ID: 964415885

View in Genome Browser
Species Human (GRCh38)
Location 3:156446982-156447004
Sequence CAGTGTGGCCAGAGAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 11, 3: 75, 4: 560}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964415885 Original CRISPR CAGTGTGGCCAGAGAAGAGA AGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900162995 1:1233236-1233258 CAGTGCTGCCAGAGAAGGGAGGG + Exonic
900922550 1:5682774-5682796 GAGGGTGGCCAGAGAAGCAATGG + Intergenic
901175996 1:7299623-7299645 GAATGTGGCCAGGGAGGAGATGG - Intronic
901203536 1:7480740-7480762 AAGTGTAGACAGAGAAGAGAAGG - Intronic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901564167 1:10098571-10098593 CACTGGAGCAAGAGAAGAGAGGG - Intronic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901989410 1:13100656-13100678 CAGTGTGGCCAGACCTGGGAAGG + Intergenic
901992403 1:13126108-13126130 CAGTGTGGCCAGACCTGGGAAGG - Intergenic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902552984 1:17230285-17230307 CAGTGTCGCTAGAGAAGCCACGG + Intronic
902707238 1:18213926-18213948 CAATGAGGCCAGAGAAGGGCAGG - Intronic
903653978 1:24937717-24937739 AACTGAGGCCAGAGAAGTGAAGG + Intronic
904418747 1:30378168-30378190 CGGTGTGGCCAGAGAGGCCAGGG + Intergenic
904426004 1:30423603-30423625 CTGTGAGGACTGAGAAGAGAAGG - Intergenic
904496145 1:30887855-30887877 GACTGAGGCCAGAGAAGAGCAGG - Intronic
904845812 1:33414303-33414325 CAGTGTGGCCAGCAAGGACAGGG + Intronic
905029004 1:34868986-34869008 CACGGTGGCCACAGAAGACAAGG - Exonic
905250261 1:36643848-36643870 GAGTGTACCCAGAGAAGAGGTGG + Intergenic
905300798 1:36985134-36985156 CAGAGGGGCCAAAGAAGAGGGGG + Intronic
905365276 1:37447958-37447980 CAGTGTGGGAAGGAAAGAGATGG + Intergenic
905764979 1:40592808-40592830 CAGTGAGGCTAGAAAAGAGCAGG + Intergenic
906651302 1:47514964-47514986 CATTGTGTCCAGGAAAGAGATGG - Intergenic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907311547 1:53541748-53541770 CTGTGATGCCAGGGAAGAGAAGG - Intronic
907337854 1:53712117-53712139 TGGTGTTGCCAGAGCAGAGATGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908410617 1:63860983-63861005 CCGTGTGTCAAGAGAAGGGAAGG - Intronic
909196244 1:72628167-72628189 CAGTGCTCCCAGAGAATAGAAGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
911006944 1:93235942-93235964 CAGTATGGTAAGAGAAGAAAGGG + Intronic
911054506 1:93698567-93698589 CTCCGTGGCCAGAGGAGAGAAGG + Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
914319416 1:146544865-146544887 AGATGTGGCCAGAGAAGCGATGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915301278 1:154953013-154953035 CTGAGTGGCTAGAGAAGGGATGG - Intronic
915323360 1:155068234-155068256 CAGTGAGGCCACACAAGACATGG - Intronic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915382854 1:155458756-155458778 CAGTGTGGTCAGACTAAAGACGG - Intronic
915514124 1:156402713-156402735 AACTGAGGCCAGAGAGGAGAAGG - Intergenic
915786206 1:158615184-158615206 GCGTGTGGCCAGAGCAGGGAGGG - Intronic
915979575 1:160411400-160411422 CAGCGTTCCCAGGGAAGAGATGG - Intronic
916027673 1:160848771-160848793 CAGTGTGCCCAGGGAAGGCATGG + Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916256086 1:162789588-162789610 CAGTTTGGTCTGAGAACAGAAGG + Intergenic
916353703 1:163880857-163880879 TAGTCTGGCCAGATCAGAGAGGG + Intergenic
916404647 1:164485969-164485991 TGGTGTTGCCAGACAAGAGAAGG - Intergenic
916479684 1:165203782-165203804 CAGGGAGGCCAGGGAAGAGGTGG - Exonic
917169804 1:172158509-172158531 CAGTGTGCAGTGAGAAGAGAGGG + Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920230473 1:204466654-204466676 CAGTGGGGGGAGGGAAGAGAAGG + Intronic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920601631 1:207330743-207330765 CAGTGTAGTCAGAGAAGACTTGG - Intronic
920727278 1:208447999-208448021 GAGTGAGGGCAGAGGAGAGAGGG + Intergenic
921508693 1:216005997-216006019 CAGTGTGACCGGAGATGTGATGG - Intronic
922227632 1:223659371-223659393 CAGTGGGGCCAGATCACAGAGGG - Intronic
922241290 1:223756925-223756947 AACTGAGGCCAGAGAGGAGAGGG + Intronic
922908997 1:229199696-229199718 CAGGCAGGCCAGAGAAGGGAAGG - Intergenic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923550621 1:234960102-234960124 CACTGAGGCCAAAGAAGGGAAGG + Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
923993452 1:239465597-239465619 TAGTTTGGCCATGGAAGAGAAGG - Intronic
924044389 1:240012337-240012359 CAGATTGGCCAGAAAAGGGAGGG - Intergenic
924654917 1:245965708-245965730 AATGGTGGCCAGAGATGAGAGGG + Intronic
1063159173 10:3407373-3407395 CAGTGTGCTCAGAACAGAGATGG - Intergenic
1063996906 10:11628376-11628398 AGGTGTGGCGAGAGAAGAGGGGG - Intergenic
