ID: 964413595

View in Genome Browser
Species Human (GRCh38)
Location 3:156424876-156424898
Sequence GTGTCTTATTACAAGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964413595_964413597 3 Left 964413595 3:156424876-156424898 CCTGAACACTTGTAATAAGACAC 0: 1
1: 0
2: 2
3: 7
4: 111
Right 964413597 3:156424902-156424924 ATGAAAAATAAGAGGAAACAAGG 0: 1
1: 0
2: 3
3: 104
4: 1215
964413595_964413598 14 Left 964413595 3:156424876-156424898 CCTGAACACTTGTAATAAGACAC 0: 1
1: 0
2: 2
3: 7
4: 111
Right 964413598 3:156424913-156424935 GAGGAAACAAGGAAGTTCATAGG 0: 1
1: 0
2: 2
3: 19
4: 254
964413595_964413596 -5 Left 964413595 3:156424876-156424898 CCTGAACACTTGTAATAAGACAC 0: 1
1: 0
2: 2
3: 7
4: 111
Right 964413596 3:156424894-156424916 GACACTGCATGAAAAATAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 280
964413595_964413599 15 Left 964413595 3:156424876-156424898 CCTGAACACTTGTAATAAGACAC 0: 1
1: 0
2: 2
3: 7
4: 111
Right 964413599 3:156424914-156424936 AGGAAACAAGGAAGTTCATAGGG 0: 1
1: 0
2: 2
3: 28
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964413595 Original CRISPR GTGTCTTATTACAAGTGTTC AGG (reversed) Intronic
904216176 1:28921831-28921853 TTGTGTTATTTCAAGTGTTGAGG - Intronic
905377951 1:37537463-37537485 GTGTTTTAGTAGAAGTGTTGTGG - Exonic
909995603 1:82275427-82275449 TTTTCTTATTATAAGTTTTCTGG - Intergenic
921523026 1:216180865-216180887 GTGCCCTTTTGCAAGTGTTCTGG - Intronic
923574734 1:235147954-235147976 GTGGCTTGTTACCAGTGCTCAGG - Intronic
1063751165 10:8948804-8948826 GTTTCTTATTACAATTGCTTTGG + Intergenic
1065003552 10:21359131-21359153 GTCTCTTAGTCCAAGTTTTCAGG - Intergenic
1066356603 10:34690655-34690677 GTGGCTTATAACATGTTTTCTGG - Intronic
1068194115 10:53694281-53694303 CTGTATTCTTAAAAGTGTTCAGG + Intergenic
1068742529 10:60490326-60490348 GTGTGTTAAAACAAATGTTCTGG - Intronic
1069892317 10:71659640-71659662 GTGTATTATTACATGTGTTCAGG - Intronic
1071965609 10:90849085-90849107 GTGTATTATTTCAAGTTTTAAGG + Intronic
1081393504 11:42558371-42558393 GGGTCTTATTAAGAATGTTCTGG + Intergenic
1081600462 11:44489018-44489040 GTGACTTAAGACAAGTGGTCAGG - Intergenic
1082627413 11:55501877-55501899 GGGTCCTATTACAAGAGTTTCGG - Intergenic
1084730140 11:71067554-71067576 GTATTTTATTACAAGTGTGGAGG + Intronic
1085664926 11:78406103-78406125 GTGCCTTATTACCAGTTTTTGGG - Intronic
1086525464 11:87720319-87720341 GTGTATTAGTACAAGTTTTCTGG - Intergenic
1089002223 11:115061234-115061256 GTGTCTTGTTGCAATTATTCAGG - Intergenic
1091319254 11:134638268-134638290 GTGTCTTATTGTAAGTGCCCTGG - Intergenic
1091354192 11:134923206-134923228 ATGGCTTATTACAAGTGTGCAGG + Intergenic
1093926773 12:24916366-24916388 GTGTCTTTTTCCAAGTCTACTGG + Intronic
1096936972 12:55291652-55291674 GTGTCTTATTATCAGGGTGCAGG - Intergenic
1098141626 12:67455658-67455680 GTTTAATATTACAAGTGTTTGGG + Intergenic
1098623125 12:72629664-72629686 GTGTCTTAGTACAAATATTTTGG - Intronic
1098863581 12:75736766-75736788 GTGTAATATTAGAAGTGTTTGGG - Intergenic
1099013452 12:77319258-77319280 GTGTCTTATTTTGAGTGCTCTGG + Intergenic
1099691017 12:85951517-85951539 GTGTTATGATACAAGTGTTCTGG - Intergenic
1104447111 12:128843548-128843570 GTGTCTTATCAAATGTCTTCGGG - Intergenic
