ID: 964414327

View in Genome Browser
Species Human (GRCh38)
Location 3:156431573-156431595
Sequence ACATTCATAGGAATGCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964414323_964414327 10 Left 964414323 3:156431540-156431562 CCAGGGGCCAATGCACCGAGGAT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
964414324_964414327 3 Left 964414324 3:156431547-156431569 CCAATGCACCGAGGATGACTGTG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
964414325_964414327 -5 Left 964414325 3:156431555-156431577 CCGAGGATGACTGTGCAGACATT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
964414320_964414327 14 Left 964414320 3:156431536-156431558 CCCTCCAGGGGCCAATGCACCGA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
964414321_964414327 13 Left 964414321 3:156431537-156431559 CCTCCAGGGGCCAATGCACCGAG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964414327 Original CRISPR ACATTCATAGGAATGCCTTA AGG Intronic