1064482704 10:15755276-15755298 TTGTGTAGCCAGAAAAGAGAAGG - Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1065952386 10:30663984-30664006 GTGGGTGGACAGAGAAGAGATGG - Intergenic
1066593260 10:37019363-37019385 CTGTGTGGCCATAAAAGAGATGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070190934 10:74111690-74111712 CTGTGTGGTGAGAGAAGAAAAGG - Intronic
1070417314 10:76203230-76203252 AGCTGAGGCCAGAGAAGAGAAGG - Intronic
1070717345 10:78732357-78732379 CAGGGTGGCGAGTGAAGGGAGGG + Intergenic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1072004676 10:91233056-91233078 AAGTATGACCAAAGAAGAGAGGG + Intronic
1073616763 10:105004205-105004227 CAGGATGGACAGAGAAGGGATGG + Intronic
1073951261 10:108812420-108812442 CAGTATGGCCAGGGAAGAAAGGG + Intergenic
1074365218 10:112852519-112852541 AAGTCTGGACAGAGAAGTGAAGG + Intergenic
1075122828 10:119676718-119676740 GAGTGTGGCTACAGAAGAGAGGG + Exonic
1075667449 10:124241095-124241117 CACTGTGGCCAGAGAAGGCCTGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076403987 10:130200563-130200585 CAGAGGGTCCAGAGAAGAGGGGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078858555 11:15226494-15226516 AAGTGTGGCCAGAGGTGAAATGG - Intronic
1080412526 11:32039179-32039201 CAAACTGGACAGAGAAGAGATGG - Intronic
1080751980 11:35159037-35159059 CTCTGAGGCCAGAGAACAGAAGG + Intronic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081804268 11:45881817-45881839 GAGTGTGGCCAGAGAAACCAGGG - Exonic
1082108478 11:48245574-48245596 CATTGGGGCCACAGAAGAGCAGG - Exonic
1082565116 11:54667785-54667807 CATTGGGGCCACAGAAGGGAAGG - Intergenic
1082576854 11:54817266-54817288 CACTGTGGCAAGAGGAGAAAGGG - Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1084947938 11:72648953-72648975 CAGTGTGGGCATCGAAGAGGAGG - Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085231769 11:74978141-74978163 CAGTATGGTCAGAGAAGACCTGG + Exonic
1085295150 11:75427331-75427353 CAGGGTGGCCAGACATGGGAAGG - Intronic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1086461714 11:87012365-87012387 CATTGAGGCCAGAGAAGGTAGGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087596763 11:100263841-100263863 TAGTGTGGCAAGAGCAGACAGGG - Intronic
1088388113 11:109282012-109282034 GAGGGTGGCCAGAGGAGCGAGGG - Intergenic
1088879690 11:113963709-113963731 GTTTGTGCCCAGAGAAGAGAAGG + Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1091214429 11:133891954-133891976 GAGGGTAGACAGAGAAGAGAAGG - Intergenic
1091230036 11:133982291-133982313 CAATGAGGACAGGGAAGAGAGGG + Intergenic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1091593392 12:1858643-1858665 AACTGTGGGGAGAGAAGAGAAGG + Exonic
1091954318 12:4625734-4625756 CAGAGAGGAGAGAGAAGAGAAGG + Intronic
1092059019 12:5533236-5533258 CAATGTGGCCAGAGAAGTAGGGG + Intronic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1093647885 12:21609870-21609892 CAGTGTGTCTAGACTAGAGAAGG + Intergenic
1094384350 12:29877825-29877847 AAGTGTGGTAAAAGAAGAGAGGG - Intergenic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1095959467 12:47825258-47825280 CAGAGTGGGGAGAGAAGAGGGGG + Intronic
1096420026 12:51449126-51449148 CAGTTTTTCCTGAGAAGAGATGG - Intronic
1096557928 12:52415161-52415183 CAGCCAGGCCAGGGAAGAGAAGG + Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097803220 12:63938112-63938134 TCATGTGGCCAGAGAAGAAAGGG + Intronic
1100210639 12:92395108-92395130 CAGTTTGGCCAGATAAGAAATGG + Intergenic
1100885597 12:99066474-99066496 GTGTGTGCACAGAGAAGAGAGGG + Intronic
1100914108 12:99398849-99398871 CATTATGTCCAGAGAACAGACGG - Intronic
1101227532 12:102704798-102704820 CAGAGTTGCCAGACAAGATAGGG + Intergenic
1101388851 12:104281788-104281810 CAGAGTGTGAAGAGAAGAGAAGG - Intronic
1101721291 12:107352774-107352796 GGCTGTGGGCAGAGAAGAGATGG + Intronic
1102022771 12:109695624-109695646 CAGTGGGGGCAGCGGAGAGATGG - Intergenic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102418115 12:112782040-112782062 CAATGGGGGCAGAGAAGAGGAGG + Intronic
1104524863 12:129511188-129511210 TACTGAGACCAGAGAAGAGAAGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104795114 12:131511820-131511842 AGATGTGGCCAGAGAAGGGATGG - Intergenic
1104908786 12:132229640-132229662 CCGTGTGGCCCGAGAAGGGTGGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105990755 13:25618327-25618349 CAGTGTGGAAAGGGAAGACATGG + Intronic
1107418688 13:40225106-40225128 GTGTGTAGGCAGAGAAGAGAAGG + Intergenic
1107567399 13:41619463-41619485 CAGTGCAGTCAGACAAGAGAAGG - Intronic
1107577419 13:41741891-41741913 CAGTGGGGACACAGAAGAGAAGG + Intronic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1108581787 13:51834122-51834144 CAGTTTGTGCAGAGAAGAGAGGG + Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1108916089 13:55613626-55613648 CAGTGTTGGCAGAGATGAAAAGG - Intergenic
