16:72013657-72013679 TCAGGTCCTGCTCTCAGATGTGG - Intronic
1141417156 16:83884633-83884655 CAAGGACCTGGTCTCACACAAGG - Intergenic
1142749442 17:1978351-1978373 CCAGGACCTGGGCTCTGCTTTGG + Intronic
1142957092 17:3529618-3529640 CCAAAACCTGGTCCCAAATGAGG - Intronic
1143632849 17:8148701-8148723 CAAGATCCGGGTCTCAGATGGGG - Exonic
1144616650 17:16781861-16781883 TCAGGACCTGAACTCAGCTGTGG - Intronic
1144728658 17:17514474-17514496 CCAGGACCCGGTGGCAGAGGCGG + Intronic
1144896043 17:18533800-18533822 TCAGGACCTGAACTCAGCTGTGG + Intergenic
1145136169 17:20410420-20410442 TCAGGACCTGAACTCAGCTGTGG - Intergenic
1145879529 17:28343320-28343342 CCAGGACCTGCACTCACAGGAGG - Intronic
1147685358 17:42283817-42283839 CCAGGGCCTGGCCTCAGAGGTGG + Intergenic
1149193216 17:54088233-54088255 CCAGGACTTGAACTCAGCTGTGG + Intergenic
1151367487 17:73626808-73626830 CCAGGGGCTGGTCTTCGATGTGG + Intronic
1151722475 17:75865348-75865370 CCAGGGCATGGTCTCACATGGGG - Intergenic
1152186136 17:78857394-78857416 CCAGAGCCTGGTCTTAGATCAGG + Intronic
1152380376 17:79939237-79939259 CCAGGATCTGGGCACTGATGGGG + Exonic
1160911219 19:1474647-1474669 CCAACACCTGGACTCAGAAGTGG + Exonic
1161054676 19:2184404-2184426 CCAGGACCTGACCTCAGGTCCGG - Intronic
1161314395 19:3611133-3611155 CCAGGCCCTGTGCTCAGAGGTGG + Exonic
1161607186 19:5221623-5221645 CTAGGATCAGGTCTCAGAGGTGG - Intronic
1162180544 19:8865888-8865910 CCAGGAAGTGGTCTCACCTGAGG + Exonic
1162340980 19:10091472-10091494 CCAGGGGCTGGGCACAGATGGGG + Exonic
1162566038 19:11446299-11446321 CCCGGAGCTGGACACAGATGGGG + Exonic
1162722535 19:12670832-12670854 CCAGGACCTGGTCTCACCCCAGG + Exonic
1166009001 19:39927344-39927366 CCTGGTCCTGATCCCAGATGTGG - Exonic
1166209929 19:41299927-41299949 CCAGGGCCTGGGCTTAGACGAGG + Intronic
1166286785 19:41835755-41835777 CCTGCACCTGGCCTCAGAAGTGG - Intergenic
1167090727 19:47341783-47341805 CCATGACCTGGTCTCGGAGATGG + Exonic
1168152901 19:54458577-54458599 CCAGGAGCTGGTCTGAGGGGCGG - Intronic
1168298751 19:55391104-55391126 CCTGGGCCTGGTTTCTGATGAGG - Intronic
926943310 2:18161088-18161110 CAAGGGCTTGGTGTCAGATGTGG - Intronic
930478332 2:51913909-51913931 TCAGGACTTGAACTCAGATGTGG + Intergenic
931687959 2:64810716-64810738 CCAGCATCTGGTGTCTGATGAGG - Intergenic
931779352 2:65566021-65566043 CCAAGGCCTGCTCTCAGATCTGG + Intergenic
932110354 2:68993554-68993576 CCAGGACCAGGTCTCAGGTTTGG + Intergenic
932333842 2:70918158-70918180 GCAGGACCTGGCCTGGGATGGGG + Intronic
933153339 2:78941237-78941259 CCAGGGCCAGTTTTCAGATGGGG - Intergenic
933943133 2:87261871-87261893 CCAGCACATGGTCTCTGATAAGG + Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936957775 2:118040583-118040605 AGAGGGCCTGGTCTGAGATGTGG - Intergenic
937283015 2:120733330-120733352 CCAGGTCCTAGTCCCAGATCTGG - Intergenic
938706898 2:133939372-133939394 CCGGGACCTGTTGTCAGGTGGGG + Intergenic
939753303 2:146075880-146075902 CCAGGACTTGGACTCAGCTCTGG + Intergenic
940128346 2:150353326-150353348 CCAGTGCCTGGTTCCAGATGAGG + Intergenic
941185751 2:162319307-162319329 CCAGGACCTGGTAACAGATGTGG + Intronic