1107304954 13:39008032-39008054 ATGTTTAATTAGAAGTGTTCTGG + Intergenic
1111066105 13:83094030-83094052 GTTTCTAATTACAAGTGCCCAGG - Intergenic
1112278015 13:98038714-98038736 GTGTGTAATTAAAAATGTTCTGG - Intergenic
1113098764 13:106694808-106694830 GGGTCTTATTTCAAGTGCTGTGG - Intergenic
1119226462 14:72947974-72947996 TTCTCTTATTAAATGTGTTCTGG + Intronic
1120809659 14:88791467-88791489 GTGTCTTAGTACAACTTTTATGG - Intronic
1126917980 15:53487169-53487191 CTGTATTATTACTAGGGTTCAGG + Intergenic
1130266378 15:82408411-82408433 GTGTATTTGTACAAGTGTTTTGG + Intergenic
1131286534 15:91063655-91063677 GAGTGTTATTTCAAATGTTCTGG + Intergenic
1133847331 16:9467414-9467436 GTGTTTTATTCCAAGTGTAAAGG - Intergenic
1140817446 16:78634182-78634204 GTGTCTAAATACAAATGTCCAGG + Intronic
1147279791 17:39349615-39349637 GTGACTTATCACAAGAGGTCAGG - Intronic
1147941387 17:44050823-44050845 GTATTTTATTAGAAATGTTCAGG - Intronic
1149968812 17:61195090-61195112 ATCACTTATTACAAATGTTCAGG + Intronic
1153412187 18:4806049-4806071 GTGCCTTATGAAAAGTGTACAGG + Intergenic
1155754938 18:29480626-29480648 ATGTCTTAGCACAGGTGTTCAGG + Intergenic
1156084387 18:33381206-33381228 TTTTCTTATTACTATTGTTCAGG - Intronic
1157826053 18:50813459-50813481 GTGTGTTTTAACAAGTCTTCCGG - Intronic
1161688681 19:5718030-5718052 GTGTCTTATTAGAGTTGTTGTGG - Intronic
926005773 2:9372577-9372599 GTTTAATATTAGAAGTGTTCTGG - Intronic
930870529 2:56166493-56166515 GTGTAGTATTCCAAATGTTCAGG - Intergenic
933363691 2:81321730-81321752 GTTTCATATTAGAAGTGTTTGGG - Intergenic
933815162 2:86061431-86061453 GTGTATTATTACAAGCATTTTGG + Intronic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
938585903 2:132690454-132690476 GTTTAATATTAGAAGTGTTCTGG + Intronic
939586414 2:144011565-144011587 GTGTCTGATTAAGAATGTTCTGG - Intronic
941192320 2:162400461-162400483 GTTTCATACTACCAGTGTTCTGG + Intronic
944954323 2:204790498-204790520 GTGTGTTATAAGAAGTGTTCTGG + Intronic
947562333 2:231167293-231167315 GTGTCCTAATACATCTGTTCTGG - Intronic
1173552749 20:43944645-43944667 TAGTATTGTTACAAGTGTTCAGG + Intronic
1178385603 21:32147042-32147064 GAATCTTAGTAAAAGTGTTCTGG + Intergenic
1179237838 21:39563172-39563194 GTCTCTTATTAGAAGAGCTCAGG - Intronic
949532922 3:4975314-4975336 CTGTTTTATTAAAAGTATTCAGG - Intergenic
950905243 3:16531577-16531599 TTGACTTATTCCAAGTCTTCAGG - Intergenic
951829761 3:26913426-26913448 ATGTCTTATAACAAATGTTGTGG - Intergenic
953342082 3:42143002-42143024 GTGGCTGATTCCAAGTCTTCGGG - Intronic
956218949 3:66881744-66881766 GTGTTTTATTCCCAGTGTTAAGG - Intergenic
956585929 3:70864919-70864941 TTATCATATTTCAAGTGTTCAGG + Intergenic
957838798 3:85638156-85638178 CTGACTTAATTCAAGTGTTCAGG - Intronic
964413595 3:156424876-156424898 GTGTCTTATTACAAGTGTTCAGG - Intronic
967231805 3:187345551-187345573 GTTTCTTCTTAAAAGTATTCTGG - Intergenic
971764863 4:30817848-30817870 GTGTTTTAAAAGAAGTGTTCTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
975759741 4:77607689-77607711 GTGTTTACTTACAGGTGTTCTGG + Exonic
977234227 4:94487676-94487698 GTGACATGTTACAAGTGTTCAGG + Intronic
977497350 4:97794972-97794994 GTGTATTATTACAAGCTTTGTGG - Intronic