1109766267 13:66903383-66903405 AAATGTGACCACAGAAGAGATGG + Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111521216 13:89407047-89407069 CTATGTGGCAAGAGAAGAAAGGG + Intergenic
1112378537 13:98866099-98866121 CAGGGTGGCCAGATAACAGTTGG - Intronic
1112429574 13:99338886-99338908 CAGGGCTGCCAGTGAAGAGAAGG - Intronic
1112673839 13:101674332-101674354 CAGGGTGGCAAAAGAAGACAAGG - Intronic
1113430352 13:110245147-110245169 CAGAGTAGCCAGGGAAGAGCCGG + Intronic
1114306342 14:21426821-21426843 CAGTGTTGACAGAAAAGTGATGG - Intronic
1115960848 14:38835454-38835476 GAGCGTGCCCAGAGAGGAGAAGG + Intergenic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1118107253 14:62673910-62673932 CAGTGGGGTCAGAGAAGGGATGG - Intergenic
1118448252 14:65871294-65871316 TAGAGTGGCCAGAGAGGAGCAGG + Intergenic
1118503500 14:66386327-66386349 GAGTTTGGCTAGAGAAGAGCTGG - Intergenic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119719136 14:76879497-76879519 GAGTGCGGACAGAGAAGAAAAGG + Intergenic
1119768548 14:77205960-77205982 CAGTCCTGCCAGAGAAGAGGTGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1122588067 14:102825111-102825133 CAGCGTGGGCAGAGCAGAAAGGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1122724126 14:103739454-103739476 CAGTGTTGACGGAGCAGAGAGGG - Intronic
1122941302 14:104982600-104982622 CAGTGTGGTCAGGCAAGAGTGGG - Intergenic
1123662218 15:22574412-22574434 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1123726863 15:23111917-23111939 GAGTGTGCCCAAAGAAGACAAGG - Intergenic
1124262000 15:28201095-28201117 CGGTGTAGCCAGAGGACAGAGGG - Intronic
1124316020 15:28668694-28668716 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124582952 15:30978040-30978062 CACTGTGGGCAGAGCAGTGAGGG - Intronic
1125195742 15:37043985-37044007 CAGTGTGGATAAAGAAGAGACGG - Intronic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125475964 15:40048247-40048269 CAGTATGGCCAGTGAAGCGGGGG + Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1125588642 15:40840343-40840365 CAGTGGGAACAGACAAGAGATGG + Intergenic
1126753077 15:51897189-51897211 CAGTGTAGACTGAGAAAAGAAGG - Intronic
1126973399 15:54146492-54146514 AAGTGTTGCCAGAAAAGACATGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127608051 15:60609790-60609812 AAGTGGGGACAGAGAAGTGAGGG + Intronic
1128065625 15:64762877-64762899 TGGTGTGAACAGAGAAGAGAAGG + Intronic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128706404 15:69840311-69840333 GAGTGTGGGAAGAGTAGAGAGGG - Intergenic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129669369 15:77598626-77598648 AGGTGTGGCCAGAGAAGGAAAGG + Intergenic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130638601 15:85648942-85648964 CTGCATGGCCTGAGAAGAGATGG + Intronic
1131270977 15:90947527-90947549 CAGTGTGGCCTGGGAAGGGGTGG + Intronic
1131425861 15:92345036-92345058 AAGTGTGGCCAGTGAAGTAAGGG + Intergenic
1131508425 15:93035681-93035703 CAGGGCGGCCTGAGGAGAGATGG + Intronic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132554106 16:565118-565140 TGGTGTGGCCAGAGAAGGGTTGG - Exonic
1132880746 16:2160741-2160763 CAGAGAGGCCAGAGAATTGAAGG + Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134214379 16:12305458-12305480 AAGTGTGCCCAGAGAAGTGAAGG - Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135392820 16:22107911-22107933 AAATATGGCCAGTGAAGAGAGGG + Intronic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135631302 16:24037765-24037787 CAGTGTGTCCTGAGAAGCGGGGG - Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1137295882 16:47092973-47092995 CAGTGAGGACAAAGAAGAGTGGG - Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137589624 16:49685677-49685699 CAGTGGGGACCGAGAACAGAGGG - Intronic
1137766479 16:50981388-50981410 CAGAGTGGCAAGACAAGAGGTGG + Intergenic
1137832519 16:51557640-51557662 CATTGTGGCCACAGAAGATGTGG + Intergenic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1139490591 16:67284000-67284022 CAGTGAGGCCTGAGAAGCGCTGG + Intronic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1139915903 16:70428341-70428363 CTGTGGGGCCAGCTAAGAGAAGG + Intronic
1140028144 16:71310778-71310800 CAGAGTGGGCAGAGACTAGAAGG + Intergenic
1140697811 16:77552186-77552208 TAGCGTGGCCAGAAAAGACAAGG - Intergenic
1140809587 16:78564648-78564670 CCGAGTGGCCAGATAAAAGAAGG - Intronic
1140902364 16:79381050-79381072 CAGGGAGGCCAGAGCAGAGGTGG - Intergenic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141213531 16:82003070-82003092 CAGTGTGACAAGTGAAGACAAGG + Intronic