944295522 2:198057335-198057357 CCAGGACCTGTTCCCTGGTGTGG + Intronic
945533251 2:210982321-210982343 CCAGGACCTGAACTCAGCTCTGG - Intergenic
946661606 2:222007092-222007114 CCAAGGCTTGGTCTCAGAGGTGG - Intergenic
946973898 2:225126464-225126486 CCAGGACCTGTTGTGGGATGGGG - Intergenic
947147224 2:227079205-227079227 ACATGGCCTGGTCTCAAATGTGG + Intronic
948731204 2:239964779-239964801 GCAGGACCACCTCTCAGATGTGG - Intronic
948771165 2:240251865-240251887 CCAGGGCTTGCTCCCAGATGGGG - Intergenic
1171954084 20:31446376-31446398 CCAGGTGCTGGTGTCAGATAAGG - Intronic
1172298341 20:33830067-33830089 CCAGAACCAGGTCTCACGTGTGG + Intronic
1172678334 20:36691879-36691901 CCAGACCCTGGTCTGAGTTGTGG + Intronic
1173419849 20:42891263-42891285 CCAGGAGCTGGGCTCAGCTGAGG + Intronic
1174290171 20:49502720-49502742 CCATGACCTCCTCACAGATGAGG + Intergenic
1175148184 20:56912311-56912333 CAAGGACGTGGTCTCAGCTGAGG - Intergenic
1175785242 20:61708068-61708090 CCAGGACCTGGGCTCTGCTGGGG + Intronic
1176864290 21:14035172-14035194 CTAGGAGCTGGTGTCAGATCTGG + Intergenic
1177699919 21:24624959-24624981 CCAGGCCCTGGTCTAAGATCTGG + Intergenic
1177815464 21:25971452-25971474 CCAGGTCATGGTTTCAGGTGGGG + Intronic
1179721923 21:43321100-43321122 CCAGCACCCAGTCTCAGCTGAGG + Intergenic
1181438859 22:22925419-22925441 CCAGAACCAGGACTGAGATGGGG - Intergenic
1182277596 22:29200455-29200477 CCAGGACCAAGCCTCAGGTGAGG + Intergenic
1183878366 22:40804091-40804113 ACAGGGCCTGGGCTCAGAAGGGG - Intronic
1184343289 22:43897941-43897963 CCAGGACCTGGTCTGAGTCACGG + Intergenic
1184343299 22:43897981-43898003 CCAGGACCTGGTCTGAGTCACGG + Intergenic
1185314707 22:50174069-50174091 CCAGGGCCTGGCCTCGGCTGAGG + Intronic
949774137 3:7612375-7612397 CCAGGCCCTGGGCTAAGATGTGG + Intronic
951822681 3:26829885-26829907 TCAGGACCTGATCTCAGCAGTGG + Intergenic
952172637 3:30825759-30825781 CCAGGGCCTGTCCTCAGGTGGGG + Intronic
953024355 3:39136298-39136320 CCAGTAGCTGTTATCAGATGAGG - Intronic
953980932 3:47412726-47412748 CCAGGACCTGGTCCTCGGTGGGG + Exonic
954457399 3:50607333-50607355 GCAGGACCTTGTCTCACCTGTGG - Exonic
954678841 3:52330684-52330706 CCGTGCCCTGTTCTCAGATGAGG + Intronic
954747150 3:52793831-52793853 GCAGGACCTGGTCTCAGTGGGGG - Intergenic
954919011 3:54173590-54173612 CAAGGTGCTGTTCTCAGATGGGG - Intronic
954968592 3:54633035-54633057 CCAGGGCCAGGACTAAGATGAGG + Intronic
955402670 3:58604349-58604371 CCAGGACATGCTCTGAGCTGAGG - Intronic
955600204 3:60636941-60636963 CCATGACTTGGCCTCAGAGGAGG - Intronic
956844481 3:73169870-73169892 CCACAACCTGGGCTCTGATGTGG - Intergenic
959542813 3:107559326-107559348 CTGGGACCTGCTCTCAGCTGAGG + Intronic
961368295 3:126414997-126415019 CCCAGCCCTGGTCTCTGATGTGG - Intronic
961406310 3:126682211-126682233 CCAGGTCCTGAGCCCAGATGGGG - Intergenic
961632032 3:128308158-128308180 CCAGGAGTGGGTCTCAGAAGAGG + Intronic
964413279 3:156421741-156421763 CCAGGACCTGGTCTCAGATGAGG + Intronic
964667790 3:159192830-159192852 TGAGGACCTGTTCCCAGATGAGG - Intronic
966429359 3:179815151-179815173 CCAGGACCTGGTCTAATTTTTGG + Intronic