984749399 4:183257158-183257180 TTGTTTTATCACAAGTGTTGGGG + Intronic
984761016 4:183363028-183363050 GTGTCTTCTTACAAATGCTCAGG - Intergenic
987576596 5:19736110-19736132 GTATCTTAATAAAAATGTTCTGG - Intronic
993383423 5:87234060-87234082 GTTTATTATTAGAAGTGTTTTGG + Intergenic
994622267 5:102177603-102177625 GTGTCTTATTACATCTCTACCGG - Intergenic
994748472 5:103708661-103708683 GTGTGTTTTTACAAAAGTTCAGG - Intergenic
999044940 5:148456789-148456811 GTGAATTATCACAAATGTTCTGG + Intronic
1000493565 5:161947705-161947727 GTGTTGCATCACAAGTGTTCAGG + Intergenic
1001165467 5:169361630-169361652 GTTTCTTAAAACAAGTGTTTTGG + Intergenic
1001711078 5:173778473-173778495 GTTTCTAATTACAAAAGTTCAGG + Intergenic
1005189515 6:23204187-23204209 GTTTAATATTAGAAGTGTTCTGG - Intergenic
1005840380 6:29741288-29741310 GTGTTTTATTTCAAGTGTCTGGG - Intergenic
1005854680 6:29851921-29851943 GTGTTTTATTTCAAGTGTCTGGG - Intergenic
1005861521 6:29906136-29906158 GTGTTTTATTTCAAGTGTCTGGG - Intergenic
1010015921 6:71104928-71104950 GTGTGATATAACAAGTGGTCAGG + Intergenic
1010375219 6:75160901-75160923 GTTTCTTATGAGAAGTGTTTTGG - Intronic
1011622024 6:89252011-89252033 GTGTCTGAGGACAAGTGTGCTGG - Intergenic
1011868868 6:91867266-91867288 GAGTCTTAGTAGAAGTGTTGAGG - Intergenic
1012191251 6:96282483-96282505 ATGTCTTTTTACAAGTAATCTGG - Intergenic
1016035806 6:139381637-139381659 GTGACTTAATACATATGTTCTGG + Intergenic
1016154592 6:140788987-140789009 GTGAGTTAATATAAGTGTTCTGG - Intergenic
1020976194 7:15010432-15010454 GGGTCTTATTACAAATTTTGTGG - Intergenic
1022034811 7:26523743-26523765 TTATCTTATCAAAAGTGTTCAGG + Intergenic
1027732700 7:81896457-81896479 TTGTCTTATTACAGGTATTAGGG + Intergenic
1028125827 7:87112164-87112186 GTGTCTTCTTTCAACTGTTCAGG - Intergenic
1031696619 7:124864019-124864041 TTCTCATATTTCAAGTGTTCTGG - Intronic
1032487997 7:132302823-132302845 TTGTCATGTTACAAGTGTTGGGG - Intronic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1034054573 7:148021248-148021270 GTGGCACATAACAAGTGTTCAGG - Intronic
1035989738 8:4476584-4476606 GTGTTTTACTAAAAGTGTTGTGG - Intronic
1037209164 8:16364011-16364033 GTGGCTTAGAACAACTGTTCTGG - Intronic
1037235330 8:16713595-16713617 GTTTAATATTACAAGTGTTTTGG - Intergenic
1039160715 8:34615999-34616021 GTGTATCATTACAAAGGTTCTGG - Intergenic
1041164321 8:55075657-55075679 GTTTAATATTAGAAGTGTTCTGG + Intergenic
1042335186 8:67622505-67622527 GTGTCTCATTACAAGGGCCCAGG - Intronic
1043490154 8:80740777-80740799 CTGTCTTATCCCAAGGGTTCAGG + Intronic
1047912229 8:129542954-129542976 GTGTCTGGCTACAAGAGTTCCGG + Intergenic
1050772856 9:9225322-9225344 GTGTCTTATTGAAACTGTTCAGG - Intronic
1056887395 9:90456600-90456622 GTTTAATATTACAAGTGTTTGGG - Intergenic
1056946052 9:90997914-90997936 GTTTAATATTACAAGTGTTTGGG + Intergenic
1060510530 9:124228941-124228963 ATGTCTAATTACATGAGTTCAGG + Intergenic
1186824082 X:13320624-13320646 ATGTGTTTTTACAGGTGTTCAGG + Intergenic
1187698573 X:21943676-21943698 TTGAGTCATTACAAGTGTTCTGG + Intronic
1188965316 X:36544479-36544501 ATGTTTTATTAGAATTGTTCTGG + Intergenic
1193422456 X:81298299-81298321 TTGTCTTTTTAGAAGTCTTCAGG - Exonic
1196396512 X:115268572-115268594 GTGTGCTATTACAAGAGTCCAGG - Intergenic