1141421952 16:83923191-83923213 CTGTGTGGCCTCAGAAGTGAGGG + Exonic
1141822843 16:86459474-86459496 CAGAGTGGGCAAAGAAGTGAAGG + Intergenic
1141849641 16:86636584-86636606 CAGTGTTTTCAGAGAAGAGCAGG - Intergenic
1142110556 16:88328869-88328891 CAGTTTGGCCACAGCAGAGGAGG + Intergenic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142423059 16:89984833-89984855 GATTGTGGGGAGAGAAGAGAAGG + Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143514227 17:7411395-7411417 CAGTGTGGGCAAAGCAGGGAAGG - Intronic
1143517883 17:7429115-7429137 GGGTGTGGCCAGATAAGAGTTGG + Intergenic
1143538179 17:7554129-7554151 TAGGGAGGGCAGAGAAGAGAGGG - Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145239868 17:21234553-21234575 CAGTGTGGAAATAGAAGAAAGGG - Intergenic
1145983466 17:29028315-29028337 AAGTGTGGCGAGAAAAGAAAGGG - Intronic
1146504419 17:33392609-33392631 CAGTGTGGTGACAGGAGAGAGGG - Intronic
1146515724 17:33487715-33487737 CAGCGTGGCCAGAATAAAGAAGG + Intronic
1146894851 17:36534103-36534125 CACTGTGGGCAGAAAGGAGACGG + Exonic
1147319672 17:39638190-39638212 CAGCGTGGTAACAGAAGAGATGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148960630 17:51389711-51389733 AACTGAGGCCAGAGAGGAGAAGG + Intergenic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1150869990 17:68896557-68896579 CAGTGTGGACACAGAAGACAAGG - Intronic
1151381257 17:73727280-73727302 AGGTGTGTCCAGAGAAGAGAGGG + Intergenic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1152210496 17:79000670-79000692 CAGTGTGGTCAGGGGACAGAAGG - Intronic
1152816048 17:82408633-82408655 CAGTGCGGCCATGGAAGAGGCGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156432014 18:37085298-37085320 CTGTTTGGGCAGGGAAGAGAGGG - Intronic
1156781502 18:40856124-40856146 ACTTGTGGCCAGAGAAGAAAAGG - Intergenic
1157192885 18:45596144-45596166 CACTGTGGCAAGATAGGAGAGGG - Intronic
1158943208 18:62425336-62425358 CAGTGTGGCCCGAACACAGATGG - Intergenic
1158992683 18:62886200-62886222 AAGTGGGGACAGGGAAGAGATGG - Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1161960301 19:7519605-7519627 CAGTGAGGCCAGAGGAGATGGGG - Exonic
1162085177 19:8244508-8244530 AAGTGGAGCCAGAAAAGAGAAGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162934590 19:13975396-13975418 CAGTGTGGTCAGTCAAGAGGTGG + Intronic
1163017921 19:14467941-14467963 CATTGTGGCCCGAGACGAGGTGG + Exonic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1163325918 19:16603189-16603211 CAGGGCAGCCAAAGAAGAGAGGG + Intronic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1166231554 19:41427907-41427929 CATTGTGGAGAGGGAAGAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166351493 19:42200648-42200670 CACTGTGCCAAGAGGAGAGAAGG + Intronic
1166554037 19:43686374-43686396 CAGTGAGGCCAGAGAAGGACAGG - Intergenic
1166836885 19:45672830-45672852 CACTGTGGGGAAAGAAGAGAGGG - Exonic
1166866865 19:45843978-45844000 CAGACTGGCCAGTGAAGAGAAGG + Intronic
1167176619 19:47868965-47868987 CAGTGGGGTCAGATCAGAGATGG + Intergenic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167223120 19:48216594-48216616 CAGTTTGCCCAGAGAAGGGGAGG + Intronic
1167284189 19:48589521-48589543 GAGCGTGGACAGAGCAGAGAGGG + Intronic
1167288013 19:48609799-48609821 CAGTGTGCTCAGAGAACAGCTGG - Intronic
1167391203 19:49196417-49196439 CTGTGGGGGAAGAGAAGAGAAGG - Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925747594 2:7056770-7056792 TATTGAGGCAAGAGAAGAGAAGG - Intronic
925905973 2:8539833-8539855 CAGTGGGGCCAGGGATGATATGG - Intergenic
926176935 2:10602014-10602036 CAGTGTAGACAGAGAAGGGCAGG - Intronic
926843540 2:17108219-17108241 CAGTGAGGGAAGAGAAGAGATGG + Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927495393 2:23548586-23548608 CACTGTGGCAAAAGGAGAGATGG - Intronic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
927683663 2:25156255-25156277 CTGTGTGCCCACAGCAGAGATGG - Exonic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928390913 2:30910357-30910379 CAGAGTGGACAAAGAAGACAGGG - Intergenic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
929917616 2:46149189-46149211 CATGGTGGCCAGGGAAGAGGAGG - Intronic
930072143 2:47375014-47375036 TATTGTGTCCAGAGAACAGAGGG + Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
931789369 2:65650284-65650306 CAGTGGGGCCACAGATGAAATGG + Intergenic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
934516857 2:94993749-94993771 CAGTGTGGGCCGGGAAGAGCTGG + Intergenic
934630159 2:95910394-95910416 GAGTATAGCCAGAGAAGAAAAGG - Intronic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937669396 2:124522176-124522198 CAGAGTGGCAAGTGAAGAGCCGG - Intronic
937835754 2:126468939-126468961 CTGTGTGTCCTGAGAAGAGAGGG - Intergenic