967406456 3:189120862-189120884 ACAAGACCTGGTCTCAGATGGGG - Intronic
968461309 4:726435-726457 CCAGGCCCTGGTCTAGGTTGTGG + Intronic
968653685 4:1769798-1769820 CCAGGCCCAGGTCCCAGGTGCGG + Intergenic
968702461 4:2063397-2063419 CCAGCTCTTGGTCTCAGAGGAGG + Intronic
969592550 4:8130263-8130285 CCCGGAACTGGTGACAGATGCGG - Intronic
969709970 4:8837112-8837134 CCAGGACCTGGAGCCAGACGAGG + Intergenic
974567149 4:63592218-63592240 CCAGGACTTGGACTCAGCTCTGG + Intergenic
974775753 4:66478241-66478263 CCGGGACCTGTTGTCAGGTGGGG - Intergenic
975722289 4:77259971-77259993 CCAGGACATGTTCTCATCTGAGG - Intronic
976906684 4:90245375-90245397 CCAGCACCTTGTTTCAGCTGAGG - Intronic
977189835 4:93986001-93986023 ACAGGACCAGGGCTAAGATGAGG + Intergenic
977412691 4:96688450-96688472 CCAGAACCTGCTCTCAACTGGGG - Intergenic
979197586 4:117939298-117939320 TCAGGACCTGAACTCAGATCTGG - Intergenic
980945562 4:139317057-139317079 CCAGTACTTTCTCTCAGATGGGG + Intronic
981783751 4:148454832-148454854 CCAGCTCATGGTTTCAGATGAGG + Intergenic
985155435 4:186982893-186982915 CCAGCACCTGGTCACAGATTTGG + Intergenic
985932852 5:3072747-3072769 CCACGTCCTGTTCTCAGCTGTGG - Intergenic
987927736 5:24364333-24364355 CCAGGGGCTGGTCTCCAATGTGG - Intergenic
989334530 5:40300268-40300290 CCAGGACTTGAACTCAGCTGTGG - Intergenic
989474514 5:41858631-41858653 CCAGAACATTGTCTCTGATGCGG - Intronic
992854260 5:80844424-80844446 CCAGGACCTGAACTCAGCTCTGG - Intronic
992995685 5:82330263-82330285 CCAGCACCCTGTCTCAGATTAGG - Intronic
995258061 5:110070475-110070497 TCAGGACCTGGACTCAGCTCTGG - Intergenic
998332277 5:141339649-141339671 CCAGGACCTTCACGCAGATGCGG - Exonic
1000009207 5:157215990-157216012 TCAGGCCCTGGTTTCACATGGGG - Intronic
1001097924 5:168790270-168790292 CCTGGACTTGCTCCCAGATGAGG - Intronic
1001170758 5:169416966-169416988 CCAGGGCCCGGCCTCTGATGAGG - Intergenic
1001673679 5:173494697-173494719 CCAAGACCTGGGGTCAGATATGG + Intergenic
1002306181 5:178285205-178285227 CATGGACCTGGTTTCAGCTGAGG + Intronic
1002315683 5:178341633-178341655 CCAGCACAGGGTCTCAGGTGTGG + Intronic
1006249114 6:32765652-32765674 ACTGCACCTGGCCTCAGATGAGG - Intergenic
1006252888 6:32805193-32805215 CCAGGACCTGAACTCAGCTCTGG - Intergenic
1006313235 6:33276160-33276182 CTAGGACCTGGATTCAGAGGAGG - Exonic
1007508563 6:42357520-42357542 CAAGGACGTGATCTCAGATGTGG - Intronic
1007741349 6:44011595-44011617 CCAAGACTTGGTCTCTGGTGTGG + Intergenic
1009035081 6:58107146-58107168 CCAGGACCAGGTCACCTATGGGG - Intergenic
1009487427 6:64242189-64242211 CCAGGACTTGAACTCAGCTGTGG - Intronic
1009827434 6:68884568-68884590 TTAGGACATGGTCTGAGATGAGG + Intronic
1009858125 6:69290378-69290400 GCAGGAGCTGGTCTCAGAGTTGG + Intronic
1009922201 6:70076015-70076037 CCAAGAGCTGTTCTCTGATGTGG + Intronic
1014545901 6:122734935-122734957 CCAGGTCTTGGTTTCTGATGTGG - Intergenic
1019101365 6:169633240-169633262 CCAACACCTGGAGTCAGATGGGG - Intronic
1019278766 7:189413-189435 CCACTCCCTGGTCTCTGATGGGG + Intergenic
1019521408 7:1462046-1462068 CCAGGATGGGGACTCAGATGGGG + Intergenic
1019703104 7:2483808-2483830 CCTGGAGCTGGCCTGAGATGGGG + Intergenic