937993929 2:127679295-127679317 AAGGGGGGGCAGAGAAGAGACGG + Intronic
938786823 2:134637358-134637380 GAGTGTGCCCTGAGATGAGATGG + Intronic
939177569 2:138767252-138767274 CAGTGTGGCCTGACCACAGAAGG + Intronic
939204988 2:139090154-139090176 CAGTGTGCCCAGAGTAGCCAAGG - Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
939695795 2:145322550-145322572 AAAAGTGGCAAGAGAAGAGATGG - Intergenic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
939918257 2:148075196-148075218 GAGTGTGGCCAAAGATGACAGGG + Intronic
940427385 2:153545761-153545783 TAGTGTGGCCAGACCAGAGTTGG - Intergenic
940811401 2:158246756-158246778 CAGGGAGACCAGAGAAGAAAAGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
945127280 2:206526548-206526570 CAGGGTTGCCATGGAAGAGAGGG + Intronic
945607230 2:211950030-211950052 GGGTGTGGCCAGAGAAGGGCCGG - Intronic
946093340 2:217249942-217249964 CTGAGGGGCCAGAGAAGTGAAGG - Intergenic
946157663 2:217817847-217817869 CAGCCTTGCCAGAGAAGCGAAGG - Exonic
946678373 2:222186897-222186919 CTGCATGGCCAGAGAAGAGATGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948246971 2:236494887-236494909 GGGTGTGGCCTGAGGAGAGAGGG + Intronic
948315547 2:237025927-237025949 GAGTGAGGACAGAAAAGAGAGGG + Intergenic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948428825 2:237905542-237905564 CTGTTTGGCCAGTGCAGAGATGG + Intronic
948458403 2:238117888-238117910 GAGGGTGGACAGAGGAGAGATGG + Intronic
1169745947 20:8942989-8943011 CATTGTGGTCAGAGGAGAGAAGG - Intronic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170834155 20:19869406-19869428 CAGTGTGGCCAGTGATGACGTGG - Intergenic
1172093296 20:32448375-32448397 CTGTGTGCCCAGACAAGAAAGGG + Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172758148 20:37301958-37301980 GACTGTGGCCAGAGCACAGAGGG + Intronic
1173252138 20:41369507-41369529 GAGTGTGGTCAGGGGAGAGAGGG + Intergenic
1173384093 20:42572421-42572443 CCATGTGGCCACAGCAGAGAAGG - Intronic
1173783268 20:45774048-45774070 GGGTGTGGCTAGGGAAGAGATGG - Intronic
1173892035 20:46520220-46520242 TACTGTGGGCAGAGAGGAGATGG + Intergenic
1174068780 20:47885473-47885495 TGGTGTGGCCAAAGAAGAGGAGG + Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174157272 20:48523805-48523827 CAGTGGGGGCAGAAGAGAGAAGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175380278 20:58557996-58558018 CAGGGTGGCAAGACAAGAGGTGG + Intergenic
1175485125 20:59340316-59340338 GTGTGTTGCAAGAGAAGAGATGG + Intergenic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1177331259 21:19666529-19666551 CAGAGTGTACAGGGAAGAGAAGG + Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1178712165 21:34927269-34927291 GAGTGTGGCAAGGGAAGAGGAGG - Intronic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179164815 21:38927059-38927081 GAGTGTGTCCATAAAAGAGATGG - Intergenic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1179895244 21:44358197-44358219 CAGGGTGGCCACAGCAGACACGG - Intronic
1179947924 21:44691093-44691115 AAGTGTGGAGAGAGGAGAGAAGG - Intronic
1179982973 21:44906005-44906027 CAGTGAGGCCAGGGAAGGAAGGG - Intronic
1180063171 21:45396902-45396924 GAGAGGGGCCAGAGAAGAGGAGG + Intergenic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181311313 22:21946384-21946406 CAGCGTGGCCAGAGACGAGCAGG + Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182146342 22:27999062-27999084 CAGTGTGGCCACCAAGGAGAGGG - Exonic
1182278865 22:29206647-29206669 CATTTTGGACAGAGAAAAGAGGG + Intronic
1182431692 22:30302589-30302611 CAGTATGGCCACAGCTGAGATGG + Intronic
1182916505 22:34037672-34037694 CTGAGGGGACAGAGAAGAGATGG + Intergenic
1183244338 22:36682208-36682230 GAGTGAAGCCAGTGAAGAGACGG + Intronic
1183406861 22:37634463-37634485 CAGTGTGGGCCCAGCAGAGAGGG - Intergenic
1184067608 22:42129362-42129384 CAGGGTGGGCAGAGACGAGGTGG - Intronic
1184070346 22:42143058-42143080 CAGGGTGGGCAGAGACGAGGTGG - Intergenic
1184198864 22:42951359-42951381 TAGTGTGCACAGAGAAGAGGAGG - Intronic
1184334943 22:43847585-43847607 GAGGCTGGCCAGAGAAGAGGGGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1185001310 22:48248178-48248200 AAGTCAGGCCAGAGAAGACACGG + Intergenic
949305543 3:2636305-2636327 CAGAGGGGCCAAAGAAGAGAGGG - Intronic
949898084 3:8785168-8785190 CAGTGTGTCTAGAGAAGGGATGG + Intronic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950499546 3:13354945-13354967 CTATGTGGCCAGAGAAGGGAGGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
951670156 3:25172298-25172320 CAGAGGGGCAAGAGCAGAGAAGG + Intergenic
952389209 3:32865427-32865449 CAGTGTGGCCTGAGAAAGGGTGG - Intronic
953298938 3:41751933-41751955 GAGTGTGCCCAAAGAAGACAAGG + Intronic
953437527 3:42890330-42890352 CAGAGGAGCCAGAGAAGTGATGG + Intronic
953546751 3:43869202-43869224 CAGAGTGTCCAGAGAAGAAGAGG + Intergenic
954464514 3:50646716-50646738 TAGGGGGGCCAGGGAAGAGAGGG - Intronic
954826066 3:53374603-53374625 CAGAGTGGAAAGAGAAGATATGG - Intergenic
954941334 3:54375816-54375838 GAGGGTTTCCAGAGAAGAGATGG + Intronic
955044185 3:55344345-55344367 GAGTGTGGCAAGAGAAGGGTGGG + Intergenic
955612301 3:60770471-60770493 TTGTGTGGCCTGAGAAGAGGAGG - Intronic
955970021 3:64429693-64429715 CTGTGTTGACAGAGAAGTGAGGG + Intronic
956392463 3:68788238-68788260 TAGTGTGGCCAGGGTAGTGAGGG - Intronic
956412696 3:68995111-68995133 CAGTTTGCCCAGGGAAGAGCAGG - Intronic
956630911 3:71315784-71315806 CAAAGAGGCCAGAGAACAGAAGG + Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957215080 3:77309708-77309730 CAGTGTCTCTAAAGAAGAGAAGG - Intronic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960202538 3:114855041-114855063 CATTATGGCCAAAGAAGATATGG - Intronic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
960358637 3:116683626-116683648 TAGTGTGGCCAGAGATCAGGAGG - Intronic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961829420 3:129615853-129615875 CCGTGTGGGCAGAGCAGAGGAGG + Intergenic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962352556 3:134666469-134666491 CAGTCTGGGGAGAGATGAGAGGG - Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
963618931 3:147579866-147579888 CAGTGTAGCCACAGAAGAGAAGG + Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
966135692 3:176695714-176695736 TAGTGTGGACAGAGACAAGACGG + Intergenic
966740085 3:183224588-183224610 GAGGGTGGAGAGAGAAGAGAGGG - Intronic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
966974223 3:185070732-185070754 GAGTCTGCCCAGAGTAGAGATGG + Intergenic
967897226 3:194407532-194407554 CAGCGGGGCCAGGGAGGAGAGGG - Intronic
967979007 3:195054338-195054360 CAGTTTCTCCAGAGAATAGAAGG + Intergenic
968226564 3:196976059-196976081 CAGCTGGGCCAGAGAAAAGAAGG - Intergenic
968782885 4:2596481-2596503 CAGTGTGGCCAGGGAAGACCAGG - Intronic
968788513 4:2642416-2642438 CACAGTGGCCACAGAAGGGAAGG - Intronic
969323108 4:6424911-6424933 CTGTGTGGCCACAGAACAGCAGG + Intronic
969429565 4:7146234-7146256 AAGTGTGGGCAGGGAGGAGAGGG + Intergenic
969691260 4:8705400-8705422 CAGGGTGGCCTGGGGAGAGAGGG + Intergenic
969934305 4:10666035-10666057 AAATATGGCCAGAGAGGAGAAGG + Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970483761 4:16504068-16504090 CACTGAGGCCAGAGAAGGTAGGG + Intronic
971216057 4:24663129-24663151 CAGTGTGCTCAAAGAAGAAATGG - Intergenic
971302963 4:25456916-25456938 CAGTGTTGACAGAGAGGAGGGGG - Intergenic
973172858 4:47166806-47166828 GAGTGGGGGCAGAGAAGGGAGGG - Intronic
975879336 4:78884624-78884646 CACTGAGGACAGAGAAAAGAGGG - Intronic
977150669 4:93507664-93507686 CAGTGCAGACAGAGAAGATAAGG - Intronic
977514558 4:98005193-98005215 CAGTGTGGCTAGAAAAAAGGAGG - Intronic
978297057 4:107217720-107217742 TAGTGTGGATAGAGAAAAGAAGG - Intronic
978453815 4:108866015-108866037 TAGTGTGGACAAGGAAGAGATGG - Intronic
978964535 4:114725405-114725427 GAGGATGGCCAGAGAAGAAAAGG - Intergenic
980901408 4:138908611-138908633 AACTGTGGTCAGAAAAGAGAGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981339991 4:143610768-143610790 AAATTTAGCCAGAGAAGAGAGGG - Intronic
981390093 4:144179452-144179474 CAATGGGGCCTGAGAGGAGAGGG + Intergenic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
982338705 4:154270640-154270662 CTGTGAGAACAGAGAAGAGAGGG + Intronic
982404849 4:155008172-155008194 CAGTGTGCCTAGAGAAAAGGAGG - Intergenic
983523439 4:168735250-168735272 CAGTGGGGCGAGAGCAGTGAGGG - Intronic
983936794 4:173508043-173508065 CAGTCCGCCCTGAGAAGAGAGGG + Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
984888075 4:184468699-184468721 GTGTGTGGCCAGAGTAGAAATGG - Intronic
985004020 4:185514672-185514694 CACTGTGGCCAGAACAGAGCCGG + Intronic
985729357 5:1538599-1538621 GAGGGTGTGCAGAGAAGAGAGGG - Intergenic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
986945262 5:13010546-13010568 AAGTATGGTCAGAGAAGAGAAGG - Intergenic
988478549 5:31609998-31610020 CATTTTGGCTAGACAAGAGAGGG + Intergenic
988581377 5:32471836-32471858 AAGTGTAGCAAGAGAAGAGAAGG - Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
988714046 5:33807067-33807089 CAGAGAGGCCAGAGGAGAAAGGG - Intronic
988929835 5:36027189-36027211 CAGAGTGTCCAGAAAACAGATGG + Intergenic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
991465368 5:66906855-66906877 AAGGGTGTCCAGAGATGAGATGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992892150 5:81213398-81213420 CATTGGTGCCAGAGAATAGAAGG + Intronic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