1019765245 7:2844730-2844752 CGAGGTCCTGGTCTCACAGGCGG - Intergenic
1019864715 7:3696485-3696507 CCAAATCCTGGGCTCAGATGAGG - Intronic
1020644815 7:10802015-10802037 CCAAGGCCTGGTCTCAGAGATGG + Intergenic
1021224314 7:18010458-18010480 TCAGGACCTGGACTCAGCTCTGG - Intergenic
1022171819 7:27838755-27838777 CCAGCGCCTGGTCACAGGTGTGG + Intronic
1023566275 7:41526679-41526701 CCAGGTCAAGGTCTGAGATGCGG - Intergenic
1026843143 7:73682223-73682245 CCTGGACCAGGTCTCACCTGCGG + Exonic
1028755843 7:94433398-94433420 CCAGGGCCTAGACTCAAATGTGG + Intergenic
1029856834 7:103526043-103526065 GCAGGGCCTGGTGTCAGCTGTGG + Intronic
1034383597 7:150720180-150720202 GCAGGCCCTGGTCACAGACGTGG - Exonic
1035546656 8:486936-486958 CCAGGACAGGGCCTCACATGTGG + Intergenic
1035711061 8:1714795-1714817 TCAGGACCTGAACTCAGATCTGG + Intergenic
1035925715 8:3725659-3725681 GGAGGACCCGGTCTCAGATGTGG + Intronic
1038023527 8:23569888-23569910 CCAGGAACTATTTTCAGATGAGG - Intronic
1038518578 8:28208736-28208758 CCAGGACCTGAACTCAGCTCTGG + Intergenic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1040951665 8:52943129-52943151 TCAGTAACTGGACTCAGATGGGG + Intergenic
1044269881 8:90229602-90229624 GCAGGACCAGGTCCAAGATGTGG - Intergenic
1046381486 8:113456183-113456205 CCAGGACCTGGATTAGGATGAGG - Intergenic
1049205287 8:141360811-141360833 CCAGGCCCAGGTCTCAGCTGAGG - Intronic
1049463714 8:142741613-142741635 CCAGGACTGGGTCTCTGAGGGGG + Intronic
1051670211 9:19502654-19502676 CCAGGACCTGAACTCAGCTCTGG - Intergenic
1053243725 9:36517665-36517687 CTAGGACCTGGTCCCAGAAATGG + Intergenic
1054872549 9:70061559-70061581 CCAGGAACTGGACTAAGGTGAGG + Intronic
1055895090 9:81165047-81165069 CCAGGACCTGAACTCAGCTCTGG + Intergenic
1056617545 9:88181272-88181294 CGAGGACCTGGACTGAGTTGAGG - Intergenic
1060732961 9:126049614-126049636 ACAGAACCTGGGCTCAGCTGTGG + Intergenic
1061218302 9:129234768-129234790 CCAGAACCTGGGCACAGCTGGGG + Intergenic
1061517410 9:131097719-131097741 GCAAGACCTGGGCTCAGATCTGG + Intronic
1061625619 9:131839122-131839144 TAAGGACCTGATCTCAGGTGGGG + Intergenic
1062044461 9:134418604-134418626 CCAGGCTTTGGTCTCAGCTGAGG + Intronic
1062094298 9:134695061-134695083 CCAGGAAGTGGGCTCAGGTGGGG - Intronic
1062353824 9:136152532-136152554 TCAGGACCTGGTCTGTGATGGGG + Intergenic
1062353831 9:136152556-136152578 TCAGGGCCTGGTCTGTGATGGGG + Intergenic
1062353849 9:136152628-136152650 TCAGGGCCTGGTCTCTGATGGGG + Intergenic
1188595355 X:31893608-31893630 CCATTCCCGGGTCTCAGATGAGG + Intronic
1190939676 X:55028244-55028266 CCACGCCCTGGTCTCAGCTTGGG - Intronic
1192970747 X:76226613-76226635 CCAGCTACTGGTCCCAGATGGGG + Intergenic
1192976944 X:76296686-76296708 CCAGGACCTGAACTCAGCTCTGG - Intergenic
1195827889 X:109022835-109022857 CCAGGACTTGAACTCAGCTGTGG - Intergenic
1196932770 X:120697413-120697435 GCAGGGCCTGGTGTCAGCTGTGG - Intergenic
1199722160 X:150549669-150549691 CCAGGAACTGCTGTCAGAGGAGG + Intergenic
1200879982 Y:8202553-8202575 CCAGGCCCTGCTCCCATATGGGG - Intergenic
1201603910 Y:15764199-15764221 CAAGGAAATGGTCTGAGATGAGG - Intergenic