993718092 5:91295240-91295262 CAGTGTGCCCAGAAAAGGCATGG + Intergenic
994340719 5:98624727-98624749 CTGTGTGTACAGAGAAGGGATGG - Intergenic
994909660 5:105886332-105886354 CAATGTGGCCCCAGAAGAAAGGG + Intergenic
995227616 5:109720149-109720171 CAGTGTGTGGAGAGAAGATAAGG + Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
996541667 5:124636238-124636260 CAGAGTGGCCACTAAAGAGATGG - Intergenic
997340726 5:133142486-133142508 CTGTGCGGCCAGGGAGGAGATGG + Intergenic
997716676 5:136047865-136047887 CAGTGTGGACACAGAAGTCAAGG + Intronic
998597801 5:143552234-143552256 CAGTGGGTCCAGAGAACACAAGG + Intergenic
998712297 5:144841021-144841043 CAGGCTGCCCTGAGAAGAGAGGG + Intergenic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999361140 5:150987744-150987766 CAGTGCTGGCAGAGAAGGGAGGG + Intergenic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000369928 5:160525388-160525410 TAGTGTCACCAGAGAATAGAGGG + Intergenic
1000847240 5:166297025-166297047 GAGTGTAGACAGAGAAAAGATGG - Intergenic
1000897182 5:166869191-166869213 CTGGGTAGACAGAGAAGAGAAGG - Intergenic
1001006296 5:168053392-168053414 AAGTGTGGCCAGTGAGGATATGG - Intronic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1002843346 6:924493-924515 CAGAGTTGTCAGAGAAGAGTCGG + Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003688022 6:8323712-8323734 CAGTGTGGCAGGAGAAGGGCAGG - Intergenic
1003994307 6:11523430-11523452 GAGTGTGGCCAGAGAACCAAGGG + Intergenic
1005423374 6:25675806-25675828 GAGAGTGGACATAGAAGAGAAGG - Intronic
1006395642 6:33785495-33785517 GAGTGTGTCCAGATCAGAGAAGG + Intronic
1008011109 6:46468738-46468760 GAGTGGGGAGAGAGAAGAGAGGG - Intronic
1008055524 6:46941788-46941810 ATGTGTGGGGAGAGAAGAGATGG - Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010065018 6:71672500-71672522 CAGTGTGGCAAAAGAAAAAAAGG - Intergenic
1010128338 6:72461610-72461632 CAGCCTGGCTAGAGAAGTGAAGG - Intergenic
1010836207 6:80589839-80589861 CAGTTTGCCCAGAAAAGGGATGG + Intergenic
1011173629 6:84535344-84535366 CAGGGTGGCAAGAAAAGTGAGGG - Intergenic
1011247687 6:85336867-85336889 CAGAGTGACCAGAGAAGAAGAGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012281778 6:97336217-97336239 TAGTGTGGCCAGAAAAGAAGAGG - Intergenic
1012737772 6:102973142-102973164 AAGTTTGGAAAGAGAAGAGAAGG + Intergenic
1012997035 6:105984479-105984501 CAGTGTAGCCAGACAGGAGTGGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013561438 6:111309363-111309385 CAGGGCAGTCAGAGAAGAGACGG - Intronic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014799874 6:125766838-125766860 CAGTGTGGCCAGATAATTCATGG - Intergenic
1015525599 6:134173067-134173089 CAGTCTGGAAAGAGAAGTGAAGG + Exonic
1015720397 6:136235487-136235509 CAGCATGGACAGAGAAGAGAGGG + Intronic
1016282669 6:142436202-142436224 CAATGTAACCATAGAAGAGATGG + Intronic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018141771 6:160844909-160844931 CAGTTAGCCCAGAGAAAAGATGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1018757443 6:166862570-166862592 GAGCGTGGCCAGGGAAGGGAGGG - Intronic
1018942128 6:168315430-168315452 CTGTGTGGCCAGTCCAGAGAGGG - Intronic
1019362628 7:613077-613099 CAGTGTTGCCAGTGAAAATAGGG + Intronic
1020282198 7:6655349-6655371 AAGTGTGGGTAGAGAAGAGGAGG - Exonic
1020428383 7:8094975-8094997 CAGTGTGGCATAAGAAGAAATGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022088672 7:27093660-27093682 GAGGGTGGCCCGAGAAGAAAGGG + Exonic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023102347 7:36731680-36731702 CATTGTGGTCAGAAAAGATACGG + Intergenic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1024989748 7:55223874-55223896 CTGTGTGTCCAGGAAAGAGAGGG - Intronic
1025307115 7:57870422-57870444 CATTTTGTTCAGAGAAGAGATGG - Intergenic
1026135375 7:67656207-67656229 CAGTGTGTCCAGAGATCACATGG + Intergenic
1026422611 7:70256349-70256371 CAGTGGGCCAAGAGAACAGAGGG + Intronic
1026454012 7:70555136-70555158 CAGTGGAGACAGAGAAGGGATGG + Intronic
1026455696 7:70570736-70570758 CAGTAAGGTCACAGAAGAGAGGG - Intronic
1026602380 7:71787292-71787314 CAGGGTTGCCACAGAAGAGGGGG - Exonic
1027878085 7:83797576-83797598 TAGTGTGCCCAAAGAAGACATGG - Intergenic
1027980912 7:85220765-85220787 CAGTGTTGACAGAGAAGGAAAGG + Intergenic
1028315201 7:89393030-89393052 CAGTGTGGTGTGAGAAGAGATGG + Intergenic
1029015490 7:97311625-97311647 CAGAGTGGCTAGAGAAGGGTAGG + Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029792924 7:102864199-102864221 GAGCATGGCCAGAGAAGAGAGGG - Intronic
1030297935 7:107947572-107947594 CAGTGTGGCCTGTGAAGGCAGGG - Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1032508076 7:132450994-132451016 AGGTGTGGCTACAGAAGAGAGGG - Intronic
1032701036 7:134379328-134379350 CACTATGACAAGAGAAGAGAGGG - Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1035104651 7:156432106-156432128 AAATGAGGACAGAGAAGAGAGGG + Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036987069 8:13545445-13545467 CAGTTTGGCCAGGAAAGAAAAGG - Intergenic
1037145576 8:15567994-15568016 CAATGTGGCCATAGAAAAGGGGG - Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037709324 8:21342985-21343007 CAGTGTGGCCACAGGAGGAAAGG - Intergenic
1037955862 8:23057956-23057978 CATTGTGCCCAGCCAAGAGATGG - Intronic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1038800533 8:30744772-30744794 CAGTGGGGGCAGGGAAGGGATGG + Intronic
1039477067 8:37844668-37844690 CAGGGTGGCAAGAGAAGGGCAGG + Exonic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1041979021 8:63833930-63833952 CAGACTAGCAAGAGAAGAGATGG + Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042593941 8:70425417-70425439 TAGTGTGGCCACCGAAGGGAGGG - Intergenic
1043679224 8:83000764-83000786 CAGAGTGATCAGACAAGAGAAGG + Intergenic
1044017366 8:87060063-87060085 CTGTGTGGCCAGTGAAGGGCTGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045065720 8:98442176-98442198 CAGTGGTGTTAGAGAAGAGAGGG - Intronic
1045226971 8:100257672-100257694 CAAGGTGACCAGAGAAGACATGG + Exonic
1047429875 8:124781883-124781905 CAGTGAAGCCAAAGAGGAGAAGG + Intergenic
1047977189 8:130142208-130142230 CAGAGTGACCGCAGAAGAGAAGG - Intronic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048340511 8:133534989-133535011 CAGTGTGGTCAGTGAAAGGAAGG + Intronic
1049433697 8:142576688-142576710 CAGAGTGGACAGAACAGAGATGG + Intergenic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051715425 9:19977941-19977963 CAGGGTGGACAGATAAGTGATGG + Intergenic
1052760135 9:32581820-32581842 CACAGTGGGCAGGGAAGAGATGG + Intergenic
1052901249 9:33796518-33796540 CAGTGAGGCCAGGCAAGGGAGGG - Intronic
1054824197 9:69555263-69555285 CTGTGTGGCGAGGGAATAGAAGG + Intronic
1055354317 9:75421897-75421919 CAGAGTGGGAAAAGAAGAGAAGG + Intergenic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1056755163 9:89377060-89377082 CAGAGAGGACAGAAAAGAGAGGG + Exonic
1056965912 9:91162814-91162836 CAGTATGGCAAGTGAGGAGAAGG - Intergenic
1056971803 9:91210948-91210970 CTGTGTGGCAAGACATGAGATGG - Intergenic
1057273018 9:93661136-93661158 CCCTGTGGACAGTGAAGAGATGG + Intronic
1057495106 9:95554272-95554294 CAGTCTGGATAGAGAAGAGAAGG - Intergenic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058906638 9:109487319-109487341 CACTGTGGCAAGAGCAGGGAGGG + Intronic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059476559 9:114552173-114552195 CAGAGTGGCCAGACTAGGGAAGG - Intergenic
1060292159 9:122313997-122314019 CAGAGTGGCTAGATAATAGAAGG + Intronic
1061432074 9:130537347-130537369 CAGTGGGGCCAGCGAGGAAAGGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1062123630 9:134847901-134847923 TGGTGTGGCCTGAGCAGAGATGG + Intergenic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1186653275 X:11585112-11585134 CTATGTGGCCATAAAAGAGAGGG - Intronic
1187470381 X:19564540-19564562 GAGAGAGGCGAGAGAAGAGAGGG - Intronic
1187820276 X:23280058-23280080 CTATGTGGCCATAGAAAAGAGGG + Intergenic
1188726287 X:33587311-33587333 CAATATGGCAAGAGAAGAGAGGG - Intergenic
1189258735 X:39661558-39661580 CAGTGTGGGTAGAAACGAGAAGG - Intergenic
1189422234 X:40866443-40866465 CCATGTGGCCAAAGTAGAGATGG - Intergenic
1189743353 X:44144032-44144054 GACTGTTGCCAGAGAAGTGATGG - Intergenic
1190525101 X:51321361-51321383 GAGTGTAGGCAGAGAAGAGAAGG + Intergenic
1191841838 X:65518868-65518890 CAGCTAGGCCAGAGAAGAGAGGG - Intronic
1191859723 X:65656479-65656501 CAGCTAGGCCAGAGAAGAGAGGG - Intronic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1196868549 X:120091019-120091041 TAGGGAGGGCAGAGAAGAGATGG + Intergenic
1197121601 X:122899770-122899792 CAGTGTGTCCATGGAAGAAAGGG - Intergenic
1197690097 X:129490126-129490148 CAGTGTTGTCAGTGATGAGACGG + Exonic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197878969 X:131144407-131144429 CAGTGAGGATAGAGAACAGATGG - Intergenic
1198024526 X:132692331-132692353 CAGTGTGGTCAGTGCAGTGATGG + Intronic
1198270989 X:135055872-135055894 CAGAGTGGTTAGAGAAGAGTTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1199466354 X:148141977-148141999 CTGTGTGGCCATAAAAAAGAAGG + Intergenic
1199472961 X:148215244-148215266 CAGTGGGGCCTGAGATGGGATGG + Intergenic
1199870918 X:151898021-151898043 TAGTGAGGCCAGAGATGAAAGGG - Intergenic
1199987316 X:152962109-152962131 CATTGTGGACAAAGAAGATAGGG + Intronic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic